Flagella-mediated Motility Research Articles

The Dynamic Interactions between Salmonella and the Microbiota, within the Challenging Niche of the Gastrointestinal Tract

Understanding how Salmonella species establish successful infections remains a foremost research priority. This gastrointestinal pathogen not only faces the hostile defenses of the host's immune system, but also faces fierce competition from the large and diverse community of microbiota for space and nutrients. Salmonella have solved these challenges ingeniously. To jump-start growth, Salmonella steal hydrogen produced by the gastrointestinal microbiota. Type 3 effector proteins are subsequently secreted by Salmonella to trigger potent inflammatory responses, which generate the alternative terminal electron acceptors tetrathionate and nitrate. Salmonella exclusively utilize these electron acceptors for anaerobic respiration, permitting metabolic access to abundant substrates such as ethanolamine to power growth blooms. Chemotaxis and flagella-mediated motility enable the identification of nutritionally beneficial niches. The resulting growth blooms also promote horizontal gene transfer amongst the resident microbes. Within the gastrointestinal tract there are opportunities for chemical signaling between host cells, the microbiota, and Salmonella. Host produced catecholamines and bacterial autoinducers form components of this chemical dialogue leading to dynamic interactions. Thus, Salmonella have developed remarkable strategies to initially shield against host defenses and to transiently compete against the intestinal microbiota leading to successful infections. However, the immunocompetent host is subsequently able to reestablish control and clear the infection.

LysPGS formation in Listeria monocytogenes has broad roles in maintaining membrane integrity beyond antimicrobial peptide resistance

Listeria monocytogenes is an intracellular, foodborne gastrointestinal pathogen that is primarily responsible for causing listeriosis or food poisoning in otherwise healthy individuals. Infections that arise during pregnancy or within immune compromised individuals are much more serious resulting in the risk of fetal termination or fetal fatality postpartum in the former and septicemia or meningitis with a 20% fatality rate in the latter. While the roles of internalin proteins and listeriolysin-O in the infection process are well characterized, the specific roles of lysine-modified phospholipids in the membrane of L. monocytogenes are not. Investigation into the lipid bilayer composition of L. monocytogenes indicated that the overall proportions of lipids, including lysylcardiolipin and lysylphosphatidylglycerol (LysPG), vary with growth temperature and growth phase. In addition, we demonstrate that LysPG formation is essential for L. monocytogenes survival in the presence of increased osmolytic stress but has no effect on bacterial adherence, invasion or survival in the presence of physiologically relevant concentrations of human neutrophil peptide (HNP-1). In the absence of LysPG synthesis, L. monocytogenes unexpectedly retained flagellum-mediated motility at 37 °C. Taken together, these findings show that LysPG formation in L. monocytogenes has broader functions in virulence and survival beyond its known role in the modification of membrane potential previously observed in other bacteria.

Changes in the proteome of the cadmium-tolerant bacteria Cupriavidus taiwanensis KKU2500-3 in response to cadmium toxicity

Cupriavidus taiwanensis KKU2500-3 is a cadmium (Cd)-tolerant bacterial strain that was previously isolated from rice fields contaminated with high levels of Cd. In 500 μmol/L CdCl2, the KKU2500-3 strain grew slower and with a more prolonged lag-phase than when grown in the absence of Cd. A proteomic approach was used to characterize the protein expression in the Cd-tolerant bacteria C. taiwanensis KKU2500-3 during growth under Cd stress. When compared with the untreated cells, a total of 982 differentially expressed protein spots were observed in the CdCl2-treated cells, and 59 and 10 spots exhibited >2- and >4-fold changes, respectively. The level of up- and downregulation varied from 2.01- to 11.26-fold and from 2.01- to 5.34-fold, respectively. Of the 33 differentially expressed protein spots analyzed by MALDI TOF MS/MS, 19 spots were successfully identified, many of which were involved in stress responses. The most highly upregulated protein (+7.95-fold) identified was the chaperone GroEL, which indicated that this factor likely contributed to the bacterial survival and growth in response to Cd toxicity. Detection of the downregulated protein flagellin (-3.52-fold) was consistent with the less effective ATP-mediated and flagella-driven motility. The flagella-losing cells were also observed in the Cd-treated bacteria when analyzed by scanning electron microscopy. Thus, the Cd-stressed cells may downregulate pathways involving ATP utilization in favor of other mechanisms in response to Cd toxicity. When the KKU2500-3 strain was grown in the presence of Cd, H2S was not detected, suggesting a possible role of the sulfur in precipitation with Cd. Apart from a general response, no specific process could be determined using the present proteomic approach. However, the potential role of protein folding-mediated GroEL, flagella-mediated motility and CdS biotransformation in Cd toxicity response observed in this study as well as the extent of Cd-tolerant mechanisms using other methods could facilitate the future application of this strain in addressing Cd environmental contamination.

High-Throughput Screening Using the Differential Radial Capillary Action of Ligand Assay Identifies Ebselen As an Inhibitor of Diguanylate Cyclases

The rise of bacterial resistance to traditional antibiotics has motivated recent efforts to identify new drug candidates that target virulence factors or their regulatory pathways. One such antivirulence target is the cyclic-di-GMP (cdiGMP) signaling pathway, which regulates biofilm formation, motility, and pathogenesis. Pseudomonas aeruginosa is an important opportunistic pathogen that utilizes cdiGMP-regulated polysaccharides, including alginate and pellicle polysaccharide (PEL), to mediate virulence and antibiotic resistance. CdiGMP activates PEL and alginate biosynthesis by binding to specific receptors including PelD and Alg44. Mutations that abrogate cdiGMP binding to these receptors prevent polysaccharide production. Identification of small molecules that can inhibit cdiGMP binding to the allosteric sites on these proteins could mimic binding defective mutants and potentially reduce biofilm formation or alginate secretion. Here, we report the development of a rapid and quantitative high-throughput screen for inhibitors of protein-cdiGMP interactions based on the differential radial capillary action of ligand assay (DRaCALA). Using this approach, we identified ebselen as an inhibitor of cdiGMP binding to receptors containing an RxxD domain including PelD and diguanylate cyclases (DGC). Ebselen reduces diguanylate cyclase activity by covalently modifying cysteine residues. Ebselen oxide, the selenone analogue of ebselen, also inhibits cdiGMP binding through the same covalent mechanism. Ebselen and ebselen oxide inhibit cdiGMP regulation of biofilm formation and flagella-mediated motility in P. aeruginosa through inhibition of diguanylate cyclases. The identification of ebselen provides a proof-of-principle that a DRaCALA high-throughput screening approach can be used to identify bioactive agents that reverse regulation of cdiGMP signaling by targeting cdiGMP-binding domains.

Sodium houttuyfonate, a potential phytoanticipin derivative of antibacterial agent, inhibits bacterial attachment and pyocyanine secretion of Pseudomonas aeruginosa by attenuating flagella-mediated swimming motility

Pseudomonas aeruginosa is a well-known clinical pathogen for its recalcitrant infection caused by biofilm formation which are initiated by flagella-mediated attachment. Sodium houttuyfonate (SH) is a natural phytoanticipin derivative of houttuynin and has anti-pathogenic effect on P. aeruginosa biofilm formation. In this paper, when using 1/2×MIC SH, the diameter of P. aeruginosa swimming motility was sharply shortened to 36% in 24h incubation, and the fold changes of fliC required for swimming motility was 0.36 in 24h cultivation, the adherence inhibition accounted for about 46%, and the pyocyanin production decreased to 47% after 1-day treatment and 56% after 3-day treatment with obvious visual changes from dark green to light green, compared with the negative control. With the help of mass spectra and scanning electronic microscope, 1/2×MIC SH was further testified to be enough to eradicate flagella and inhibit pyocyanin secretion of P. aeruginosa. The results do not only re-affirm the close interplay of attachment and virulence (i.e. swimming motility and pyocyanin), but also unravel the potential mechanism of SH on anti-biofilm of P. aeruginosa.

Thermo-Regulation of Genes Mediating Motility and Plant Interactions in Pseudomonas syringae

Pseudomonas syringae is an important phyllosphere colonist that utilizes flagellum-mediated motility both as a means to explore leaf surfaces, as well as to invade into leaf interiors, where it survives as a pathogen. We found that multiple forms of flagellum-mediated motility are thermo-suppressed, including swarming and swimming motility. Suppression of swarming motility occurs between 28° and 30°C, which coincides with the optimal growth temperature of P. syringae. Both fliC (encoding flagellin) and syfA (encoding a non-ribosomal peptide synthetase involved in syringafactin biosynthesis) were suppressed with increasing temperature. RNA-seq revealed 1440 genes of the P. syringae genome are temperature sensitive in expression. Genes involved in polysaccharide synthesis and regulation, phage and IS elements, type VI secretion, chemosensing and chemotaxis, translation, flagellar synthesis and motility, and phytotoxin synthesis and transport were generally repressed at 30°C, while genes involved in transcriptional regulation, quaternary ammonium compound metabolism and transport, chaperone/heat shock proteins, and hypothetical genes were generally induced at 30°C. Deletion of flgM, a key regulator in the transition from class III to class IV gene expression, led to elevated and constitutive expression of fliC regardless of temperature, but did not affect thermo-regulation of syfA. This work highlights the importance of temperature in the biology of P. syringae, as many genes encoding traits important for plant-microbe interactions were thermo-regulated.

Isolation of Salmonella Mutants Resistant to the Inhibitory Effect of Salicylidene acylhydrazides on Flagella-Mediated Motility

Salicylidene acylhydrazides identified as inhibitors of virulence-mediating type III secretion systems (T3SSs) potentially target their inner membrane export apparatus. They also lead to inhibition of flagellar T3SS-mediated swimming motility in Salmonella enterica serovar. Typhimurium. We show that INP0404 and INP0405 act by reducing the number of flagella/cell. These molecules still inhibit motility of a Salmonella ΔfliH-fliI-fliJ/flhB (P28T) strain, which lacks three soluble components of the flagellar T3S apparatus, suggesting that they are not the target of this drug family. We implemented a genetic screen to search for the inhibitors' molecular target(s) using motility assays in the ΔfliH-fliI/flhB (P28T) background. Both mutants identified were more motile than the background strain in the absence of the drugs, although HM18 was considerably more so. HM18 was more motile than its parent strain in the presence of both drugs while DI15 was only insensitive to INP0405. HM18 was hypermotile due to hyperflagellation, whereas DI15 was not hyperflagellated. HM18 was also resistant to a growth defect induced by high concentrations of the drugs. Whole-genome resequencing of HM18 indicated two alterations within protein coding regions, including one within atpB, which encodes the inner membrane a-subunit of the FOF1-ATP synthase. Reverse genetics indicated that the alteration in atpB was responsible for all of HM18's phenotypes. Genome sequencing of DI15 uncovered a single A562P mutation within a gene encoding the flagellar inner membrane protein FlhA, the direct role of which in mediating drug insensitivity could not be confirmed. We discuss the implications of these findings in terms of T3SS export apparatus function and drug target identification.

Anaerobic Respiration Using a Complete Oxidative TCA Cycle Drives Multicellular Swarming in Proteus mirabilis

ABSTRACTProteus mirabilis rapidly migrates across surfaces using a periodic developmental process of differentiation alternating between short swimmer cells and elongated hyperflagellated swarmer cells. To undergo this vigorous flagellum-mediated motility, bacteria must generate a substantial proton gradient across their cytoplasmic membranes by using available energy pathways. We sought to identify the link between energy pathways and swarming differentiation by examining the behavior of defined central metabolism mutants. Mutations in the tricarboxylic acid (TCA) cycle (fumC and sdhB mutants) caused altered patterns of swarming periodicity, suggesting an aerobic pathway. Surprisingly, the wild-type strain swarmed on agar containing sodium azide, which poisons aerobic respiration; the fumC TCA cycle mutant, however, was unable to swarm on azide. To identify other contributing energy pathways, we screened transposon mutants for loss of swarming on sodium azide and found insertions in the following genes that involved fumarate metabolism or respiration: hybB, encoding hydrogenase; fumC, encoding fumarase; argH, encoding argininosuccinate lyase (generates fumarate); and a quinone hydroxylase gene. These findings validated the screen and suggested involvement of anaerobic electron transport chain components. Abnormal swarming periodicity of fumC and sdhB mutants was associated with the excretion of reduced acidic fermentation end products. Bacteria lacking SdhB were rescued to wild-type pH and periodicity by providing fumarate, independent of carbon source but dependent on oxygen, while fumC mutants were rescued by glycerol, independent of fumarate only under anaerobic conditions. These findings link multicellular swarming patterns with fumarate metabolism and membrane electron transport using a previously unappreciated configuration of both aerobic and anaerobic respiratory chain components.

The genome of the ammonia‐oxidizing CandidatusNitrososphaera gargensis: insights into metabolic versatility and environmental adaptations

The cohort of the ammonia-oxidizing archaea (AOA) of the phylum Thaumarchaeota is a diverse, widespread and functionally important group of microorganisms in many ecosystems. However, our understanding of their biology is still very rudimentary in part because all available genome sequences of this phylum are from members of the Nitrosopumilus cluster. Here we report on the complete genome sequence of Candidatus Nitrososphaera gargensis obtained from an enrichment culture, representing a different evolutionary lineage of AOA frequently found in high numbers in many terrestrial environments. With its 2.83 Mb the genome is much larger than that of other AOA. The presence of a high number of (active) IS elements/transposases, genomic islands, gene duplications and a complete CRISPR/Cas defence system testifies to its dynamic evolution consistent with low degree of synteny with other thaumarchaeal genomes. As expected, the repertoire of conserved enzymes proposed to be required for archaeal ammonia oxidation is encoded by N. gargensis, but it can also use urea and possibly cyanate as alternative ammonia sources. Furthermore, its carbon metabolism is more flexible at the central pyruvate switch point, encompasses the ability to take up small organic compounds and might even include an oxidative pentose phosphate pathway. Furthermore, we show that thaumarchaeota produce cofactor F420 as well as polyhydroxyalkanoates. Lateral gene transfer from bacteria and euryarchaeota has contributed to the metabolic versatility of N. gargensis. This organisms is well adapted to its niche in a heavy metal-containing thermal spring by encoding a multitude of heavy metal resistance genes, chaperones and mannosylglycerate as compatible solute and has the genetic ability to respond to environmental changes by signal transduction via a large number of two-component systems, by chemotaxis and flagella-mediated motility and possibly even by gas vacuole formation. These findings extend our understanding of thaumarchaeal evolution and physiology and offer many testable hypotheses for future experimental research on these nitrifiers.

Structural and functional importance of outer membrane proteins in Vibrio cholerae flagellum

Vibrio cholerae has a sheath-covered monotrichous flagellum that is known to contribute to virulence. Although the structural organization of the V. cholerae flagellum has been extensively studied, the involvement of outer membrane proteins as integral components in the flagellum still remains elusive. Here we show that flagella produced by V. cholerae O1 El Tor strain C6706 were two times thicker than those from two other Gram-negative bacteria. A C6706 mutant strain (SSY11) devoid of two outer membrane proteins (OMPs), OmpU and OmpT, produced thinner flagella. SSY11 showed significant defects in the flagella-mediated motility as compared to its parental strain. Moreover, increased shedding of the flagella-associated proteins was observed in the culture supernatant of SSY11. This finding was also supported by the observation that culture supernatants of the SSY11 strain induced the production of a significantly higher level of IL-8 in human colon carcinoma HT29 and alveolar epithelial A549 cells than those of the wild-type C6706 strain. These results further suggest a definite role of these two OMPs in providing the structural integrity of the V. cholerae flagellum as part of the surrounding sheath.

Pomegranate materials inhibit flagellin gene expression and flagellar-propelled motility of uropathogenic Escherichia coli strain CFT073

This report describes the inhibitory effect of pomegranate rind extract (PGRE) on the motility of uropathogenic Escherichia coli (UPEC), a common agent of uncomplicated urinary tract infections (UTIs). To this end, a fliC-lux reporter, as well as Western blot analysis and scanning electron microscopy, was used to demonstrate that when UPEC strain CFT073 is exposed to PGRE, expression of the flagellin gene, fliC, and flagellin production decrease. In agreement with these results, the swimming and swarming motilities of UPEC were observed to be hindered in the presence of PGRE. To evaluate the effect of other pomegranate materials (PMs), the hydrolysable tannins in pomegranate (PG; punicalagin) and pomegranate fruit powder (PGP) were also investigated. Of the materials tested, PGRE had the strongest inhibitory effect on fliC expression and motility. Moreover, a fractionation of PGRE showed fractions with a molecular weight between 1000 and 3000kDa to be the strongest inhibitors of fliC expression. Because flagellum-mediated motility has been suggested to enable UPEC to disseminate to the upper urinary tract; we propose that PGRE might be therapeutically beneficial in the treatment and prevention of UTIs.

Characterization of Pro-Inflammatory Flagellin Proteins Produced by Lactobacillus ruminis and Related Motile Lactobacilli

Lactobacillus ruminis is one of at least twelve motile but poorly characterized species found in the genus Lactobacillus. Of these, only L. ruminis has been isolated from mammals, and this species may be considered as an autochthonous member of the gastrointestinal microbiota of humans, pigs and cows. Nine L. ruminis strains were investigated here to elucidate the biochemistry and genetics of Lactobacillus motility. Six strains isolated from humans were non-motile while three bovine isolates were motile. A complete set of flagellum biogenesis genes was annotated in the sequenced genomes of two strains, ATCC25644 (human isolate) and ATCC27782 (bovine isolate), but only the latter strain produced flagella. Comparison of the L. ruminis and L. mali DSM20444T motility loci showed that their genetic content and gene-order were broadly similar, although the L. mali motility locus was interrupted by an 11.8 Kb region encoding rhamnose utilization genes that is absent from the L. ruminis motility locus. Phylogenetic analysis of 39 motile bacteria indicated that Lactobacillus motility genes were most closely related to those of motile carnobacteria and enterococci. Transcriptome analysis revealed that motility genes were transcribed at a significantly higher level in motile L. ruminis ATCC27782 than in non-motile ATCC25644. Flagellin proteins were isolated from L. ruminis ATCC27782 and from three other Lactobacillus species, while recombinant flagellin of aflagellate L. ruminis ATCC25644 was expressed and purified from E. coli. These native and recombinant Lactobacillus flagellins, and also flagellate L. ruminis cells, triggered interleukin-8 production in cultured human intestinal epithelial cells in a manner suppressed by short interfering RNA directed against Toll-Like Receptor 5. This study provides genetic, transcriptomic, phylogenetic and immunological insights into the trait of flagellum-mediated motility in the lactobacilli.

Osmotic spreading of Bacillus subtilis biofilms driven by an extracellular matrix

Bacterial biofilms are organized communities of cells living in association with surfaces. The hallmark of biofilm formation is the secretion of a polymeric matrix rich in sugars and proteins in the extracellular space. In Bacillus subtilis, secretion of the exopolysaccharide (EPS) component of the extracellular matrix is genetically coupled to the inhibition of flagella-mediated motility. The onset of this switch results in slow expansion of the biofilm on a substrate. Different strains have radically different capabilities in surface colonization: Flagella-null strains spread at the same rate as wild type, while both are dramatically faster than EPS mutants. Multiple functions have been attributed to the EPS, but none of these provides a physical mechanism for generating spreading. We propose that the secretion of EPS drives surface motility by generating osmotic pressure gradients in the extracellular space. A simple mathematical model based on the physics of polymer solutions shows quantitative agreement with experimental measurements of biofilm growth, thickening, and spreading. We discuss the implications of this osmotically driven type of surface motility for nutrient uptake that may elucidate the reduced fitness of the matrix-deficient mutant strains.

Determination of Target Sequence Bound by PapX, Repressor of Bacterial Motility, in flhD Promoter Using Systematic Evolution of Ligands by Exponential Enrichment (SELEX) and High Throughput Sequencing

Most uncomplicated urinary tract infections (UTIs) are caused by uropathogenic Escherichia coli (UPEC). Both motility and adherence are integral to UTI pathogenesis, yet they represent opposing forces. Therefore, it is logical to reciprocally regulate these functions. In UPEC strain CFT073, PapX, a non-structural protein encoded by one of the two pap operons encoding P fimbria adherence factor, represses flagella-mediated motility and is a putative member of the winged helix transcription factor family. The mechanism of this repression, however, is not understood. papX is found preferentially in more virulent UPEC isolates, being significantly more prevalent in pyelonephritis strains (53% of isolates) than in asymptomatic bacteriuria (32%) or fecal/commensal (12.5%) strains. To examine PapX structure-function, we generated papX linker insertion and site-directed mutants, which identified two key residues for PapX function (Lys(54) and Arg(127)) within domains predicted by modeling with I-TASSER software to be important for dimerization and DNA binding, respectively. To determine the PapX binding site in the CFT073 genome, systematic evolution of ligands by exponential enrichment (SELEX) in conjunction with high throughput sequencing was utilized for the first time to determine a novel binding site for a bacterial transcription factor. This method identified a 29-bp binding site within the flhDC promoter (TTACGGTGAGTTATTTTAACTGTGCGCAA), centered 410 bp upstream of the flhD translational start site. Gel shift experiments demonstrated that PapX binds directly to this site to repress transcription of flagellar genes.

Inhibition of Escherichia coli CFT073 fliC Expression and Motility by Cranberry Materials

In humans, uropathogenic Escherichia coli (UPEC) is the most common etiological agent of uncomplicated urinary tract infections (UTIs). Cranberry extracts have been linked to the prevention of UTIs for over a century; however, a mechanistic understanding of the way in which cranberry derivatives prevent bacterial infection is still lacking. In this study, we used a fliC-lux reporter as well as quantitative reverse transcription-PCR to demonstrate that when UPEC strain CFT073 was grown or exposed to dehydrated, crushed cranberries or to purified cranberry-derived proanthocyanidins (cPACs), expression of the flagellin gene (fliC) was inhibited. In agreement with these results, transmission electron microscopy imaging of bacteria grown in the presence of cranberry materials revealed fewer flagella than those in bacteria grown under control conditions. Furthermore, we showed that swimming and swarming motilities were hindered when bacteria were grown in the presence of the cranberry compounds. Because flagellum-mediated motility has been suggested to enable UPEC to disseminate to the upper urinary tract, we propose that inhibition of flagellum-mediated motility might be a key mechanism by which cPACs prevent UTIs. This is the first report to show that cranberry compounds inhibit UPEC motility via downregulation of the fliC gene. Further studies are required to establish whether these inhibitors play a role in vivo.

The Pseudomonas aeruginosa Chemotaxis Methyltransferase CheR1 Impacts on Bacterial Surface Sampling

The characterization of factors contributing to the formation and development of surface-associated bacterial communities known as biofilms has become an area of intense interest since biofilms have a major impact on human health, the environment and industry. Various studies have demonstrated that motility, including swimming, swarming and twitching, seems to play an important role in the surface colonization and establishment of structured biofilms. Thereby, the impact of chemotaxis on biofilm formation has been less intensively studied. Pseudomonas aeruginosa has a very complex chemosensory system with two Che systems implicated in flagella-mediated motility. In this study, we demonstrate that the chemotaxis protein CheR1 is a methyltransferase that binds S-adenosylmethionine and transfers a methyl group from this methyl donor to the chemoreceptor PctA, an activity which can be stimulated by the attractant serine but not by glutamine. We furthermore demonstrate that CheR1 does not only play a role in flagella-mediated chemotaxis but that its activity is essential for the formation and maintenance of bacterial biofilm structures. We propose a model in which motility and chemotaxis impact on initial attachment processes, dispersion and reattachment and increase the efficiency and frequency of surface sampling in P. aeruginosa.

A MotN Mutant of Ralstonia solanacearum Is Hypermotile and Has Reduced Virulence

Ralstonia solanacearum is a soil-borne plant pathogen that causes bacterial wilt disease on many plant species. We previously showed that swimming motility contributes to virulence of this bacterium in the early stages of host invasion and colonization. In this study we identified a new negative regulator of motility, named motN, that is located in a cluster of motility-related genes. A motN mutant was hypermotile both on 0.3% agar motility plates and in rich and minimal medium broth. However, like its wild-type parent, it was largely nonmotile inside plants. The motN mutant cells appeared hyperflagellated, and sheared cell protein preparations from motN contained more flagellin than preparations from wild-type cells. The motN strain was significantly reduced in virulence in a naturalistic soil soak assay on tomato plants. However, the motN mutant had wild-type virulence when it was inoculated directly into the plant vascular system. This suggests that motN makes its contribution to virulence early in disease development. The motN mutant formed weaker biofilms than the wild type, but it attached normally to tomato roots and colonized tomato stems as well as its wild-type parent. Phenotypic analysis and gene expression studies indicated that MotN directly or indirectly represses transcription of the major motility regulator FlhDC. MotN was also connected with other known motility and virulence regulators, PehSR, VsrBC, and VsrAD, via uncertain mechanisms. Together, these results demonstrate the importance of precise regulation of flagellum-mediated motility in R. solanacearum.

The Swarming Motility of Pseudomonas aeruginosa Is Blocked by Cranberry Proanthocyanidins and Other Tannin-Containing Materials

Bacterial motility plays a key role in the colonization of surfaces by bacteria and the subsequent formation of resistant communities of bacteria called biofilms. Derivatives of cranberry fruit, predominantly condensed tannins called proanthocyanidins (PACs) have been reported to interfere with bacterial adhesion, but the effects of PACs and other tannins on bacterial motilities remain largely unknown. In this study, we investigated whether cranberry PAC (CPAC) and the hydrolyzable tannin in pomegranate (PG; punicalagin) affected the levels of motilities exhibited by the bacterium Pseudomonas aeruginosa. This bacterium utilizes flagellum-mediated swimming motility to approach a surface, attaches, and then further spreads via the surface-associated motilities designated swarming and twitching, mediated by multiple flagella and type IV pili, respectively. Under the conditions tested, both CPAC and PG completely blocked swarming motility but did not block swimming or twitching motilities. Other cranberry-containing materials and extracts of green tea (also rich in tannins) were also able to block or impair swarming motility. Moreover, swarming bacteria were repelled by filter paper discs impregnated with many tannin-containing materials. Growth experiments demonstrated that the majority of these compounds did not impair bacterial growth. When CPAC- or PG-containing medium was supplemented with surfactant (rhamnolipid), swarming motility was partially restored, suggesting that the effective tannins are in part acting by a rhamnolipid-related mechanism. Further support for this theory was provided by demonstrating that the agar surrounding tannin-induced nonswarming bacteria was considerably less hydrophilic than the agar area surrounding swarming bacteria. This is the first study to show that natural compounds containing tannins are able to block P. aeruginosa swarming motility and that swarming bacteria are repelled by such compounds.

FimL Regulates cAMP Synthesis in Pseudomonas aeruginosa

Pseudomonas aeruginosa, a ubiquitous bacteria found in diverse ecological niches, is an important cause of acute infections in immunocompromised individuals and chronic infections in patients with Cystic Fibrosis. One signaling molecule required for the coordinate regulation of virulence factors associated with acute infections is 3′, 5′-cyclic adenosine monophosphate, (cAMP), which binds to and activates a catabolite repressor homolog, Vfr. Vfr controls the transcription of many virulence factors, including those associated with Type IV pili (TFP), the Type III secretion system (T3SS), the Type II secretion system, flagellar-mediated motility, and quorum sensing systems. We previously identified FimL, a protein with histidine phosphotransfer-like domains, as a regulator of Vfr-dependent processes, including TFP-dependent motility and T3SS function. In this study, we carried out genetic and physiologic studies to further define the mechanism of action of FimL. Through a genetic screen designed to identify suppressors of FimL, we found a putative cAMP-specific phosphodiesterase (CpdA), suggesting that FimL regulates cAMP levels. Inactivation of CpdA increases cAMP levels and restores TFP-dependent motility and T3SS function to fimL mutants, consistent with in vivo phosphodiesterase activity. By constructing combinations of double and triple mutants in the two adenylate cyclase genes (cyaA and cyaB), fimL, and cpdA, we show that ΔfimL mutants resemble ΔcyaB mutants in TM defects, decreased T3SS transcription, and decreased cAMP levels. Similar to some of the virulence factors that they regulate, we demonstrate that CyaB and FimL are polarly localized. These results reveal new complexities in the regulation of diverse virulence pathways associated with acute P. aeruginosa infections.

TbUNC119 and Its Binding Protein Complex Are Essential for Propagation, Motility, and Morphogenesis of Trypanosoma brucei Procyclic Form Cells

Flagellum-mediated motility of Trypanosoma brucei is considered to be essential for the parasite to complete stage development in the tsetse fly vector, while the mechanism by which flagellum-mediated motility is controlled are not fully understood. We thus compared T. brucei whole gene products (amino acid sequence) with Caenorhabditis elegans UNC (uncoordinated) proteins, in order to find uncharacterized motility-related T. brucei genes. Through in silico analysis, we found 88 gene products which were highly similar to C. elegans UNC proteins and categorized them as TbCEUN (T. brucei gene products which have high similarity to C. elegans UNC proteins). Approximately two thirds of the 88 TbCEUN gene products were kinesin-related molecules. A gene product highly similar to C. elegans UNC119 protein was designated as TbUNC119. RNAi-mediated depletion of TbUNC119 showed no apparent phenotype. However, knock-down analysis of both TbUNC119 and its binding protein (TbUNC119BP) which was found by yeast two-hybrid analysis showed characteristic phenotypes, including reduced motility, morphological change (extended cell shape), and cellular apoptosis. Based on the observed phenotypes, possible function of the TbUNC119 and TbUNC119BP is discussed.