Flagellar Expression Research Articles

Comparison of heat stress responses of immobilized and planktonic Salmonella enterica serovar Typhimurium

Salmonellae are often present as immobilized cells in food products in the form of micro-colonies. Despite this, most research into Salmonella physiology has been performed with bacteria grown as planktonic cultures. In the current study, we compared the transcriptome of planktonic and immobilized Salmonella enterica subsp. enterica serovar Typhimurium (S. Typhimurium) subjected to 30 min of heat stress at 45 °C. The expression of 538 genes was differently regulated between the two conditions after 30 min. Heat stress of an immobilized culture induced expression of flagella and virulence genes compared to the non-heat stressed immobilized bacteria. Immobilized heat stressed S. Typhimurium was more invasive in HeLa cells than the non-heat stressed controls, whereas the heat stress caused planktonic bacteria to be less invasive. The decrease in invasion of heat stressed planktonic cultures returned to non-heat stressed levels 30 min post treatment, whereas the increased invasion of HeLa cells of the heat stressed immobilized cultures still remained 30 min after the heat stress was terminated. This study shows that immobilized bacteria respond to heat stress differently than planktonic bacteria.

Atomic force microscopy: A powerful tool for studying bacterial swarming motility

Swarming motility is a fascinating phenomenon by which some bacteria use flagella to move over solid surfaces. Understanding the molecular mechanisms underlying swarming motility requires studying the factors that induce and control flagella expression in swarming cells. Traditionally, flagella are observed by optical or electron microscopy, but none of these techniques combine versatility and easiness, with quantitative and high-resolution information. We report an atomic force microscopy (AFM)-based approach for the fast imaging of bacterial phenotypes (cell shape, flagella expression) in swarming motility studies. Cells from the Gram-positive bacterium Bacillus thuringiensis sv. israelensis were inoculated on energy-rich media containing increasing agar concentrations. Following swarming assays (2 days), the cell morphology and the amount of flagella were directly observed by AFM imaging in air. Consistent with the macroscopic swarming behavior, cells harvested from the rim of colonies spreading on soft agar were hyperflagellated, elongated and arranged in chains. Increasing the agar concentration led to much lower amounts of flagella and to shorter rod-shaped cells, a finding consistent with the slower swarming motility of the cells. Cells taken from colony centers on soft and hard agar surfaces were generally non-flagellated, rod-shaped, rarely arranged in chains, and exhibited lysis and sporulation. This study shows that AFM imaging can readily discriminate between swarming and non-swarming cells, and quantify their morphological details, thus offering an important tool to study the dynamics of bacterial populations.

The Bacterial Cytoskeleton Modulates Motility, Type 3 Secretion, and Colonization in Salmonella

Although there have been great advances in our understanding of the bacterial cytoskeleton, major gaps remain in our knowledge of its importance to virulence. In this study we have explored the contribution of the bacterial cytoskeleton to the ability of Salmonella to express and assemble virulence factors and cause disease. The bacterial actin-like protein MreB polymerises into helical filaments and interacts with other cytoskeletal elements including MreC to control cell-shape. As mreB appears to be an essential gene, we have constructed a viable ΔmreC depletion mutant in Salmonella. Using a broad range of independent biochemical, fluorescence and phenotypic screens we provide evidence that the Salmonella pathogenicity island-1 type three secretion system (SPI1-T3SS) and flagella systems are down-regulated in the absence of MreC. In contrast the SPI-2 T3SS appears to remain functional. The phenotypes have been further validated using a chemical genetic approach to disrupt the functionality of MreB. Although the fitness of ΔmreC is reduced in vivo, we observed that this defect does not completely abrogate the ability of Salmonella to cause disease systemically. By forcing on expression of flagella and SPI-1 T3SS in trans with the master regulators FlhDC and HilA, it is clear that the cytoskeleton is dispensable for the assembly of these structures but essential for their expression. As two-component systems are involved in sensing and adapting to environmental and cell surface signals, we have constructed and screened a panel of such mutants and identified the sensor kinase RcsC as a key phenotypic regulator in ΔmreC. Further genetic analysis revealed the importance of the Rcs two-component system in modulating the expression of these virulence factors. Collectively, these results suggest that expression of virulence genes might be directly coordinated with cytoskeletal integrity, and this regulation is mediated by the two-component system sensor kinase RcsC.

Small regulatory RNAs control the multi‐cellular adhesive lifestyle of Escherichia coli

Small regulatory RNA molecules have recently been recognized as important regulatory elements of developmental processes in both eukaryotes and bacteria. We here describe a striking example in Escherichia coli that can switch between a single-cell motile lifestyle and a multi-cellular, sessile and adhesive state that enables biofilm formation on surfaces. For this, the bacterium needs to reprogramme its gene expression, and in many E. coli and Salmonella strains the lifestyle shift relies on control cascades that inhibit flagellar expression and activate the synthesis of curli, extracellular adhesive fibres important for co-aggregation of cells and adhesion to biotic and abiotic surfaces. By combining bioinformatics, genetic and biochemical analysis we identified three small RNAs that act by an antisense mechanism to downregulate translation of CsgD, the master regulator of curli synthesis. Our demonstration that basal expression of each of the three RNA species is sufficient to downregulate CsgD synthesis and prevent curli formation indicates that all play a prominent role in the curli regulatory network. Our findings provide the first clue as to how the Rcs signalling pathway negatively regulates curli synthesis and increase the number of small regulatory RNAs that act directly on the csgD mRNA to five.

LuxS and quorum-sensing in Campylobacter

Several intercellular bacterial communication mechanisms have been identified in a broad range of bacterial species. These systems, collectively termed quorum-sensing systems, have been demonstrated to play significant roles in a variety of bacterial processes including motility, biofilm formation, expression of virulence genes, and animal colonization. Campylobacter jejuni is known to possess a LuxS/ autoinducer-2 (AI-2) mediated system that have been partially characterized over the last decade. AI-2 is formed as a byproduct of the activated methyl recycling pathway, specifically by the LuxS enzyme. Previous work in our laboratory and that of others has demonstrated that this gene is involved in a variety of physiologic pathways of C. jejuni including motility, autoagglutination, cytolethal distending toxin (CDT) expression, flagellar expression, oxidative stress, and animal colonization. This review article will summarize the current research associated with LuxS in C. jejuni and will provide insights into the role of this system in the metabolism and intercellular communication of this organism. Additionally, the evidence for other quorum-sensing pathways in Campylobacter will be discussed.

Nanoscale imaging of Bacillus thuringiensis flagella using atomic force microscopy

Because bacterial flagella play essential roles in various processes (motility, adhesion, host interactions, secretion), studying their expression in relation to function is an important challenge. Here, we use atomic force microscopy (AFM) to gain insight into the nanoscale surface properties of two wild-type and four mutant strains of Bacillus thuringiensis exhibiting various levels of flagellation. We show that, unlike AFM in liquid, AFM in air is a simple and reliable approach to observe the morphological details of the bacteria, and to quantify the density and dimensions of their flagella. We found that the amount of flagella expressed by the six strains, as observed at the nanoscale, correlates with their microscopic swarming motility. These observations provide novel information on flagella expression in gram-positive bacteria and demonstrate the power of AFM in genetic studies for the fast assessment of the phenotypic characteristics of bacterial strains altered in cell surface appendages.

The Aeromonas dsbA mutation decreased their virulence by triggering type III secretion system but not flagella production

Pathogenesis of Aeromonas species have been reported to be associated with virulence factors such as lipopolysaccharides (LPS), bacterial toxins, bacterial secretion systems, flagella, and other surface molecules. Dsb ( Di sulfide bond) proteins play an important role in catalyzing disulfide bond formation in proteins within the periplasmic space. An A. hydrophila dsbA mutant with attenuated virulence using Dictyostelium amoebae as an alternative host model was identified. The attenuated virulence was tested in other animal models (by intraperitoneal injection in fish and mice) and was correlated with the presence of a defective type III secretion system for the first time in non enteric bacteria. The dsbA mutation was shown in several enteric bacteria to involve the outer membrane secretin. The defect in Aeromonas also seems to involve the outer membrane secretin homologue named AscC. However, unlike what happen in Escherichia coli, no changes in motility or flagella expression were observed for A. hydrophila dsbA mutants. The loss of E. coli motility caused by deletion of dsbA is likely due to defective disulfide bond formation in FlgI, a component of the flagella. No disulfide bond formation in FlgI homologues in Aeromonas flagella biogenesis, either polar or lateral, could be expected according to their amino acid residues sequences.

Determination of Target Sequence Bound by PapX, Repressor of Bacterial Motility, in flhD Promoter Using Systematic Evolution of Ligands by Exponential Enrichment (SELEX) and High Throughput Sequencing

Most uncomplicated urinary tract infections (UTIs) are caused by uropathogenic Escherichia coli (UPEC). Both motility and adherence are integral to UTI pathogenesis, yet they represent opposing forces. Therefore, it is logical to reciprocally regulate these functions. In UPEC strain CFT073, PapX, a non-structural protein encoded by one of the two pap operons encoding P fimbria adherence factor, represses flagella-mediated motility and is a putative member of the winged helix transcription factor family. The mechanism of this repression, however, is not understood. papX is found preferentially in more virulent UPEC isolates, being significantly more prevalent in pyelonephritis strains (53% of isolates) than in asymptomatic bacteriuria (32%) or fecal/commensal (12.5%) strains. To examine PapX structure-function, we generated papX linker insertion and site-directed mutants, which identified two key residues for PapX function (Lys(54) and Arg(127)) within domains predicted by modeling with I-TASSER software to be important for dimerization and DNA binding, respectively. To determine the PapX binding site in the CFT073 genome, systematic evolution of ligands by exponential enrichment (SELEX) in conjunction with high throughput sequencing was utilized for the first time to determine a novel binding site for a bacterial transcription factor. This method identified a 29-bp binding site within the flhDC promoter (TTACGGTGAGTTATTTTAACTGTGCGCAA), centered 410 bp upstream of the flhD translational start site. Gel shift experiments demonstrated that PapX binds directly to this site to repress transcription of flagellar genes.

염 농도가 어류 병원체 Edwardsiella tarda의 운동성과 편모발현에 미치는 영향

염농도에 따른 E. tarda CK41의 운동성을 알아보기 위하여 1.0%와 3.5%의 염농도를 가지는 운동성 측정 배지에서 집락의 변화를 관찰한 결과, 3.5% 염농도 조건에서 운동성이 감소하는 것을 확인할 수 있었다. 1.0%과 3.5% 염농도 조건에서의 생육도를 측정해본 결과 각 염농도 조건에 따른 생균수의 차이는 매우 적은 것으로 보아, 높은 염농도에서의 운동성의 감소는 생육정체가 아닌 실질적인 운동성의 차이에 의함을 알 수 있었다. 이러한 염농도에 의한 운동성의 차이가 편모에 의한 것인지를 알아보기 위하여 투과 전자 현미경으로 형태학적 관찰을 해본 결과, 3.5% 염농도에서는 편모의 형성이 되지 않음을 확인하였다. E. tarda는 PFAD와 FDP 두개의 편모 유전자를 가지며 이들간의 아미노산 상동률은 93%로 높은 편이다. 편모의 발현양의 확인을 위하여 PFAD 특이적인 다클론성 항체를 제작하기 위하여, PFAD를 과발현시키는 재조합 플라스미드 pBP793을 구축하여 대장균 발현시스템으로 발현시켜 정제한 후, 토끼에서 면역반응을 유도하여 특이 항체를 제작하였다. PFAD 특이적인 다클론성 항체를 이용한 immunoblot assay 결과, 3.5% 염농도 조건에서 배양한 E. tarda CK41의 경우 1.0% 염농도에서 보다 반응하는 면역 활성 단백질 밴드가 낮은 것으로 측정되었다. 이러한 결과를 종합하여 볼 때, 염농도가 높은 해수환경에서의 운동성의 감소는 E. tarda CK41의 편모 단백질이 제대로 발현되지 않아 기능적인 편모의 형성이 이루어지지 않는다는 것을 예증하고 있다. 향후 연구에서 어떠한 메카니즘에 의해 염농도가 flagellin의 발현을 조절하는지를 밝힐 필요가 있다. E. tarda, a fish pathogen, can survive in seawater under relatively high salt conditions as well as in fish under physiological salt conditions. Bacterial growth under different salt concentrations may influence the expression of genes involved in bacterial structure and physiology. The growth rate of E. tarda culture in high salt (3.5% NaCl) was similar to that in low salt (1.0% NaCl, physiological salt concentration). Interestingly, the strain moved much faster in low salt conditions than in high salt conditions. Electron microscopic observation demonstrated that the bacterial cells grown in high salt had less or no flagellation. Obvious flagellation was observed in the parental strain E. tarda CK41 grown in low-salt condition. Two putative genes coding flagellin were identified in the E. tarda genome sequences. The amino acid sequence comparison of each gene revealed 93% identities. A flagellin gene was PCR amplified and cloned into a cloning vector. Using an E. coli protein expression system, a part of flagellin protein was overexpressed. Using the purified protein, an anti-flagellin antibody was raised in the rabbit. Immunoblot analyses with flagellin specific antibody demonstrated that E. tarda CK41 expressed falgellin in low salt conditions, which is consistent with the results seen in motility assay and microscopic observation. This is the first report of salt regulated flagella expression in E. tarda.

Dual regulatory pathways of flagellar gene expression by ClpXP protease in enterohaemorrhagic Escherichia coli

In enterobacteria such as Escherichia coli and Salmonella species, flagellar biogenesis is strictly dependent upon the master regulator flhDC. Here, we demonstrate that in enterohaemorrhagic E. coli (EHEC), the flagellar regulon is controlled by ClpXP, a member of the ATP-dependent protease family, through two pathways: (i) post-translational control of the FlhD/FlhC master regulator and (ii) transcriptional control of the flhDC operon. Both FlhD and FlhC proteins accumulated markedly following ClpXP depletion, and their half-lives were significantly longer in the mutant cells, suggesting that ClpXP is responsible for degrading FlhD and FlhC proteins, leading to downregulation of flagellar expression. ClpXP was involved in regulating the transcription of the flhD promoter only when the cells had entered stationary phase in a culture medium that markedly induced expression of the locus of enterocyte effacement (LEE). Comparative analyses of transcription from the flhD promoter in EHEC cells with different genetic backgrounds suggested that the downregulation of flhDC expression by ClpXP is dependent on the LEE-encoded GrlR-GrlA system. We have also shown that the degradation of FlhD and FlhC by ClpXP is responsible for downregulating flagellar expression even when LEE expression is induced.

Genetic diversity in monophasic (1,4,[5],12:i:- and 1,4,[5],12:-:1,2) and in non-motile (1,4,[5],12:-:-) variants of Salmonella enterica S. Typhimurium

Monophasic variants of Salmonella enterica serotype Typhimurium, lacking either the second phase H-antigen with the antigenic formula 1,4,[5],12:i:- or lacking the first phase H-antigen with the antigenic formula 1,4,[5],12:-:1,2, and a non-motile variant lacking both flagellar phases were phenotypically and genotypically characterised. The genetic diversity of a collection of 58 isolates of Salmonella enterica 1,4,[5],12:i:- (n=23), 1,4,[5],12:-:1,2 (n=17), 1,4,[5],12:-:- (n=18) mainly from swine, bovine and poultry sources using a novel multiplex real-time PCR to simultaneously target different classes of genes (i.e. 10 loci) was investigated in regards to antimicrobial resistance and pulsed field gel electrophoresis (PFGE) typing. The majority of the S. 1,4,[5],12:i:- strains were genotypically confirmed to be variant of serotype Typhimurium, except two mdh negative isolates. Five fljB positive S. 1,4,[5],12:i:- variants were detected and could be considered as “inconsistent” variant. Moreover, presence of the fliC and fljB amplicons in the phenotypically monophasic S. 1,4,[5],12:-:1,2 and non-motile isolates suggest that their expressions should be blocked by mutation or deletion in the promoter regions linked to the flagellar phase expression. Based on the combination of detection of the following markers: Salmonella Pathogenic Islands (SPI-2 to SPI-5), virulence plasmid (spvC), antimicrobial resistance markers (blaTEM and sul1), Salmonella Genomic island (SGI-1 left junction), the integrase from class 1 integron (intI1) and DT104 16S-23S spacer region, thirteen different genotypes were identified among the 58 isolates. All investigated isolates showed virulence potential as determined by the presence of four SPI markers, which was exhibited in the genotype A9 mainly encountered for S. 1,4,[5],12:-:1,2 isolates. In contrast, high-frequency of markers were encountered for S. 1,4,[5],12:i:- assigned to genotypes B7 gathering almost all 10 markers except SGI-1. Frequencies of SGI-1 markers typically detected in serotype Typhimurium strains differed strongly among the three variants ranging from 0% for fljB negative S. 1,4,[5],12:i:- to 58.8% for S. 1,4,[5],12:-:-. The three variants were clearly phenotypically and genotypically distinct and varied in their resistance-types as well as in their PFGE types and genotypes newly described in this study. This first study on the French collection from non human sources could suggest presence of the Spanish clone in France as well as, to a lesser extent, some “inconsistent” variants exhibiting the resistance-type AM S SSS TE previously described in different European countries.

The non-motile phenotype of Salmonella hha ydgT mutants is mediated through PefI-SrgD

BackgroundTwo ancestral nucleoid-associated proteins called Hha and YdgT contribute to the negative regulation of several virulence-associated genes in Salmonella enterica serovar Typhimurium. Our previous work showed that Hha and YdgT proteins are required for negative regulation of Salmonella Pathogenicity Island-2 and that hha ydgT double mutants are attenuated for murine infection. Interestingly, hha ydgT mutant bacteria exhibited a non-motile phenotype suggesting that Hha and YdgT have a role in flagellar regulation.ResultsIn this study we show that the non-motile phenotype of hha ydgT mutants is due to decreased levels of the master transcriptional regulator FlhD4C2 resulting in down-regulation of class II/III and class III flagellar promoters and lack of surface flagella on these cells. The horizontally acquired pefI-srgD region was found to be partially responsible for this phenotype since deletion of pefI-srgD in a hha ydgT deletion background resulted in transient restoration of class II/III and III transcription, expression of surface flagella, and motility in the quadruple mutant.ConclusionThese data extend our current understanding of the mechanisms through which Hha and YdgT regulate flagellar biosynthesis and further describe how S. Typhimurium has integrated horizontal gene acquisitions into ancestral regulatory networks.

EAL Domain Protein YdiV Acts as an Anti-FlhD 4 C 2 Factor Responsible for Nutritional Control of the Flagellar Regulon in Salmonella enterica Serovar Typhimurium

Flagellar operons are divided into three classes with respect to their transcriptional hierarchy in Salmonella enterica serovar Typhimurium. The class 1 gene products FlhD and FlhC act together in an FlhD(4)C(2) heterohexamer, which binds upstream of the class 2 promoters to facilitate binding of RNA polymerase. In this study, we showed that flagellar expression was much reduced in the cells grown in poor medium compared to those grown in rich medium. This nutritional control was shown to be executed at a step after class 1 transcription. We isolated five Tn5 insertion mutants in which the class 2 expression was derepressed in poor medium. These insertions were located in the ydiV (cdgR) gene or a gene just upstream of ydiV. The ydiV gene is known to encode an EAL domain protein and to act as a negative regulator of flagellar expression. Gene disruption and complementation analyses revealed that the ydiV gene is responsible for nutritional control. Expression analysis of the ydiV gene showed that its translation, but not transcription, was enhanced by growth in poor medium. The ydiV mutation did not have a significant effect on either the steady-state level of flhDC mRNA or that of FlhC protein. Purified YdiV protein was shown in vitro to bind to FlhD(4)C(2) through interaction with FlhD subunit and to inhibit its binding to the class 2 promoter, resulting in inhibition of FlhD(4)C(2)-dependent transcription. Taking these data together, we conclude that YdiV is a novel anti-FlhD(4)C(2) factor responsible for nutritional control of the flagellar regulon.

Activation of Motility by Sensing Short-Chain Fatty Acids via Two Steps in a Flagellar Gene Regulatory Cascade in Enterohemorrhagic Escherichia coli

The regulated expression of virulence genes is critical for successful infection by an intestinal pathogen. Bacteria rely on sensing environmental signals to find preferable niches and reach the infectious state. Orally ingested enterohemorrhagic Escherichia coli (EHEC) travels through the gastrointestinal tract and encounters a variety of environmental factors, some of which act as triggering signals for the induction of virulence genes. Butyrate, one of the main short-chain fatty acids (SCFAs), is such a signal, enhancing the expression of genes for intimate attachment and type III secretion. We further explored the role of SCFAs and found a positive effect of SCFAs on flagellar expression. Although EHEC did not produce flagella when grown in Dulbecco's modified Eagle's medium (DMEM), a tissue culture medium that enhances virulence gene expression, the addition of SCFAs to the medium induced the production of flagella, and the EHEC bacteria became motile. Among SCFAs, butyrate simultaneously activates both virulence and flagellar genes. Flagella did not affect initial adherence, and they were not expressed in adherent bacteria during microcolony formation. SCFAs activated flagellar genes via two regulatory steps. Butyrate activated the flhDC regulatory genes through leucine-responsive regulatory protein (Lrp), which is also a regulator of virulence genes. However, butyrate, acetate, and propionate also activated downstream genes independently of flhDC activation. Consequently, when encountering increased concentrations of SCFAs, which are abundant in acetate, in the intestine, EHEC first activates flagellar production and motility, followed by genes involved in adherence and type III secretion, which leads to efficient adherence in a preferable niche.

Have flagella a preferred orientation during early stages of biofilm formation?: AFM study using patterned substrates

Biofilm development involves several stages and flagellar expression of bacteria is considered an important factor in this process. However, its role in the earliest stage of biofilm development is not yet clear. In order to analyse this topic, Pseudomonas fluorescens samples were trapped on a patterned gold surface with sub-microtrenches (ST) so as to hinder their motility, and nanostructured gold with random orientation (SR) was used as control substrate. Atomic force microscopic (AFM) observations were made on untreated samples. Initially, ca. 75% of the flagella on ST and 85% of flagella on SR are oriented towards the neighbouring bacteria. Some of them made contact and surrounded the cells. Subsequently, 2-D raft structures formed on SR inert substrates with lateral curly flagella, while those at the poles of the rafts turned towards the nearest cell group. A few flagella and the formation of 3-D bacterial structures were observed on toxic substrates like copper. Results showed that patterned substrates are suitable tools to detect the orientation of flagella in the earliest stage of biofilm formation on solid opaque surfaces avoiding sample pre-treatment.

OmpR controls Yersinia enterocolitica motility by positive regulation of flhDC expression

Flagella and invasin play important roles during the early stages of infection by the enteric pathogen Yersinia enterocolitica. Our previous study demonstrated that OmpR negatively regulates invasin gene expression at the transcriptional level. The present study focused on the role of OmpR in the regulation of flagella expression. Motility assays and microscopic observations revealed that an ompR mutant strain exhibits a non-motile phenotype due to the lack of flagella. An analysis of flhDC::lacZYA chromosomal fusions demonstrated a decrease in flhDC expression in ompR mutant cells, suggesting a role for OmpR in the positive control of flagellar master operon flhDC, which is in contrast to the negative role it plays in Escherichia coli. Moreover, high temperature or osmolarity and low pH decreased flhDC expression and OmpR was not required for the response to these factors. Evidence from an examination of the DNA binding properties of OmpR in vitro indicated that the mechanism by which OmpR regulates flhDC is direct. Electrophoretic mobility shift assays confirmed that OmpR binds specifically to the flhDC promoter region and suggested the presence of more than one OmpR-binding site. In addition, phosphorylation of OmpR by acetyl-P appeared to stimulate the binding abilities of OmpR. Together with the results of our previous studies revealing the negative role of OmpR in the regulation of invasin expression, these findings support a model in which invasion and motility might be reciprocally regulated by OmpR.

Pseudomonas aeruginosa Evasion of Phagocytosis Is Mediated by Loss of Swimming Motility and Is Independent of Flagellum Expression

Pseudomonas aeruginosa is a pathogenic Gram-negative bacterium that causes severe opportunistic infections in immunocompromised individuals; in particular, severity of infection with P. aeruginosa positively correlates with poor prognosis in cystic fibrosis (CF) patients. Establishment of chronic infection by this pathogen is associated with downregulation of flagellar expression and of other genes that regulate P. aeruginosa motility. The current paradigm is that loss of flagellar expression enables immune evasion by the bacteria due to loss of engagement by phagocytic receptors that recognize flagellar components and loss of immune activation through flagellin-mediated Toll-like receptor (TLR) signaling. In this work, we employ bacterial and mammalian genetic approaches to demonstrate that loss of motility, not the loss of the flagellum per se, is the critical factor in the development of resistance to phagocytosis by P. aeruginosa. We demonstrate that isogenic P. aeruginosa mutants deficient in flagellar function, but retaining an intact flagellum, are highly resistant to phagocytosis by both murine and human phagocytic cells at levels comparable to those of flagellum-deficient mutants. Furthermore, we show that loss of MyD88 signaling in murine phagocytes does not recapitulate the phagocytic deficit observed for either flagellum-deficient or motility-deficient P. aeruginosa mutants. Our data demonstrate that loss of bacterial motility confers a dramatic resistance to phagocytosis that is independent of both flagellar expression and TLR signaling. These findings provide an explanation for the well-documented observation of nonmotility in clinical P. aeruginosa isolates and for how this phenotype confers upon the bacteria an advantage in the context of immune evasion.

Temporal and spatial trigger of post‐exponential virulence‐associated regulatory cascades by Legionella pneumophila after bacterial escape into the host cell cytosol

During late stages of infection and prior to lysis of the infected macrophages or amoeba, the Legionella pneumophila-containing phagosome becomes disrupted, followed by bacterial escape into the host cell cytosol, where the last few rounds of bacterial proliferation occur prior to lysis of the plasma membrane. This coincides with growth transition into the post-exponential (PE) phase, which is controlled by regulatory cascades including RpoS and the LetA/S two-component regulator. Whether the temporal expression of flagella by the regulatory cascades at the PE phase is exhibited within the phagosome or after bacterial escape into the host cell cytosol is not known. We have utilized fluorescence microscopy-based phagosome integrity assay to differentiate between vacuolar and cytosolic bacteria/or bacteria within disrupted phagosomes. Our data show that during late stages of infection, expression of FlaA is triggered after bacterial escape into the macrophage cytosol and the peak of FlaA expression is delayed for few hours after cytosolic residence of the bacteria. Importantly, bacterial escape into the host cell cytosol is independent of flagella, RpoS and the two-component regulator LetA/S, which are all triggered by L. pneumophila upon growth transition into the PE phase. Disruption of the phagosome and bacterial escape into the cytosol of macrophages is independent of the bacterial pore-forming activity, and occurs prior to the induction of apoptosis during late stages of infection. We conclude that the temporal and spatial engagement of virulence-associated regulatory cascades by L. pneumophila at the PE phase is temporally and spatially triggered after phagosomal escape and bacterial residence in the host cell cytosol.

Flagellated but Not Hyperfimbriated Salmonella enterica Serovar Typhimurium Attaches to and Forms Biofilms on Cholesterol-Coated Surfaces

The asymptomatic, chronic carrier state of Salmonella enterica serovar Typhi occurs in the bile-rich gallbladder and is frequently associated with the presence of cholesterol gallstones. We have previously demonstrated that salmonellae form biofilms on human gallstones and cholesterol-coated surfaces in vitro and that bile-induced biofilm formation on cholesterol gallstones promotes gallbladder colonization and maintenance of the carrier state. Random transposon mutants of S. enterica serovar Typhimurium were screened for impaired adherence to and biofilm formation on cholesterol-coated Eppendorf tubes but not on glass and plastic surfaces. We identified 49 mutants with this phenotype. The results indicate that genes involved in flagellum biosynthesis and structure primarily mediated attachment to cholesterol. Subsequent analysis suggested that the presence of the flagellar filament enhanced binding and biofilm formation in the presence of bile, while flagellar motility and expression of type 1 fimbriae were unimportant. Purified Salmonella flagellar proteins used in a modified enzyme-linked immunosorbent assay (ELISA) showed that FliC was the critical subunit mediating binding to cholesterol. These studies provide a better understanding of early events during biofilm development, specifically how salmonellae bind to cholesterol, and suggest a target for therapies that may alleviate biofilm formation on cholesterol gallstones and the chronic carrier state.

Effect of Ibicella lutea on uropathogenic Proteus mirabilis growth, virulence, and biofilm formation

Proteus mirabilis, an important uropathogen that can cause complicated urinary tract infections (UTI), has emerged as a therapeutic problem following mutations that compromise the use of antimicrobial drugs. Due to the serious effects associated with uropathogenic P. mirabilis and the problems related to the use of antibiotics, it is necessary to develop alternative strategies for its control. The objective of this study was to assess the effect of Ibicella lutea extract, a South American indigenous plant, on growth, virulence and biofilm production of uropathogenic P. mirabilis. This study was based on the extract generation and the assessment of its effect on bacterial features related to virulence. These assays involved determination of antibacterial activity, swarming motility, Western blot to assess expression of fimbriae and flagella, biofilms formation, haemagglutination, haemolysis, and electron microscopy. I. lutea extract had an effect on bacterial growth rate and bacterial morphology. It also affected P. mirabilis swarming differentiation, hemagglutination and biofilm formation on glass and polystyrene. These findings suggest that I. lutea may have a role as an agent for the control of P. mirabilis UTI.