Ff Phage Research Articles

Cryo-electron microscopy of the f1 filamentous phage reveals insights into viral infection and assembly

Phages are viruses that infect bacteria and dominate every ecosystem on our planet. As well as impacting microbial ecology, physiology and evolution, phages are exploited as tools in molecular biology and biotechnology. This is particularly true for the Ff (f1, fd or M13) phages, which represent a widely distributed group of filamentous viruses. Over nearly five decades, Ffs have seen an extraordinary range of applications, yet the complete structure of the phage capsid and consequently the mechanisms of infection and assembly remain largely mysterious. In this work, we use cryo-electron microscopy and a highly efficient system for production of short Ff-derived nanorods to determine a structure of a filamentous virus including the tips. We show that structure combined with mutagenesis can identify phage domains that are important in bacterial attack and for release of new progeny, allowing new models to be proposed for the phage lifecycle.

Conformational Changes in Ff Phage Protein gVp upon Complexation with Its Viral Single-Stranded DNA Revealed Using Magic-Angle Spinning Solid-State NMR.

Gene V protein (gVp) of the bacteriophages of the Ff family is a non-specific single-stranded DNA (ssDNA) binding protein. gVp binds to viral DNA during phage replication inside host Escherichia coli cells, thereby blocking further replication and signaling the assembly of new phage particles. gVp is a dimer in solution and in crystal form. A structural model of the complex between gVp and ssDNA was obtained via docking the free gVp to structures of short ssDNA segments and via the detection of residues involved in DNA binding in solution. Using solid-state NMR, we characterized structural features of the gVp in complex with full-length viral ssDNA. We show that gVp binds ssDNA with an average distance of 5.5 Å between the amino acid residues of the protein and the phosphate backbone of the DNA. Torsion angle predictions and chemical shift perturbations indicate that there were considerable structural changes throughout the protein upon complexation with ssDNA, with the most significant variations occurring at the ssDNA binding loop and the C-terminus. Our data suggests that the structure of gVp in complex with ssDNA differs significantly from the structure of gVp in the free form, presumably to allow for cooperative binding of dimers to form the filamentous phage particle.

Filamentous Phage: Structure and Biology.

Ff filamentous phage (fd, M13 and f1) of Escherichia coli have been the workhorse of phage display technology for the past 30years. Dominance of Ff over other bacteriophage in display technology stems from the titres that are about 100-fold higher than any other known phage, efficacious transformation ensuring large library size and superior stability of the virion at high temperatures, detergents and pH extremes, allowing broad range of biopanning conditions in screening phage display libraries. Due to the excellent understanding of infection and assembly requirements, Ff phage have also been at the core of phage-assisted continual protein evolution strategies (PACE). This chapter will give an overview of the Ff filamentous phage structure and biology, emphasizing those properties of the Ff phage life cycle and virion that are pertinent to phage display applications.

CTXϕ: Exploring new alternatives in host factor-mediated filamentous phage replications.

For a long time Ff phages from Escherichia coli provided the majority of the knowledge about the rolling circle replication mechanism of filamentous phages. Host factors involved in coliphages replication have been fully identified. Based on these studies, the function of Rep protein as the accessory helicase directly implicated in filamentous phage replication was considered a paradigm. We recently reported that the replication of some filamentous phages from Vibrio cholerae, including the cholera toxin phage CTXϕ, depended on the accessory helicase UvrD instead of Rep. We also identified HU protein as one of the host factors involved in CTXϕ and VGJϕ replication. The requirement of UvrD and HU for rolling circle replication was previously reported in some family of plasmids but had no precedent in filamentous phages. Here, we enrich the discussion of our results and present new preliminary data highlighting remarkable divergence in the lifestyle of filamentous phages.

Targeting glioblastoma via intranasal administration of Ff bacteriophages

Bacteriophages (phages) are ubiquitous viruses that control the growth and diversity of bacteria. Although they have no tropism to mammalian cells, accumulated evidence suggests that phages are not neutral to the mammalian macro-host and can promote immunomodulatory and anti-tumorigenic activities. Here we demonstrate that Ff phages that do not display any proteins or peptides could inhibit the growth of subcutaneous glioblastoma tumors in mice and that this activity is mediated in part by lipopolysaccharide molecules attached to their virion. Using the intranasal route, a non-invasive approach to deliver therapeutics directly to the CNS, we further show that phages rapidly accumulate in the brains of mice and could attenuate progression of orthotopic glioblastoma. Taken together, this study provides new insight into phages non-bacterial activities and demonstrates the feasibility of delivering Ff phages intranasally to treat brain malignancies.

Ff-nano, short functionalized nanorods derived from Ff (f1, fd, or M13) filamentous bacteriophage.

F-specific filamentous phage of Escherichia coli (Ff: f1, M13, or fd) are long thin filaments (860 nm × 6 nm). They have been a major workhorse in display technologies and bionanotechnology; however, some applications are limited by the high length-to-diameter ratio of Ff. Furthermore, use of functionalized Ff outside of laboratory containment is in part hampered by the fact that they are genetically modified viruses. We have now developed a system for production and purification of very short functionalized Ff-phage-derived nanorods, named Ff-nano, that are only 50 nm in length. In contrast to standard Ff-derived vectors that replicate in E. coli and contain antibiotic-resistance genes, Ff-nano are protein-DNA complexes that cannot replicate on their own and do not contain any coding sequences. These nanorods show an increased resistance to heating at 70∘C in 1% SDS in comparison to the full-length Ff phage of the same coat composition. We demonstrate that functionalized Ff-nano particles are suitable for application as detection particles in sensitive and quantitative “dipstick” lateral flow diagnostic assay for human plasma fibronectin.

Filamentous Bacteriophage: Biology, Phage Display and Nanotechnology Applications

Filamentous bacteriophage, long and thin filaments that are secreted from the host cells without killing them, have been an antithesis to the standard view of head-and-tail bacterial killing machines. Episomally replicating filamentous phage Ff of Escherichia coli provide the majority of information about the principles and mechanisms of filamentous phage infection, episomal replication and assembly. Chromosomally- integrated "temperate" filamentous phage have complex replication and integration, which are currently under active investigation. The latter are directly or indirectly implicated in diseases caused by bacterial pathogens Vibrio cholerae, Pseudomonas aeruginosa and Neisseria meningitidis. In the first half of the review, both the Ff and temperate phage are described and compared. A large section of the review is devoted to an overview of phage display technology and its applications in nanotechnology.

Consensus structure of Pf1 filamentous bacteriophage from X-ray fibre diffraction and solid-state NMR.

Filamentous bacteriophages (filamentous bacterial viruses or Inovirus) are simple and well-characterised macromolecular assemblies that are widely used in molecular biology and biophysics, both as paradigms for studying basic biological questions and as practical tools in areas as diverse as immunology and solid-state physics. The strains fd, M13 and f1 are virtually identical filamentous phages that infect bacteria expressing F-pili, and are sometimes grouped as the Ff phages. For historical reasons fd has often been used for structural studies, but M13 and f1 are more often used for biological experiments. Many other strains have been identified that are genetically quite distinct from Ff and yet have a similar molecular structure and life cycle. One of these, Pf1, gives the highest resolution X-ray fibre diffraction patterns known for filamentous bacteriophage. These diffraction patterns have been used in the past to derive a molecular model for the structure of the phage. Solid-state NMR experiments have been used in separate studies to derive a significantly different model of Pf1. Here we combine previously published X-ray fibre diffraction data and solid-state NMR data to give a consensus structure model for Pf1 filamentous bacteriophage, and we discuss the implications of this model for assembly of the phage at the bacterial membrane.

Escherichia coliTolA tolerates multiple amino-acid substitutions as revealed by screening randomized variants for membrane integrity and phage receptor function

Escherichia coli TolA is a cytoplasmic membrane protein required for outer membrane integrity and the translocation of F-specific filamentous (Ff) bacteriophage DNA. Both phage infection and membrane integrity depend on several TolA interactions, e.g. those of the TolA C-terminal domain (TolAIII). Membrane integrity involves interaction with two host proteins and phage translocation requires direct interaction with the N-terminal domain (N1) of Ff phage protein g3p. Although cocrystallization of TolAIII and N1g3p has identified several contact points, it is still uncertain which residues are selectively involved in the different TolA functions. Thus, four different limited substitution libraries of TolA were created, targeting contacts at positions 415-420. These libraries were introduced into the tolA strain K17DE3tolA/F(+) and several variants, containing complementing, multiple amino-acid substitutions, were identified. However, most randomized variants did not complement the tolA strain K17DE3tolA/F(+). The TolA variants that restored sensitivity to phage infection displayed a considerable sequence variation, while the few variants that restored tolerance to detergent were from the same library. A comparison of the generated residue variation and natural variation, suggests that structural dependence overrides contact residue dependence. Thus, library screening can be efficient in identifying TolA variants with different functionally associated characteristics.

Tol-Dependent Macromolecule Import through theEscherichia coliCell Envelope Requires the Presence of an Exposed TolA Binding Motif

The Tol-Pal proteins of the cell envelope of Escherichia coli are required for maintaining outer membrane integrity. This system forms protein complexes in which TolA plays a central role by providing a bridge between the inner and outer membranes via its interaction with the Pal lipoprotein. The Tol proteins are parasitized by filamentous bacteriophages and group A colicins. The N-terminal domain of the Ff phage g3p protein and the translocation domains of colicins interact directly with TolA during the processes of import through the cell envelope. Recently, a four-amino-acid sequence in Pal has been shown to be involved in Pal's interaction with TolA. A similar motif is also present in the sequence of two TolA partners, g3p and colicin A. Here, a mutational study was conducted to define the function of these motifs in the binding activity and import process of TolA. The various domains were produced and exported to the bacterial periplasm, and their cellular effects were analyzed. Cells producing the g3p domain were tolerant to colicins and filamentous phages and had destabilized outer membranes, while g3p deleted of three residues in the motif was affected in TolA binding and had no effect on cell integrity or colicin or phage import. A conserved Tyr residue in the colicin A translocation domain was involved in TolA binding and colicin A import. Furthermore, in vivo and in vitro coprecipitation analyses demonstrated that colicin A and g3p N-terminal domains compete for binding to TolA.

A Sensitive and Rapid Chemiluminescence ELISA for Filamentous Bacteriophages

Filamentous bacteriophage (Ff) displayed random peptide and antibody libraries are widely used to identify specific, high affinity, binding ligands. A critical element in the identification of target‐specific phages is to determine phage titers, not only at every round of selection, but also for normalizing phage titers of a set of individual clones for their comparative binding analysis. The conventional ELISA‐based Ff titration methods require a minimum of 4–5 hr assay time and their lowest reported detection limit is ∼50,000 particles/well. In this report, we present a sandwich ELISA that allows detection of ∼1000 Ff particles/well in less than 2.5 hr. The values of correlation of coefficient (r2) for the curves at low phage concentrations (up to 106 TU/well) were about 0.999 in our ELISA. Experiments conducted at different temperatures suggest using 40°C incubations when titering low phage concentration samples. Experiments were also conducted with conventional ELISA for comparison. Our ELISA method derives an advantage from using a chemiluminescence substrate that gives much larger signals and wide linear range of measurement, thus allowing discrimination between background and low Ff phage concentrations. In conclusion, the Ff titration method presented here is highly sensitive, rapid, and amenable to high throughput analysis.

Ff gene 5 single-stranded DNA-binding protein assembles on nucleotides constrained by a DNA hairpin.

The gene 5 protein (g5p) encoded by filamentous Ff phages is an ssDNA-binding protein, which binds to and sequesters the nascent ssDNA phage genome in the process of phage morphogenesis. The g5p also binds with high affinity to DNA and RNA sequences that form G-quadruplex structures. However, sequences that would form G-quadruplexes are absent in single copies of the phage genome. Using SELEX (systematic evolution of ligands by exponential enrichment), we have now identified a family of DNA hairpin structures to which g5p binds with high affinity. After eight rounds of selection from a library of 58-mers, 26 of 35 sequences of this family contained two regions of complete or partial complementarity. This family of DNA hairpins is represented by the sequence: 5'-d(CGGGATCCAACGTTTTCACCAGATCTACCTCCTCGGGATCCCAAGAGGCAGAATTCGC)-3' (named U-4), where complementary regions are italicized or underlined. Diethyl pyrocarbonate modification, UV-melting profiles, and BamH I digestion experiments revealed that the italicized sequences form an intramolecular hairpin, and the underlined sequences form intermolecular base pairs so that a dimer exists at higher oligomer concentrations. Gel shift assays and end boundary experiments demonstrated that g5p assembles on the hairpin of U-4 to give a discrete, intermediate complex prior to saturation of the oligomer at high g5p concentrations. Thus, biologically relevant sequences at which g5p initiates assembly might be typified better by DNA hairpins than by G-quadruplexes. Moreover, the finding that hairpins of U-4 can dimerize emphasizes the unexpected nature of sequence-dependent structures that can be recognized by the g5p ssDNA-binding protein.

VGJ phi, a novel filamentous phage of Vibrio cholerae, integrates into the same chromosomal site as CTX phi.

We describe a novel filamentous phage, designated VGJ phi, isolated from strain SG25-1 of Vibrio cholerae O139, which infects all O1 (classical and El Tor) and O139 strains tested. The sequence of the 7,542 nucleotides of the phage genome reveals that VGJ phi has a distinctive region of 775 nucleotides and a conserved region with an overall genomic organization similar to that of previously characterized filamentous phages, such as CTX phi of V. cholerae and Ff phages of Escherichia coli. The conserved region carries 10 open reading frames (ORFs) coding for products homologous to previously reported peptides of other filamentous phages, and the distinctive region carries one ORF whose product is not homologous to any known peptide. VGJ phi, like other filamentous phages, uses a type IV pilus to infect V. cholerae; in this case, the pilus is the mannose-sensitive hemagglutinin. VGJ phi-infected V. cholerae overexpresses the product of one ORF of the phage (ORF112), which is similar to single-stranded DNA binding proteins of other filamentous phages. Once inside a cell, VGJ phi is able to integrate its genome into the same chromosomal attB site as CTX phi, entering into a lysogenic state. Additionally, we found an attP structure in VGJ phi, which is also conserved in several lysogenic filamentous phages from different bacterial hosts. Finally, since different filamentous phages seem to integrate into the bacterial dif locus by a general mechanism, we propose a model in which repeated integration events with different phages might have contributed to the evolution of the CTX chromosomal region in V. cholerae El Tor.

Crystal structure of the two N-terminal domains of g3p from filamentous phage fd at 1.9 Å: evidence for conformational lability

Infection of Escherichia coli by filamentous bacteriophages is mediated by the minor phage coat protein g3p and involves two distinct cellular receptors, the F′ pilus and the periplasmic protein TolA. Recently we have shown that the two receptors are contacted in a sequential manner, such that binding of TolA by the N-terminal domain g3p-D1 is conditional on a primary interaction of the second g3p domain D2 with the F′ pilus. In order to better understand this process, we have solved the crystal structure of the g3p-D1D2 fragment (residues 2–217) from filamentous phage fd to 1.9 Å resolution and compared it to the recently published structure of the same fragment from the related Ff phage M13. While the structure of individual domains D1 and D2 of the two phages are very similar (rms < 0.7 Å), there is comparatively poor agreement for the overall D1D2 structure (rms > 1.2 Å). This is due to an apparent movement of domain D2 with respect to D1, which results in a widening of the inter-domain groove compared to the structure of the homologous M13 protein. The movement of D2 can be described as a rigid-body rotation around a hinge located at the end of a short anti-parallel beta-sheet connecting domains D1 and D2. Structural flexibility of at least parts of the D1D2 structure was also suggested by studying the thermal unfolding of g3p: the TolA binding site on D1, while fully blocked by D2 at 37 °C, becomes accessible after incubation at temperatures as low as 45 °C. Our results support a model for the early steps of phage infection whereby exposure of the coreceptor binding site on D1 is facilitated by a conformational change in the D1D2 structure, which in vivo is induced by binding to the F′ pilus on the host cell and which can be mimicked in vitro by thermal unfolding.

Transcription of the Genome of the Filamentous Bacteriophage cf from Both Plus and Minus DNA Strands

The filamentous bacteriophage cf infects the bacterium Xanthomonas campestris pv. citri. Northern blot analysis with probes derived from various restriction fragments of cf replicative form (RF) DNA has revealed the presence of five major phage-specific transcripts in infected cells. Four of these transcripts were shown to be derived from the region of the cf genome extending from gene II to gene VIII and are consistent with the cascade model of transcription proposed for Ff coliphages. These transcripts overlap with each other and terminate upstream of an efficient Rho-independent transcription terminator. Unlike the well-characterized Ff phages, in which only the minus strand of viral DNA serves as a transcription template, both strands of the RF DNA of phage cf appeared to be transcribed. Thus one of the five major cf transcripts was shown to be derived from a region of the viral minus strand that contains an open reading frame encoding a putative polypeptide of 165 amino acids. Primer extension analysis mapped the transcriptional initiation site of this RNA to a cytosine residue at position 870. A partial transcription map of phage cf revealed two independent regions of transcriptional activity. The region with the highest activity coincides with that encoding the polypeptides required in the largest amounts during the cf infection cycle.

Purification and Expression of the Gene III Protein from Filamentous Phage φLf

The gene III protein (pIII) from φLf, a filamentous phage ofXanthomonas campestrispv.campestris,was purified by gel filtration with FPLC. ThegIIIcoding region was amplified by PCR, which was then cloned into pUC18 and expressed inEscherichia coli.The size of both pIII, purified from phage particle and expressed inE. coli,is similar to the value deduced from the nucleotide sequence as shown by Western blot analysis. This is different from the case in Ff phages (f1, fd, and M13), in which the size of pIII observed in SDS-polyacrylamide gel electrophoresis is substantially larger than the deduced value. Upon infection ofX. c.pv.vesicatoriacarrying cloned φLfgIIIwith φXv, a filamentous phage of pv.vesicatoria,the progeny particles in supernatant were able to infect both pv.campestriscarrying cloned φLfgIIIand pv.vesicatoria,indicating that a mixture of authentic φXv and chimeric phage consisting of φXv DNA and φLf pIII was produced. These results suggest pIII to be the adsorption protein required for host recognition.

Analyses of the stability and function of three surface mutants (R82C, K69H, and L32R) of the gene V protein from Ff phage by X-ray crystallography.

The high-resolution crystal structure of the gene V protein (GVP) from the Ff filamentous phages (M13, fl, fd) has been solved recently for the wild-type and two surface mutant (Y41F and Y41H) proteins, leading to a plausible model for the polymeric GVP-ssDNA complex (Guan Y, Zhang H, Wang AHJ, 1995, Protein Sci 4:187-197). The model of the complex shows extensive contacts between neighboring dimer GVPs involving electrostatic interactions between the K69 from one and the D79 and R82 from the next dimer. In addition, hydrophobic interactions between the amino acids L32 and L44 from one and G23 from the next dimer also contribute to the dimer-dimer interactions. Mutations at the L32, K69, and R82 amino acid sites generally destabilize the protein and many of these affect the function of the phage. We have studied the structural effects of three mutant proteins involving those sites, i.e., L32R, K69H, and R82C, by X-ray crystallographic analysis at 2.0 A resolution. In L32R GVP, the structural perturbation is localized, whereas in K69H and R82C GVPs, some long-range effects are also detected in addition to the local perturbation. We have interpreted the protein stability and the functional properties associated with those mutations in terms of the observed structural perturbations.

Filamentous phage IKe mRNAs conserve form and function despite divergence in regulatory elements

As a means of determining whether there has been selection to conserve the basic pattern of filamentous phage mRNAs, the major mRNAs representing genes II to VIII have been defined for a phage distantly related to the Ff group specific for Escherichia coli hosts bearing F pili. Phage IKe has a genome with 55% identity with the Ff genome and infects E. coli strains bearing N pili. The results reveal a remarkably similar pattern of overlapping polycistronic mRNAs with a common 3′ end and unique 5′ ends. The IKe mRNAs, like the Ff phage mRNAs, represent a combination of primary transcripts and processed RNAs. However, examination of the sequences containing the RNA endpoint positions revealed that effectively the only highly conserved regulatory element is the rho-independent terminator that generates the common 3′ end. Promoters and processing sites have not been maintained in identical positions, but frequently are placed so as to yield RNAs with similar coding function. By conserving the pattern of transcription and processing despite divergence in the regulatory elements and possibly the requirements for host endoribonucleases, the results argue that the pattern is not simply fortuitous.

Single-stranded DNA binding protein from bacteriophage cf: characterization, gene localization and protein-ssDNA complex

The single-stranded DNA binding protein from the filamentous bacteriophage cf has been purified and characterized. The first 12 amino acids, resulting from the N-terminal amino acid sequencing analysis of the protein, agree with an open reading frame (ORF) on the cf genome. The ORF contains 294 bp and codes for a 98 a.a. protein of molecular weight 10.8 kDa, consistent with the result from the denaturing protein gel analysis. The protein appears to be a homodimer as evident from the apparent molecular weight of about 22 kDa obtained from native protein gel analysis. The gene location of the protein has been identified as gene V of the cf single stranded genome, same as that from the M13 phage. The GVP of cf shows a strong sequence homology to the ssDNA binding proteins of Ff, IKe and Pf3 filamentous phages. The DNA binding wing of GVP, conserved among the filamentous phages, has been predicted for cf. To further characterize the protein, the GVP-ssDNA complex of cf has been purified from the infected host ( Xanthomonas campestris pv. citri) by density gradient centrifugation. Transmission electron microscopy (TEM) images of the complex showed that it is about 1200 nm in length and 9 nm in diameter and it has a highly regular morphology with a central groove shadow running along the entire structure, but without any apparent helical pattern seen in the M 13 complex. The GVP-ssDNA complex of cf seems more rigid than that of M13. Our computer modeling study suggested that this difference between the two complexes may be due to the additional 11 or 12 amino acids at the C-terminal end of the cf-GVP.

A Region of the Filamentous Phage φLf Genome That Can Support Autonomous Replication and Miniphage Production

A 2028-bp fragment from the RF DNA of φLf, a filamentous phage ofXanthomonas campestrispv.campestris,was maintained autonomously as a minireplicon. Upon superinfection of the cells harboring the minireplicon with φLf, transducing miniphage particles were released. The minireplicon contained an open reading frame (ORF346) able to encode a polypeptide of MW 39144, which possessed consensus motifs found in the Rep proteins from various sources. These findings suggested ORF346 to be the gene encoding replication initiation protein, gene II (gII) of φLf. Upstream to ORF346 were sequences with potential to form hairpin structures and a sequence similar to the integration host factor (IHF) binding site, structures similar to the intergenic region (IR) of the Ff phages. A 15 bp AT-rich core for φLf integration was found 37 bp downstream to the IHF binding site.