Field-grown Cucurbits Research Articles

Kyuri green mottle mosaic virus detected for the first time in Turkey

Turkey is among the top 10 producers of cucumber, melon, watermelon, and squash in the world. Lately, seed-borne viruses have become a major issue in greenhouse and field-grown cucurbits. In this study, the incidence of kyuri green mottle mosaic virus (KGMMV) was determined in seeds from various species (cucumber, melon, watermelon, summer squash, bottle gourd, winter squash) of Cucurbitaceae. KGMMV detection in a total of 20 seed lots of each cucurbit species was done by enzyme-linked immunosorbent assay (ELISA) and RT-PCR. The highest virus incidence was 45% in melon followed by 25% in cucumber and 10% in squash. To the best of our knowledge, this is the first report of KGMMV in cucurbit crops in Turkey and this highlights the potential risk of KGMMV to commercial cucurbit seed lots.

Analysis of the molecular and biological variability of Zucchini yellow mosaic virus isolates from Iran and Iraq.

During the growing season of 2018, several field-grown cucurbit plants in different parts of Iraq and Iran were surveyed for the presence of zucchini yellow mosaic virus (ZYMV), using two degenerate primer pairs (CIF/Rev and NIb2F/3R) targeting the two separated partial regions of the potyvirus genome (CI and NIb respectively). 7 out of 20 samples were confirmed to be infected with ZYMV. Phylogenetic analyses based on the CI gene grouped all Iranian and two Iraqi (ZYMV1 and ZYMV2) isolates together with isolates from the Middle East in the subgroup (AI), whereas the other Iraqi (ZYMV3 and ZYMV4) isolates were clustered in the subgroup (DI), which was only consisted of American isolates. The highest and lowest identity between the studied isolates and the GenBank isolates showed that the two genes (CI, NIb) of each isolate particularly the Iraqi isolates were more similar to a specific and geographically scattered mosaic of worldwide isolates, suggestive of mixed infection might have occurred between different worldwide isolates in Iraq. Furthermore, the first complete nucleotide sequence of an Iraqi ZYMV (ZYMV-Iq) isolate was done, using the Illumina sequencing technique. The complete nucleotide sequence of ZYMV-Iq isolate was 9650 nt, excluding the 3'poly (A) tail. ZYMV-Iq isolate shared the highest nt identity of 98.8% with an American (KC665630) isolate. Phylogenetic analysis based on the full genome sequence placed ZYMV-Iq in subgroup A of group I alongside 18 isolates from the US and two isolates from Australia. In addition, recombination analysis detected lone significant recombination between ZYMV-Iq and South Korean (AY279000) isolate. Moreover, the results showed that symptom intensity was varied across experimental host plants.

The Occurrence of Major Viruses Infecting Zucchini Squash (Cucurbita pepo L.) in Morocco

Zucchini squash, Cucurbita pepo L., is one of the most economically important vegetable crops in Morocco. Virus diseases are a major factor in limiting production of zucchini squash in the country. During the growing seasons 2015, 2016 and 2017, the main areas of field-grown cucurbit production in Morocco (Loukkos, Gharb, Bouznika, Doukkala and Souss) were surveyed for the occurrence and distribution of viruses of zucchini squash. A total of 38 commercial fields were visited and inspected for symptoms of virus diseases and 415 leaf samples were collected from plants showing virus-like symptoms for laboratory analyses. ELISA technique was used to detect the following viruses: Zucchini yellow mosaic virus (ZYMV), Squash mosaic virus (SqMV), Cucumber mosaic virus (CMV), Papaya ringspot virus-watermelon strain (PRSV-W) and Cucurbit aphid-borne yellows virus (CABYV). The obtained results showed that virus diseases were widely distributed in the country with an infection rate of 77.6%, especially in the region of Loukkos where 85% of the tested plants were infected by at least one virus. To the best of our knowledge, this isthe first study on the occurrence and geographical distribution of viruses infecting zucchini squash in Morocco. This study provides valuable information, which could be beneficial and of great interest for the researchers, growers and the plant protection services for planning future strategies to control virus diseases of zucchini squash in Morocco.

Evaluation of Rotational Biopesticide Programs for Disease Management in Organic Cucurbit Production.

Downy mildew (Pseudoperonospora cubensis) and powdery mildew (Podosphaera xanthii) are two of the most economically important and widespread cucurbit diseases. Disease management relies primarily on fungicide use, but frequent fungicide applications can lead to the development of resistant pathogen populations. In addition, more vegetables are being produced with organic practices, which prohibit the use of many fungicides. Incorporating biorational products into a disease management program may help mitigate the risk of fungicide resistance development while being compatible with organic production. Field trials were conducted for two years on organically managed land in Maryland with cucumber, muskmelon, pumpkin, and butternut squash to evaluate the efficacy of four biorational products (i.e., Actinovate AG, OxiDate, Regalia, and Serenade Soil) when applied in a rotational program with copper against foliar cucurbit diseases. Generally, all biorational treatments resulted in significantly lower downy and powdery mildew severity compared with the nontreated plants, but the level of disease management was not significantly different than that provided by copper alone. However, Actinovate AG, OxiDate, and Serenade Soil each improved disease management on at least one crop, as compared with copper alone. Rotational programs with biopesticides are a viable disease management option for organic production of field-grown cucurbits in Maryland.

Distribution of Virus Symptoms and Viruses Infecting Field-Grown Cucurbit Crops Under Natural Tropical Conditions Within a Humid Rainforest Transition Agro-Ecology in Nigeria

Farmers’ fields where cucurbit crops were grown in seven Local Government Areas (LGA) of Ogun state were surveyed in 2009 and 2010 for incidence and severity of virus symptoms and the identity of the viruses infecting the crops were determined using DAS-ELISA. Six viruses including Zucchini yellow mosaic virus (ZYMV), Watermelon mosaic virus (WMV), Papaya ringspot virus (PRSV), Cucumber green mottle mosaic virus (CGMMV), Cucumber mosaic virus (CMV), and Melon necrotic spot virus (MNSV) were indexed for in the leaf samples. A total of 14 farms were visited and 130 leaf samples were collected. The incidences of virus symptoms on the field were between 41.0 and 100.0% while the mean severity score were between 1 (apparently healthy) and 5 (severe symptoms and death) in some locations. The incidences of virus symptoms such as mottle, chlorosis and yellowing, mosaic, leaf distortion, puckering, vein banding and vein clearing were 20.0, 19.2, 18.5, 16.2, 11.5, 3.1 and 3.1%, respectively in the collected leaf samples. However, 8.5% of the leaf samples were apparently healthy. Serological analysis of the leaf sample showed the presence of ZYMV, PRSV, WMV, CMV, MNSV, and CGMMV. The most widely distributed virus was MNSV which occurred in 9 out of 14(64.3%)of the locations. This was followed by WMV and CGMMV occurring in 8 out of 14 (57.0%) of the locations. PRSV and CMV occurred in 50.0% of the locations. ZYMV occurred in 5 out of 14 (35.7%) of the locations. The viruses detected are among the viruses reported to limit the production of cucurbit crops world-wide.

Assessment of Field-Grown Cucurbit Crops and Weeds within Farms in South-West Nigeria for Viral Diseases

Cucurbits are economic crops in Nigeria which serve as additional nutritional supplements and also good sources of income for farmers. Viral diseases are a worldwide problem of cucurbits and a major limiting factor for cucurbit production. A survey of farmer’s fields where cucurbit crops were grown was carried out to assess the incidence and severity of virus symptoms and viruses associated with the crops and weeds in selected locations in Ogun and Osun, in southwest Nigeria, in June, 2012. In all, 38 leaf samples were collected in Ogun state and 52 in Osun state from cucurbit crops and weeds. Leaf samples were tested against  Cucumber mosaic virus (CMV), Melon necrotic spot virus (MNSV), Papaya ringspot virus (PRSV), Watermelon mosaic virus (WMV),Zucchini yellow mosaic virus (ZYMV) and Cucumber green mottle mosaic virus (CGMMV) using Double Antibody Sandwich (DAS) enzyme-linked immunosorbent assay (ELISA). All the fields surveyed had virus symptom incidences of 100% except for melon fields in Osun state with incidences of between 10 and 30%. In Ogun state, the occurrence of CMV was 5/31 (16.1%) while MNSV was detected in Lagenaria siceraria and T. occidentalis and it occurred in 6.5% of the leaf samples. In Osun state, CMV was detected in watermelon, melon and weeds found in all locations surveyed. The occurrence of CMV was 9/38 (23.7%) in the cucurbit crops and in 78.6% (11/14) of the weeds. PRSV and WMV also occurred in mixed infection with CMV in 7.1% respectively. CMV was the most widespread and prevalent virus infecting cucurbit crops and weeds.Cucurbits are economic crops in Nigeria which serve as additional nutritional supplements and also good sources of income for farmers. Viral diseases are a worldwide problem of cucurbits and a major limiting factor for cucurbit production. A survey of farmer’s fields where cucurbit crops were grown was carried out to assess the incidence and severity of virus symptoms and viruses associated with the crops and weeds in selected locations in Ogun and Osun, in southwest Nigeria, in June, 2012. In all, 38 leaf samples were collected in Ogun state and 52 in Osun state from cucurbit crops and weeds. Leaf samples were tested against  Cucumber mosaic virus (CMV), Melon necrotic spot virus (MNSV), Papaya ringspot virus (PRSV), Watermelon mosaic virus (WMV), Zucchini yellow mosaic virus (ZYMV) and Cucumber green mottle mosaic virus (CGMMV) using Double Antibody Sandwich (DAS) enzyme-linked immunosorbent assay (ELISA). All the fields surveyed had virus symptom incidences of 100% except for melon fields in Osun state with incidences of between 10 and 30%. In Ogun state, the occurrence of CMV was 5/31 (16.1%) while MNSV was detected in Lagenaria siceraria and T. occidentalis and it occurred in 6.5% of the leaf samples. In Osun state, CMV was detected in watermelon, melon and weeds found in all locations surveyed. The occurrence of CMV was 9/38 (23.7%) in the cucurbit crops and in 78.6% (11/14) of the weeds. PRSV and WMV also occurred in mixed infection with CMV in 7.1% respectively. CMV was the most widespread and prevalent virus infecting cucurbit crops and weeds.

Assessment of Field-Grown Cucurbit Crops and Weeds within Farms in South-West Nigeria for Viral Diseases


 Cucurbits are economic crops in Nigeria which serve as additional nutritional supplements and also good sources of income for farmers. Viral diseases are a worldwide problem of cucurbits and a major limiting factor for cucurbit production. A survey of farmer’s fields where cucurbit crops were grown was carried out to assess the incidence and severity of virus symptoms and viruses associated with the crops and weeds in selected locations in Ogun and Osun, in southwest Nigeria, in June, 2012. In all, 38 leaf samples were collected in Ogun state and 52 in Osun state from cucurbit crops and weeds. Leaf samples were tested against Cucumber mosaic virus (CMV), Melon necrotic spot virus (MNSV), Papaya ringspot virus (PRSV), Watermelon mosaic virus (WMV),Zucchini yellow mosaic virus (ZYMV) and Cucumber green mottle mosaic virus (CGMMV) using Double Antibody Sandwich (DAS) enzyme-linked immunosorbent assay (ELISA). All the fields surveyed had virus symptom incidences of 100% except for melon fields in Osun state with incidences of between 10 and 30%. In Ogun state, the occurrence of CMV was 5/31 (16.1%) while MNSV was detected in Lagenaria siceraria and T. occidentalis and it occurred in 6.5% of the leaf samples. In Osun state, CMV was detected in watermelon, melon and weeds found in all locations surveyed. The occurrence of CMV was 9/38 (23.7%) in the cucurbit crops and in 78.6% (11/14) of the weeds. PRSV and WMV also occurred in mixed infection with CMV in 7.1% respectively. CMV was the most widespread and prevalent virus infecting cucurbit crops and weeds.Cucurbits are economic crops in Nigeria which serve as additional nutritional supplements and also good sources of income for farmers. Viral diseases are a worldwide problem of cucurbits and a major limiting factor for cucurbit production. A survey of farmer’s fields where cucurbit crops were grown was carried out to assess the incidence and severity of virus symptoms and viruses associated with the crops and weeds in selected locations in Ogun and Osun, in southwest Nigeria, in June, 2012. In all, 38 leaf samples were collected in Ogun state and 52 in Osun state from cucurbit crops and weeds. Leaf samples were tested against Cucumber mosaic virus (CMV), Melon necrotic spot virus (MNSV), Papaya ringspot virus (PRSV), Watermelon mosaic virus (WMV), Zucchini yellow mosaic virus (ZYMV) and Cucumber green mottle mosaic virus (CGMMV) using Double Antibody Sandwich (DAS) enzyme-linked immunosorbent assay (ELISA). All the fields surveyed had virus symptom incidences of 100% except for melon fields in Osun state with incidences of between 10 and 30%. In Ogun state, the occurrence of CMV was 5/31 (16.1%) while MNSV was detected in Lagenaria siceraria and T. occidentalis and it occurred in 6.5% of the leaf samples. In Osun state, CMV was detected in watermelon, melon and weeds found in all locations surveyed. The occurrence of CMV was 9/38 (23.7%) in the cucurbit crops and in 78.6% (11/14) of the weeds. PRSV and WMV also occurred in mixed infection with CMV in 7.1% respectively. CMV was the most widespread and prevalent virus infecting cucurbit crops and weeds.

The status of Cucumber vein yellowing virus in Iran

Yellowing symptoms of greenhouse- and open field-grown cucurbit crops are becoming increasingly important in many cucurbit growing regions of the world, and particularly in Iran. A survey was conducted from 2011 to 2012 in eight major cucurbit growing regions in Iran. Yellowing and specifically vein clearing symptoms were observed in many cucumber plants grown in greenhouses and open fields, suggesting the presence of Cucumber vein yellowing virus (CVYV, genus Ipomovirus , family Potyviridae ). The identification of CVYV was carried out with a specific triple-antibody sandwich enzyme-linked immunosorbent assay (TAS-ELISA) and reverse transcription (RT)-PCR. CVYV was detected in 42% of the collected samples, in all surveyed provinces, except Bushehr. CVYV was also detected in melon and cucumber crops grown in open fields. These results indicate that CVYV is widely distributed on these two cucurbit species in the major cucumber growing areas of Iran. CVYV positive samples were also tested, using DAS-ELISA, for the presence of Cucurbit chlorotic yellows virus (CCYV) and Cucurbit yellow stunting disorder virus (CYSDV), two criniviruses reported previously to occur in Iran. Double or triple infections of CCYV and CYSDV occurred in 49 of 166 of the CVYV-infected plants. The CVYV and CCYV combined infections were more prevalent than CVYV and CYSDV combined infections. TAS-ELISA positive samples were used to mechanically inoculate healthy cucumber plants, and mild vein yellowing was observed on the inoculated leaves. Identical symptoms were also observed on whitefly inoculated healthy cucumber plants. The presence of CVYV in mechanically and whitefly inoculated plants was confirmed by TAS-ELISA and RT-PCR. Sequence analysis revealed that the Iranian isolate of CVYV was more closely related to Spanish isolates than to isolates from Jordan. Phylogenetic analysis showed that CVYV isolates can be divided into two phylogenetic groups (I and II). Despite the close vicinity of Jordan to Iran, the Iranian CVYV isolate clustered with Spanish isolates in group I and not with the Jordanian isolates of group II.

Viruses of cucurbits in Panama.

The main areas of field-grown cucurbit production in Panama were surveyed for the occurrence and distribution of viruses in the growing seasons of 2006 and 2008. Notably, in 2006 only Melon necrotic spot virus (MNSV) was detected, while Papaya ringspot virus (PRSV) was the most frequent in 2008 in terms of number of fields and samples analysed, followed by Zucchini yellow mosaic virus (ZYMV), Watermelon mosaic virus (WMV) and MNSV. Cucumber mosaic virus (CMV), Squash mosaic virus (SqMV), Cucumber green mottle mosaic virus (CGMMV), Tomato spotted wilt virus (TSWV), Cucumber leaf spot virus (CLSV), Cucurbit yellow stunting disorder virus (CYSDV), Cucurbit aphid-borne yellows virus (CABYV), Beet pseudoyellows virus (BPYV), Beet yellows virus (BYV), and Cucumber vein yellowing virus (CVYV) were not detected . Single and double (PRSV+WMV; PRSV+ZYMV; ZYMV+MNSV) infections were detected in 60% and 40% of the samples tested, respectively. The occurrence and distribution of each virus varied according to the region and cucurbit species.

Effect of different irrigation water salinities on some yield and quality components of two field-grown Cucurbit species

Using irrigation water with a salinity level of 0.8, 2, and 5 g L^{-1}, the impact of saline water irrigation on the yield and quality of 2 Chinese Cucurbit species, melon (Cucumis melo cv. Huanghe) and watermelon (Citrullus lanatus. convar megulaspemus) were studied in Minqin Oasis, northwestern China. Our results show that melon yields decreased as water salinity increased, just as concentrations of glutamic acid content rose, although the concentration of most amino acids did not differ significantly. In contrast, watermelon yields decreased significantly as water salinity rose, and fruit number, fruit firmness, fruit crude protein, and essential amino acid (EAA) levels of the watermelon showed a significant increase as water salinity rose. Salt stress on both Cucurbit species resulted in an increase in total soluble solids (TSS) and Na^+ concentrations, while Ca^{2+} and Cl^- concentrations were not affected significantly. In conclusion, our results showed that, although melon and watermelon yields were restrained by saline water irrigation, fruit quality was not influenced, such as for the fruit's amino acids. The fact that saline water irrigation is feasible for melon and watermelon species shows that saline water is a potential irrigation water resource in arid areas of northwest China.

LIMITED GEOGRAPHIC DISTRIBUTION OF BEET PSEUDO-YELLOWS VIRUS IN COSTA RICAN CUCURBITS

SUMMARY Beet pseudo-yellows virus (BPYV) was previously found to be associated with severe yellowing and chlorosis in field-grown cucurbits in Costa Rica. To determine the prevalence and molecular variability of BPYV in Costa Rica, leaf samples were collected in 2004 and 2005 from symptomatic cucurbit plants growing in geographically distinct cucurbit-growing regions, and weedy plants growing adjacent to production fields. The samples were tested for the presence of BPYV using RT-PCR with virus-specific primers and nucleic acid hybridization probes specific for genes encoding the BPYV minor coat protein, heat shock protein, and polymerase protein. Several isolates were also amplified using primers spanning an insertion region in RNA1 to examine isolate variability. Our results revealed that (1) BPYV in cucurbits is currently limited to an isolated region of the country, (2) genetic variation in the genes examined among the isolates is very low, and (3) BPYV is present in wild cucurbit and other plant species growing adjacent to production fields containing BPYV-positive cucurbits.

Identification, distribution and incidence of viruses in field-grown cucurbit crops of Iran

A survey of viruses in the major cucurbit-growing areas of 17 provinces in Iran was conducted in 2005 and 2006. A total of 1699 leaf samples were collected from melon, squash, cucumber and watermelon plants showing various virus-like symptoms. Screening for 11 cucurbit viruses by double-antibody sandwich ELISA (DAS-ELISA) or RT-PCR, found that 71% of the samples were infected by at least one virus, of which Cucurbit aphid-borne yellows virus (CABYV) was the most common overall, occurring in 49, 47, 40, and 33% of cucumber, squash, melon, and watermelon samples respectively. The second most common virus on melon and watermelon was Watermelon mosaic virus (WMV) (incidence 30–33%); on cucumber, Cucumber mosaic virus (CMV)(33%); and on squash, Zucchini yellow mosaic virus (ZYMV)(38%). To our knowledge, this is the first report of Melon necrotic spot virus (MNSV) and Zucchini yellow fl eck virus (ZYFV) in Iran. Mixed infections occurred in 49% of symptomatic samples. Mixed infections were relatively frequent in squash (58%) and melon (55%). The most frequent double infections were WMV+CABYV and ZYMV+CABYV in melon, squash and cucumber, followed by WMV+ZYMV. In watermelon, the most frequent double infection was WMV+ZYMV, followed by WMV+CABYV. The high frequency of CABYV, WMV and ZYMV in the samples assayed on all four cucurbit crops and in all areas surveyed, as well as the detection of Watermelon chlorotic stunt virus (WmCSV) and Cucumber vein yellowing virus (CVYV) in northern and southern Iran, suggest that these viruses represent a potential threat to cucurbit crops in Iran.

Cucurbit aphid-borne yellows virus Is Prevalent in Field-Grown Cucurbit Crops of Southeastern Spain.

Despite the importance of field-grown cucurbits in Spain, only limited information is available about the impact of disease on their production. During the 2003 and 2004 growing seasons, systematic surveys were carried out in open field melon (Cucumis melo) and squash (Cucurbita pepo) crops of Murcia Province (Spain). The fields were chosen with no previous information regarding their sanitation status, and samples were taken from plants showing viruslike symptoms. Samples were analyzed using molecular hybridization to detect Beet pseudo-yellows virus (BPYV), Cucurbit aphid-borne yellows virus (CABYV), Cucumber mosaic virus (CMV), Cucumber vein yellowing virus (CVYV), Cucurbit yellow stunting disorder virus (CYSDV), Melon necrotic spot virus (MNSV), Papaya ringspot virus (PRSV), Watermelon mosaic virus (WMV), and Zucchini yellow mosaic virus (ZYMV). We collected 924 samples from 48 field plots. Out of these, almost 90% were infected by at least one of the viruses considered, usually CABYV, which was present in 83 and 66% of the melon and squash samples, respectively. In the case of melon, CYSDV, BPYV, and WMV followed CABYV in relative importance, with frequencies of around 20 to 30%, while in squash, CVYV and BPYY showed frequencies between 28 and 21%. The number of multiple infections was very high, 66 and 56% of the infected samples of melon and squash, respectively, being afflicted. CABYV was present in all multiple infections. The high incidence of CABYV in single and multiple infections suggests that this virus may well become an important threat for cucurbit crops in the region. Restriction fragment length polymorphism (RFLP) analysis revealed that CABYV isolates can be grouped into two genetic types, both of which seemed to be present during the 2003 epidemic episode, but only one of the types was found in 2004.

First Report of Beet pseudo-yellows virus on Cucurbita moschata and C. pepo in Costa Rica

In early 2004, severe yellowing and chlorosis were observed in field-grown cucurbits in Costa Rica. Symptoms resembled those of the genus Crinivirus (family Closteroviridae), and large populations of whiteflies were observed in the fields and on symptomatic plants. Although the identity of the whiteflies on the curcurbits was not determined, the greenhouse whitefly, Trialeurodes vaporariorum (Westwood) is known to be present in the region from where the samples were obtained. To identify the causal agent of the disease, leaf samples of symptomatic plants were collected from several farms. The leaf samples were dried with silica gel. Total RNA was extracted from leaf tissue of eight representative samples (two from healthy plants and six from symptomatic plants) using TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription-polymerase chain reactions (RT-PCR) containing one primer set at a time were performed using the Titan One-Tube RT-PCR kit (Roche Diagnostics Corp., Chicago IL) and primers specific for genes of cucurbit-infecting criniviruses, including the coat protein gene of Cucurbit yellow stunting disorder virus (3) and the minor coat protein gene (CPm) of Beet pseudoyellows virus (BPYV) (4). Primers specific for the heat shock protein (HSP) gene (CYHSPF 5' GAGCGCCGCACAAGTCATC 3' and CYHSPR 5' TACCGCCACCAAAGTCATACATTA 3') of Cucumber yellows virus (CYV, a strain of BPYV) (1) were designed based on published sequence data. In addition, primers specific for Cucurbit aphid-borne yellows virus (2) and melon yellowing-associated flexivirus (MYVF 5' GGCTGGCAACATGGAAACTGA 3' and MYVR 5' CTGAAAAGGCGATGAACTA TTGTG 3') were used in RT-PCR reactions. Amplified DNA fragments of 333 and 452 bp were obtained in each of two samples obtained from symptomatic plants and only in separate reactions containing BPYV and CYV primer sets, respectively. Nucleotide sequence analysis of all purified PCR products verified their identity as variants of BPYV, with 97 and 99% sequence identity with reported CPm and HSP sequences, respectively. The two samples from Cucurbita moschata Duch. (ayote or squash) and Cucurbita pepo L.(escalopini or sunburst squash) were taken from a region around Paraiso, Cartago, Costa Rica. To our knowledge, this is the first report of BPYV in Costa Rica. The economic impact on cucurbit production has not yet been determined. Studies are underway to determine the prevalence and genetic variability of BPYV isolates in Costa Rica.

Incidence and management of virus diseases of cucurbits in Lebanon

Virus diseases are the major cause of economic losses in commercial cucurbit production in Lebanon. This survey revealed that Zucchini yellow mosaic Potyvirus (ZYMV) and Cucurbit aphid-borne yellows Polerovirus (CABYV) are the most common viruses of field-grown cucurbits in Lebanon. They are followed by Watermelon mosaic Potyvirus (WMV), Papaya ringspot Potyvirus-watermelon strain (PRSV-W) and to a lesser extent Cucumber mosaic Cucumovirus (CMV). Cross-protection with a mild strain of ZYMV-WK gave significant protection of squash plants against severe virus symptoms and resulted in significant yield increase as compared to the control. Silver plastic mulch also gave a significant protection against viral diseases and a higher total yield than controls. However, the best protection and highest total yield were obtained with floating row covers. The integration of cross-protection with silver mulch or with floating row covers improved the protection obtained with either approach.

Decreased sensitivity of Sphaerotheca fuliginea to fenarimol and other ergosterol-biosynthesis inhibitors

Decreased sensitivity of Sphaerotheca fuliginea (Schlecht.) Poll. (powdery mildew of cucurbits) to ergosterol-biosynthesis inhibitors (EBIs) which inhibit 14C-demethylation, has been found in areas where these fungicides have been used frequently for several seasons. Relatively low sensitivity was associated with poor disease control in some cases, especially in field-grown cucurbits. Isolates less sensitive to EBIs which inhibit 14C-demethylation were sensitive to fungicides with different modes of action. In order to ensure their continued usefulness it is recommended to reduce selection pressure by using EBIs inhibiting 14C-demethylation during only a part of the growing season.