EDL-FET Sensor As a New Platform for COVID 19 Diagnosis

Abstract

Studies utilizing biosensors are being extensively used in the field of biomedicine, drug testing and environmental sensing in recent years. Various types of biosensors are being developed to employ in different ways with different sets of advantages. Field -effect transistor (FET) based sensor system is one such sensor which has the unique advantages of rapid detection, low manufacturing cost, ease of use and high sensitivity. In this study, an EDL-FET sensor array has been used to detect a fragment of COVID-19 viral RNA in saliva without performing complex pre-treatment procedures on the sample. The results of this study demonstrate a promising screening tool that can potentially be used for rapid detection of COVID-19. The portability of the device adds an additional advantage that it can be used even in the places with poor healthcare facilities for accurate detection of the pathogen. Introduction Covid19 is one of the deadliest pandemic till date, which is challenge for the complete health care system all over the world. Rapid disease diagnosis and proper patient isolation have been proven as better way in epidemic handling and control. Due to the present unavailability of vaccines and standardized treatment protocol, rapid diagnosis and treatment is in very high mandate. Multiple diagnosing platforms have been developed for the diagnosis of COVID-19 effectively. At present, many platforms such as Lateral flow immune chromatography, serology testing and Antigen detection have been authorized by WHO for the SARS-CoV-2 detection. Real time RT-PCR is considered as the gold standard for disease diagnosis and it is the most viable method to perceive viral RNA from nasopharyngeal swab samples. However, false negative signal is also commonly seen in this PCR method. The long analysis time and large sample collection to result challenges the consistent SARS-CoV-2 detection in PCR analysis method. The quality of testing and realistic data processing also plays a critical role in success of treatment. For nasopharyngeal sampling, the swab sample is invasively collected from nasal duct and it can make the patient very uncomfortable. This may result in reduced viral content in the test sample and resulting in the rise of false negative results. Testing for viral RNA in the patient’s saliva is suggested to be an alternative source for COVID-19 detection. Taking this idea to account, our sensor array was specially fabricated for the diagnosis of viral RNA in the saliva from patient. Artificial ssDNA probes that specifically match with viral RNA, were designed and immobilized over the sensor surface. The functionalized sensor surface was exposed to the saliva sample, which was collected from the suspected patient sample. The specified viral RNA binds with the pre-immobilised ssDNA probes over the FET sensor surface. The corresponding signal changes of EDL-FET sensor for different concentration of complimentary DNA strands and an artificial Covid viral RNA (S-gene RNA) has been analysed. Sensor fabrication An extended gate chip was employed in the sensor array. Electrode surface was cleaned and to ensure proper cleaning of surface, fluorescent images were taken. 10μM ssDNA probe was prepared with TE buffer, followed by adding 1mM TCEP (tris (2-carboxyethyl) phosphine) buffer. The probe solution was then dropped on the cleaned chip and allowed to react for 30 minutes at room temperature. TCEP was used as a reducing agent which helps in the formation of dithiol bonds (SS), making the attachment of the probe easier.Probe- TTT TTT TGG CAA TGT TGT TCC TTG AGG AAGT- FAMComplementary DNA:GCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAG Electrical measurement After the DNA probe was immobilized over the sensor surface, baseline measurement was carried out. The drain current was measured at different voltage bias (Vg=0V and 1V, at Vd=2V). Throughout the measurement, drain current change was taken as sensing signal. Drain current change ( ) is defined as the difference in drain current at Vg=0V and 1V, at Vd=2V. All were performed using identical test solution composition and every measurement was carried out for 20 minutes. Conclusion We successfully immobilized the probe over the sensor area and the corresponding signals were measured with different concentrations of complimentary DNA and viral RNA. Responses to artificial-SARS-CoV-2 viral RNA on functionalized EDL-FET sensor array were effectively monitored. The detection limit of DNA in saliva sample is found to be approximately 1fM, which indicates the feasibility to direct viral RNA without PCR. Due to the ease of usage and sample collection from the patients and fast test results, the EDL-FET platform has significant promise for point of care diagnosis and high potential to be implemented in remote sensing. Figure 1