Abstract
Most uncomplicated urinary tract infections (UTIs) are caused by uropathogenic Escherichia coli (UPEC). Both motility and adherence are integral to UTI pathogenesis, yet they represent opposing forces. Therefore, it is logical to reciprocally regulate these functions. In UPEC strain CFT073, PapX, a non-structural protein encoded by one of the two pap operons encoding P fimbria adherence factor, represses flagella-mediated motility and is a putative member of the winged helix transcription factor family. The mechanism of this repression, however, is not understood. papX is found preferentially in more virulent UPEC isolates, being significantly more prevalent in pyelonephritis strains (53% of isolates) than in asymptomatic bacteriuria (32%) or fecal/commensal (12.5%) strains. To examine PapX structure-function, we generated papX linker insertion and site-directed mutants, which identified two key residues for PapX function (Lys(54) and Arg(127)) within domains predicted by modeling with I-TASSER software to be important for dimerization and DNA binding, respectively. To determine the PapX binding site in the CFT073 genome, systematic evolution of ligands by exponential enrichment (SELEX) in conjunction with high throughput sequencing was utilized for the first time to determine a novel binding site for a bacterial transcription factor. This method identified a 29-bp binding site within the flhDC promoter (TTACGGTGAGTTATTTTAACTGTGCGCAA), centered 410 bp upstream of the flhD translational start site. Gel shift experiments demonstrated that PapX binds directly to this site to repress transcription of flagellar genes.
Highlights
When P fimbrial adhesins are expressed in uropathogenic E. coli, PapX represses motility
Prevalence of PapX Homologs among uropathogenic Escherichia coli (UPEC)—To assess the prevalence of papX in UPEC strains, a collection of 294 E. coli strains representing a range of isolates from fecal/commensal strains (n ϭ 88) to strains isolated from clinical cases of asymptomatic bacteriuria (n ϭ 54), complicated urinary tract infections (UTIs) (n ϭ 39), uncomplicated cystitis (n ϭ 37), and acute pyelonephritis (n ϭ 76) was examined by multiplex PCR for the presence of papX homologs
12.5% of fecal/commensal E. coli contained at least one copy of papX, the lowest prevalence within the strain collection and significantly less prevalent than in asymptomatic bacteriuria strains (p ϭ 0.0081) (Fig. 2B). focX, a close homolog of papX, did not vary significantly in prevalence within the UPEC strain collection (p ϭ 0.7927) (Fig. 2C). This was not surprising because focX is closely associated with genes encoding F1C fimbria, which appears more closely associated with meningitis-associated strains than with UTI-associated strains [31]
Summary
When P fimbrial adhesins are expressed in uropathogenic E. coli, PapX represses motility. In UPEC strain CFT073, PapX, a nonstructural protein encoded by one of the two pap operons encoding P fimbria adherence factor, represses flagella-mediated motility and is a putative member of the winged helix transcription factor family. Recent studies in UPEC have demonstrated that PapX, a non-structural 183-amino acid protein of the highly conserved 17-kDa family and a functional homolog of MrpJ, which is encoded by the PAI-CFT073pheV but not PAICFT073pheU-associated pap operon, down-regulates motility by repressing the expression of flagella [16]. To further our understanding of the mechanism of PapXmediated repression of motility, we functionally characterized the PapX protein and used systematic evolution of ligands by exponential enrichment (SELEX) in conjunction with high throughput sequencing technology to identify a novel DNA binding site for PapX within the flhDC promoter. Because the 17-kDa family of genes is highly conserved, by elucidating the mechanisms underlying reciprocal control of motility by PapX in UPEC, we will be better equipped to manipulate and disrupt this important regulatory cascade and virulence property of a pathogenic microbe
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
