False Signals Research Articles

False Alarms Signal Urgency of Infant-Specific Devices

False Alarms Signal Urgency of Infant-Specific Devices

Optimization of Electrostatic Quadrupole Profile to Reduce Image Charge Effects

Vertical electric fields need to remain orders of magnitude smaller than the horizontal electric field in storage ring electric dipole moment experiments. Otherwise, the coupling with the magnetic dipole moment dominates the spin precession, eventually leading to a false signal. This work presents first quantitative studies regarding electrostatic quadrupole profile optimization, which helps suppressing image beam induced vertical electric fields. Besides the demonstration of the profile optimization, its suppression performance is also studied for various beam offsets and beam size configurations. It is found that with the optimum profile, the vertical electric field can be reduced by two orders of magnitude.

Accurate Fluorescence Diagnosis of Cancer Based on Sequential Detection of Hydrogen Sulfide and pH.

Cancer ranks as a leading cause of death in every country of the world. However, if they are discovered early, a lot of cancers can be prevented or cured. Discovering and monitoring cancer markers are the main methods for early diagnosis of cancer. To date, many fluorescent probes designed and used for early cancer diagnosis can only react with a single marker, which always causes insufficient accuracy in complex systems. Herein, a novel near-infrared (NIR) fluorescent probe (CyO-DNP) for the sequential detection of H2S and H+ is synthesized. In this probe, a heptamethine dye is selected as the fluorophore and a 2,4-dinitrophenyl (DNP) ether is chosen as recognition group. In the presence of H2S, CyO-DNP is transformed into CyO, which exhibits an intense fluorescence at 663 nm. Then, H+ induces the protonation of CyO to obtain CyOH, and the final fluorescence emission at 793 nm significantly enhances. Owing to the low cytotoxicity and the NIR fluorescence emission, CyO-DNP can sequentially monitor endogenous H2S and H+ in cancer cells and image exogenous and endogenous H2S and H+ in mice. It is worth mentioning that CyO-DNP can effectively avoid the false positive signal caused by the liver and kidney and discriminate normal mice and tumor mice accurately. For all we know, CyO-DNP is the first fluorescent probe for early accurate diagnosis of cancer by sequentially detecting H2S and H+.

Broad-Spectrum Polymeric Nanoquencher as an Efficient Fluorescence Sensing Platform for Biomolecular Detection.

Colloidal inorganic nanostructures (metal, carbon, and silica) have been widely used as "nanoquenchers" for construction of nanosensors; however, inherent drawbacks such as insufficient fluorescence quenching efficiency, false positive signals, and uncertain long-term cytotoxicity have limited their further utility. Herein, by taking advantages of polymeric nanoparticles (PNPs) in terms of high loading capacity, facile surface modification chemistry, and good biocompatibility, we report a broad-spectrum (400-750 nm) polymeric fluorescence-quenching platform for sensor fabrication. Our newly developed polymeric nanoquenchers (qPNPs) were constructed by concurrently encapsulating various alkylated black-hole quenchers into nanoparticles made of poly(methyl methacrylate-co-methacrylic acid) and were found to have an excellent fluorescence quenching effect (>400-fold) on common fluorophores (FAM, TMR, and Cy5) together with high stability under physiological conditions. As a proof of concept, the feasibility of these qPNPs for fluorescence sensing was validated by successful construction of two nanosensors (FAMDEVD@qPNP and Cy5SurC@qPNP), which could be used as promising nanosensors for live-cell imaging of the apoptosis-related protease caspase-3 and cancer-related survivin mRNA, respectively. As expected, in the FAM channel, the FAMDEVD@qPNP showed fast and selective fluorescence responses toward caspase-3 in buffers and could be used to image the activation of drug-induced endogenous caspase-3. In the Cy5 channel, the Cy5SurC@qPNP could be used to distinguish normal cells (MCF10A) from cancer cells (HeLa) by quantitatively detecting the endogenous survivin mRNA level. It could be further used to monitor changes in the endogenous survivin mRNA expression levels in drug-treated HeLa cells. Altogether, by virtue of their high quencher loading and broad-spectrum quenching efficiency and good signal-to-background ratio, these qPNPs might be particularly attractive alternatives to other conventional nanoquenchers for the construction of more complex biosensors in the future.

DEMAND FOR MONEY AND HAYEKIAN TRIANGLES

Friedrich August von Hayek (1935) developed a specific business cycle theory in which interactions between the real and monetary sectors play a central role. In the first version of the theory, shocks to the money supply deflect market interest rate from the natural level and thus give false signals to entrepreneurs about relative demand between present goods and future goods. This idea was represented in a simple graphical tool, which was later called the Hayekian triangle. The structure of capital and the production process are depicted in a diagram that maps flows of resources from early stages of production to late stages, and finally to the hands of the consumer. On the basis of this theory, the prelimi- nary recommendation for the monetary authority was to freeze the money supply in order to prevent fluctuations in the structure of production (Hayek 1928).

Finding flares in Kepler and TESS data with recurrent deep neural networks

Stellar flares are an important aspect of magnetic activity – from both stellar evolution and circumstellar habitability viewpoints – but automatically and accurately finding them is still a challenge to researchers in the big data era of astronomy. We present an experiment to detect flares in space-borne photometric data using deep neural networks. Using a set of artificial data and real photometric data we trained a set of neural networks, and found that the best performing architectures were the recurrent neural networks using long short-term memory layers. The best trained network detected flares over 5σ with ≳80% recall and precision and was also capable of distinguishing typical false signals (e.g., maxima of RR Lyr stars) from real flares. Testing the network –trained on Kepler data– on TESS light curves showed that the neural net is able to generalize and find flares –with similar effectiveness– in completely new data with different sampling and characteristics from those of the training set ő.

Phylogeographic reconstructions can be biased by ancestral shared alleles: The case of the polymorphic lichen Bryoria fuscescens in Europe and North Africa.

Large phylogeographic studies on lichens are scarce, and none involves a single species within which different lineages show fixed alternative dispersal strategies. We investigated Bryoria fuscescens (including B.capillaris) in Europe and western North Africa by phenotypically characterizing 1400specimens from 64 populations and genotyping them with 14microsatellites. We studied population structure and genetic diversity at the local and continental scales, discussed the post-glacial phylogeography, and compared dispersal capacities of phenotypes with and without soralia. Our main hypothesis is that the estimated phylogeography, migration routes, and dispersal capacities may be strongly biased by ancestral shared alleles. Scandinavia is genetically the richest area, followed by the Iberian Peninsula, the Carpathians, and the Alps. Three gene pools were detected: two partially linked to phenotypic characteristics, and the third one genetically related to the American sister species B.pseudofuscescens. The comparison of one gene pool producing soredia and one not, suggested both as panmictic, with similar levels of isolation by distance (IBD). The migration routes were estimated to span from north to south, in disagreement with the assessed glacial refugia. The presence of ancestral shared alleles in distant populations can explain the similar IBD levels found in both gene pools while producing a false signal of panmixia, and also biasing the phylogeographic reconstruction. The incomplete lineage sorting recorded for DNA sequence loci also supports this hypothesis. Consequently, the high diversity in Scandinavia may rather come from recent immigration into northern populations than from an in situ diversification. Similar patterns of ancestral shared polymorphism may bias the phylogeographical reconstruction of other lichen species.

Testing as Prevention of Resistance in Bacteria Causing Sexually Transmitted Infections-A Population-Based Model for Germany.

Prescribed antibiotic treatments which do not match the therapeutic requirements of potentially co-existing undetected sexually transmitted infections (STIs) can facilitate the selection of antibiotic-drug-resistant clones. To reduce this risk, this modelling assessed the potential applicability of reliable rapid molecular test assays targeting bacterial STI prior to the prescription of antibiotic drugs. The modelling was based on the prevalence of three bacterial STIs in German heterosexual and men-having-sex-with-men (MSM) populations, as well as on reported test characteristics of respective assays. In the case of the application of rapid molecular STI assays for screening, the numbers needed to test in order to correctly identify any of the included bacterial STIs ranged from 103 to 104 for the heterosexual population and from 5 to 14 for the MSM population. The number needed to harm—defined as getting a false negative result for any of the STIs and a false positive signal for another one, potentially leading to an even more inappropriate adaptation of antibiotic therapy than without any STI screening—was at least 208,995 for the heterosexuals and 16,977 for the MSM. Therefore, the screening approach may indeed be suitable to avoid unnecessary selective pressure on bacterial causes of sexually transmitted infections.

Specificity of plasma oxytocin immunoassays: A comparison of commercial assays and sample preparation techniques using oxytocin knockout and wildtype mice

Oxytocin has garnered much interest due to its role in affective states, social behaviors, and diverse physiological functions. However, approaches for measuring endogenous oxytocin concentrations have generated considerable controversy and debate. Common procedures for measuring oxytocin often produce uncorrelated results, and the detected concentrations frequently vary across two orders of magnitude. These findings have led some researchers to argue that immunoassays of plasma oxytocin may be unreliable and nonspecific, particularly when samples are not first processed using an extraction procedure. Here, we assess the specificity of oxytocin immunoassays using plasma samples from wildtype (WT) and oxytocin knockout (KO) mice. Plasma samples from both genotypes were measured using immunoassay and were measured with or without a solid-phase extraction. Using a commercially available kit from Arbor Assays, we demonstrate that both techniques generate a clear contrast between genotypes, with wildtype samples containing high concentrations of oxytocin (unextracted mean = 468 pg/ml; extracted mean = 381 pg/ml), while knockout samples measured below the lower limit of detection. Analytical validations demonstrated good parallelism and spike recovery for both methods. Furthermore, the same wildtype samples measured with both procedures were highly correlated (r = 0.95), although unextracted samples measured at significantly higher concentrations (p = 2.0 ×10−7, Cohen’s d = 2.65). To test the generalizability of these results across immunoassay kits, we performed additional assays with kits from Cayman Chemical and Enzo Life Sciences. The Cayman Chemical kit produced results similar to Arbor Assays with a clean signal differentiating WT and KO plasma, both with and without an extraction step. The Enzo kit also differentiated the genotypes, with correlation between extracted and unextracted samples, but was considerably more susceptible to interference without the extraction, as evidenced by false positive signal in KO plasma samples. The extent to which these results generalize to other species remains unknown and challenging to assess.

Toxicity of Carbon Nanomaterials-Towards Reliable Viability Assessment via New Approach in Flow Cytometry.

The scope of application of carbon nanomaterials in biomedical, environmental and industrial fields is recently substantially increasing. Since in vitro toxicity testing is the first essential step for any commercial usage, it is crucial to have a reliable method to analyze the potentially harmful effects of carbon nanomaterials. Even though researchers already reported the interference of carbon nanomaterials with common toxicity assays, there is still, unfortunately, a large number of studies that neglect this fact. In this study, we investigated interference of four bio-promising carbon nanomaterials (graphene acid (GA), cyanographene (GCN), graphitic carbon nitride (g-C3N4) and carbon dots (QCDs)) in commonly used LIVE/DEAD assay. When a standard procedure was applied, materials caused various types of interference. While positively charged g-C3N4 and QCDs induced false results through the creation of free agglomerates and intrinsic fluorescence properties, negatively charged GA and GCN led to false signals due to the complex quenching effect of the fluorescent dye of a LIVE/DEAD kit. Thus, we developed a new approach using a specific gating strategy based on additional controls that successfully overcame all types of interference and lead to reliable results in LIVE/DEAD assay. We suggest that the newly developed procedure should be a mandatory tool for all in vitro flow cytometry assays of any class of carbon nanomaterials.

Long-term performance following share repurchase, signaling costs and accounting transparency: Korean evidence

Purpose Existing studies show that firms may have an incentive to use share repurchases opportunistically, thereby taking advantage of market participants’ confirmation bias that share repurchase is a signal of undervaluation. This study aims to investigate whether signaling costs and accounting transparency can serve as tools to identify opportunistic share repurchases. Design/methodology/approach The authors measure signaling costs by using two share repurchase methods (direct and indirect share repurchase) with different share repurchase costs, and measure accounting transparency using the history of earnings timeliness. The authors further measure long-term performance following share repurchases using operating performance and stock returns. Lastly, the authors compare the long-term performances between the groups defined by share repurchase method and earnings timeliness level. Findings The authors find that indirect share repurchase firms with a history of poor earnings timeliness experience unfavorable long-term performance, while other share repurchase firms do not. This finding reinforces the view that some share repurchases may be driven by managerial opportunism. In particular, when firms with a history of poor earnings-reporting behavior choose a low-cost repurchase method, their share repurchases may be motivated by managerial opportunism. Originality/value The findings suggest that past earnings timeliness and the signaling costs of a repurchase together are useful predictors of false signaling. Moreover, they suggest that investors can – at least in part – predict opportunistic share repurchases by using signaling costs and accounting transparency.

Development of Polydiacetylene-Based Testosterone Detection as a Model Sensing Platform for Water-Insoluble Hormone Analytes

We have developed a polydiacetylene (PDA)-based sensing platform to detect testosterone (T) as a potential biomarker of preterm birth. The insolubility of the steroid hormone in water, where PDA assemblies are dispersed, poses a major issue, since they can hardly interact with each other. To overcome this challenge, acetonitrile was used as a suitable solvent. In addition, to minimize false signals of PDA assemblies caused by the solvent, a mixture of acetonitrile and distilled water was selected. To prove a concept of PDA-based sensing platform for targeting T hormone, we conjugated anti-T antibodies to surface of PDA assemblies to induce selective binding between T and anti-T antibodies. The fluorescence sensory signaling of the PDA-anti-T antibody conjugate was selectively generated for T, over 3.4 times higher sensitivity of the signaling compared to that from other sex steroid hormones studied (β-estradiol and progesterone).

Abstract 1433: Acquired resistance to KRASG12C inhibitors evolves from drug tolerant cells vulnerable to AsiDNA

Abstract Purpose: Mutated KRAS represents one of the most prevalent tumor-driving events in a variety of human cancers. Although there is compelling evidence that oncogenic KRAS drives tumorigenesis, efforts to target mutant KRAS have been stalled for many years. Recently, progress has been made in the development of therapeutics against KRASG12C mutation, which is present in ~15% of lung adenocarcinoma and 0-8% of other cancers. However, therapeutic resistance to KRASG12C inhibition (KRASG12Ci) is still a clinical hurdle. Here, we describe that resistance to KRASG12Ci emerges from Drug Tolerant Cells (DTC) preventing KRASG12Ci from achieving long-term efficacy. AsiDNA is able to target specifically DTC and therefore represents a therapeutic opportunity to impede tumor progression or relapse. Experimental design: AsiDNA is a double-stranded (DS) DNA molecule that mimics DS DNA breaks to interfere with DNA repair, by over-activating a false DNA damage signaling through DNA-PK and PARP enzymes (decoy agonist). We used continuous treatment protocols, to select resistance to KRASG12Ci Sotorasib and MRTX849 and assessed the impact of AsiDNA addition on resistance prevention and abrogation. We also addressed the mechanisms underlying the survival and evolution of the residual DTC under KRASG12Ci treatment, and how AsiDNA could impede their outgrowth. Results: Long-term treatment of NCI-H23, Calu-1 or MIA PACA 2 cells harboring KRASG12C mutation led to acquired resistance in all independently treated populations. Addition of AsiDNA to Sotorasib or MRTX849 completely and irreversibly abolished resistance emergence. Cloning assays showed that acquired resistance to KRASG12Ci does not occur through the selection of a pre-existing KRAS-wt or KRAS-independent sub-clones, but rather via de novo evolution of tumor cells toward a drug resistant state. We hypothesized that resistance to KRASG12Ci could occur through the evolution of remaining tumor cells through drug-tolerant dormant cells, as it's described for other targeted therapies like tyrosine kinase inhibitors. DTC are characterized by a transient senescent phenotype and evolve progressively into proliferative state. We showed that continuous treatment with KRASG12Ci lead to the emergence of a DTC-like population displaying a senescent phenotype evolving over time into proliferative cells. The co-treatment with AsiDNA and KRASG12Ci prevents DTC regrowth. This resistance prevention was also observed when adding AsiDNA during the DTC state (three to five weeks after KRASG12Ci start), indicating a DTC-dependent resistance abrogation by AsiDNA. In line with this, we showed that DTC are hyper-sensitive to AsiDNA compared to parental cells. Conclusion: Our results provide the evidence that resistance to KRASG12Ci can evolve from DTC, and point to the therapeutic opportunity of combining AsiDNA and KRASG12Ci to overcome tumor progression or relapse. Citation Format: Wael Jdey, Aurelie Dubois, Loane Ratel, Marie-Christine Lienafa, Veronique Trochon-Joseph, Francoise Bono. Acquired resistance to KRASG12C inhibitors evolves from drug tolerant cells vulnerable to AsiDNA [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2021; 2021 Apr 10-15 and May 17-21. Philadelphia (PA): AACR; Cancer Res 2021;81(13_Suppl):Abstract nr 1433.

Follow-Up and Validation of K2 and TESS Planetary Systems With Keck NIRC2 Adaptive Optics Imaging

High resolution imaging (HRI) is a critical part of the transiting exoplanet follow-up and validation process. HRI allows previously unresolved stellar companions and background blends to be resolved, vetting false positive signals and improving the radii measurements of true planets. Through a multi-semester Keck NIRC2 adaptive optics imaging program, we have pursued HRI of K2 and TESS candidate planet host systems to provide the transiting exoplanet community with necessary data for system validation and characterization. Here we present a summary of our ongoing program that includes an up to date list of targets observed, a description of the observations and data reduction, and a discussion of planetary systems validated by the community using these data. This observing program has been key in NASA's K2 and TESS missions reaching their goals of identifying new exoplanets ideal for continued follow-up observations to measure their masses and investigate their atmospheres. Once processed, all observations presented here are available as calibrated images and resulting contrast curves through the Exoplanet Follow-up Observing Program (ExoFOP) website. We encourage members of the exoplanet community to use these data products in their ongoing planetary system validation and characterization efforts.

Photo-gated and self-powered three-dimensional DNA motors with boosted biostability for exceptionally precise and efficient tracing of intracellular survivin mRNA

Benefiting from the outstanding signal amplification effect and the admirable construction flexibility, the currently proposed DNA motors (particularly DNA walkers) based biosensing concepts have provided a forceful fluorescence imaging tool for intracellular detection. Even so, this promising sensing means is not only subject to poor controllability and prone to produce false signals but also requires exogenous powering forces owing to the common employment of DNAzyme. In response to these challenges, we are herein motivated to present some meaningful solving strategies. For one thing, the surfaces of gold nanoparticles are conducted with a photo-gated walking behavior by introducing a photocleave mode, under which the light-switchable DNA walkers are capable of being selectively activated via an external ultraviolet source to faultlessly prevent the sensing frame from being pre-initiated during cellular uptake and intracellular delivery. For another, the intracellular biothiols are consumed by MnO2 nanosheets to effectively avoid the competitions to Au–S bonds to eliminate potential false outputs and also self-supply sufficient cofactors (Mn2+) to actualize a self-powered operation pattern as well as facilitate the endocytosis process. Following these breakthroughs, a favorable analysis performance towards a model tumor biomarker (survivin mRNA) is endowed with the newly raised biosensor, whose sensitivity is low to pM level with a sound specificity for identifying single base mismatching. Moreover, the significantly improved autonomous three-dimensional DNA walkers can be used to determine and dynamically trace the targets in live cancer cells with an exceptional precise and efficient manner, commendably impelling the sensing ability of DNA motors in biological specimens.

Development of a loop-mediated isothermal amplification assay for the detection of Tilletia controversa based on genome comparison

Tilletia controversa causing dwarf bunt of wheat is a quarantine pathogen in several countries. Therefore, its specific detection is of great phytosanitary importance. Genomic regions routinely used for phylogenetic inferences lack suitable polymorphisms for the development of species-specific markers. We therefore compared 21 genomes of six Tilletia species to identify DNA regions that were unique and conserved in all T. controversa isolates and had no or limited homology to other Tilletia species. A loop-mediated isothermal amplification (LAMP) assay for T. controversa was developed based on one of these DNA regions. The specificity of the assay was verified using 223 fungal samples comprising 43 fungal species including 11 Tilletia species, in particular 39 specimens of T. controversa, 92 of T. caries and 40 of T. laevis, respectively. The assay specifically amplified genomic DNA of T. controversa from pure cultures and teliospores. Only Tilletia trabutii generated false positive signals. The detection limit of the LAMP assay was 5 pg of genomic DNA per reaction. A test performance study that included five laboratories in Germany resulted in 100% sensitivity and 97.7% specificity of the assay. Genomic regions, specific to common bunt (Tilletia caries and Tilletia laevis together) are also provided.

EDL-FET Sensor As a New Platform for COVID 19 Diagnosis

Studies utilizing biosensors are being extensively used in the field of biomedicine, drug testing and environmental sensing in recent years. Various types of biosensors are being developed to employ in different ways with different sets of advantages. Field -effect transistor (FET) based sensor system is one such sensor which has the unique advantages of rapid detection, low manufacturing cost, ease of use and high sensitivity. In this study, an EDL-FET sensor array has been used to detect a fragment of COVID-19 viral RNA in saliva without performing complex pre-treatment procedures on the sample. The results of this study demonstrate a promising screening tool that can potentially be used for rapid detection of COVID-19. The portability of the device adds an additional advantage that it can be used even in the places with poor healthcare facilities for accurate detection of the pathogen. Introduction Covid19 is one of the deadliest pandemic till date, which is challenge for the complete health care system all over the world. Rapid disease diagnosis and proper patient isolation have been proven as better way in epidemic handling and control. Due to the present unavailability of vaccines and standardized treatment protocol, rapid diagnosis and treatment is in very high mandate. Multiple diagnosing platforms have been developed for the diagnosis of COVID-19 effectively. At present, many platforms such as Lateral flow immune chromatography, serology testing and Antigen detection have been authorized by WHO for the SARS-CoV-2 detection. Real time RT-PCR is considered as the gold standard for disease diagnosis and it is the most viable method to perceive viral RNA from nasopharyngeal swab samples. However, false negative signal is also commonly seen in this PCR method. The long analysis time and large sample collection to result challenges the consistent SARS-CoV-2 detection in PCR analysis method. The quality of testing and realistic data processing also plays a critical role in success of treatment. For nasopharyngeal sampling, the swab sample is invasively collected from nasal duct and it can make the patient very uncomfortable. This may result in reduced viral content in the test sample and resulting in the rise of false negative results. Testing for viral RNA in the patient’s saliva is suggested to be an alternative source for COVID-19 detection. Taking this idea to account, our sensor array was specially fabricated for the diagnosis of viral RNA in the saliva from patient. Artificial ssDNA probes that specifically match with viral RNA, were designed and immobilized over the sensor surface. The functionalized sensor surface was exposed to the saliva sample, which was collected from the suspected patient sample. The specified viral RNA binds with the pre-immobilised ssDNA probes over the FET sensor surface. The corresponding signal changes of EDL-FET sensor for different concentration of complimentary DNA strands and an artificial Covid viral RNA (S-gene RNA) has been analysed. Sensor fabrication An extended gate chip was employed in the sensor array. Electrode surface was cleaned and to ensure proper cleaning of surface, fluorescent images were taken. 10μM ssDNA probe was prepared with TE buffer, followed by adding 1mM TCEP (tris (2-carboxyethyl) phosphine) buffer. The probe solution was then dropped on the cleaned chip and allowed to react for 30 minutes at room temperature. TCEP was used as a reducing agent which helps in the formation of dithiol bonds (SS), making the attachment of the probe easier.Probe- TTT TTT TGG CAA TGT TGT TCC TTG AGG AAGT- FAMComplementary DNA:GCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAG Electrical measurement After the DNA probe was immobilized over the sensor surface, baseline measurement was carried out. The drain current was measured at different voltage bias (Vg=0V and 1V, at Vd=2V). Throughout the measurement, drain current change was taken as sensing signal. Drain current change ( ) is defined as the difference in drain current at Vg=0V and 1V, at Vd=2V. All were performed using identical test solution composition and every measurement was carried out for 20 minutes. Conclusion We successfully immobilized the probe over the sensor area and the corresponding signals were measured with different concentrations of complimentary DNA and viral RNA. Responses to artificial-SARS-CoV-2 viral RNA on functionalized EDL-FET sensor array were effectively monitored. The detection limit of DNA in saliva sample is found to be approximately 1fM, which indicates the feasibility to direct viral RNA without PCR. Due to the ease of usage and sample collection from the patients and fast test results, the EDL-FET platform has significant promise for point of care diagnosis and high potential to be implemented in remote sensing. Figure 1

Autonomously driving multiplexed hierarchical hybridization chain reaction of a DNA cobweb sensor for monitoring intracellular microRNA

Here, we present an autonomously driving multiplexed hierarchical hybridization chain reaction (MH-HCR) of a DNA cobweb sensor for monitoring intracellular microRNAs. The amplifier of the sensor consists of an enzyme-free amplification, two-step and multiple round hybridization chain reaction (HCR) circuit, where the target miRNA-triggered output of the first HCR stage (HCR1) serves as input to generate the following HCR stage (HCR2) and then produces n cycles (HCR1-HCR2) amplifying processes to result in a DNA cobweb sensor. By introducing a pair of fluorescence resonance energy transfer (FRET) probes, this MH-HCR-based DNA cobweb sensor enables selective and sensitive detection of miRNAs down to 1 fM. In situ imaging of miRNAs in several living cells was successfully achieved. Compared with other nonlinear HCRs, the initiation sequence is enclosed in the stable multiple capture probe, avoiding interference reaction of the capture probe with a hairpin containing DNA fluorescent agent to generate false signals. This MH-HCR amplifier provides a general and robust method for the highly sensitive and selective detection of multiple miRNAs and has the potential for early cancer diagnosis.

Double Hairpin DNAs Recognition Induced a Novel Cascade Amplification for Highly Specific and Ultrasensitive Electrochemiluminescence Detection of DNA.

Herein, a novel DNA cascade amplification, including double hairpin DNAs recognition-triggered single-target recycling (D-STR) and concatenated DNA structure-controlled rolling circle amplification (C-RCA), was developed as a signal amplifier to construct a highly specific and ultrasensitive electrochemiluminescence (ECL) biosensor for human immunodeficiency virus (HIV) DNA fragments detection, which not only revealed tremendous potential in avoiding false positive signals but also obviously promoted the amplification efficiency simultaneously compared to conventional single recognition of the target. Once the target DNA triggered the rolling circle amplification (RCA), the obtained RCA products could be anchored on the Pt-modified glassy carbon electrode (GCE) via the Pt-N bond, capturing massive ruthenium (Ru)-labeled ssDNA as the ECL signal tag to generate remarkable ECL emission. As a result, the proposed biosensor showed highly specific and ultrasensitive detection of the target with the detection limit down to 27.0 aM, which gives great impetus to the development of a novel specific biosensor for practical bioanalysis and diagnostic technologies.

False Positive Results in SARS-CoV-2 Serological Tests for Samples From Patients With Chronic Inflammatory Diseases.

Patients with chronic inflammatory diseases are often treated with immunosuppressants and therefore are of particular concern during the SARS-CoV-2 pandemic. Serological tests will improve our understanding of the infection and immunity in this population, unless they tests give false positive results. The aim of this study was to evaluate the specificity of SARS-Cov-2 serological assays using samples from patients with chronic inflammatory diseases collected prior to April 2019, thus defined as negative. Samples from patients with multiple sclerosis (MS, n=10), rheumatoid arthritis (RA, n=47) with or without rheumatoid factor (RF) and/or anti-cyclic citrullinated peptide antibodies (anti-CCP2) and systemic lupus erythematosus (SLE, n=10) with or without RF, were analyzed for SARS-CoV-2 antibodies using 17 commercially available lateral flow assays (LFA), two ELISA kits and one in-house developed IgG multiplex bead-based assay. Six LFA and the in-house validated IgG assay correctly produced negative results for all samples. However, the majority of assays (n=13), gave false positive signal for samples from patients with RA and SLE. This was most notable in samples from RF positive RA patients. No false positive samples were detected in any assay using samples from patients with MS. Poor specificity of commercial serological assays could possibly be, at least partly, due to interfering antibodies in samples from patients with chronic inflammatory diseases. For these patients, the risk of false positivity should be considered when interpreting results of the SARS-CoV-2 serological assays.