Resource Exports Research Articles

Regional development in Сentral Asia: status, problems and prospects

The article deals with the problems of the impact of the global COVID-19 pandemic on the economy of the Central Asian countries (CA), where such industries as the healthcare system, transport and supply, services and employment, incomes and social protection of the population, trade relations between regions and the export of natural resources were mainly affected. The article analyzes the anti-crisis measures taken by national governments for the comprehensive recovery and development of regions, as well as the sustainability of economic growth in general. The consequences and prospects of regional development are considered, the difference in approaches to the implementation of anti-crisis measures in each of the Central Asian states is emphasized. The authors of the article believe that anti-crisis support measures should be maintained until the recovery of the economy and social sphere becomes an irreversible process, since the unpredictability and uncertainty of the course of the pandemic, its possible protracted nature acts as the main risk of disruption of the planned terms of economic recovery and social development of the regions.

Energy and environmental security of the European Union in the context of russia's unstable military and economic policy

The countries of the European Union are experiencing the first real global energy crisis in history, bearing in mind that reliability and the possibility of receiving the required amount of energy resources are the basis of full functioning and further sustainable social and economic development of countries. The purpose of the study is to analyse European Union energy and environmental security regulatory measures in terms of unpredictable actions of the main supplier of energy resources. A set of general scientific and special methods of scientific cognition was used: the historical method with a systematic analysis of energy law; the structural and functional method; synthesis; deduction and induction. As a result of the conducted study, the main areas of increasing energy security in the European Union were determined based on scientific programmes using renewable energy sources, which gradually reduce the demand for organic fossil fuels (natural gas, oil, coal, peat, oil shale). The situation of dependence of EU states on the export of russian energy resources was also characterised and the process of changing the EU energy policy was illustrated. This research contains an analysis of the ecological aspect of the change in the situation with energy security in the EU, and forecasts regarding the situation on the international energy market of russia. The primary theoretical principles, conclusions, and practical recommendations in the industry of the energy market would help accelerate the diversification of the natural gas market in Ukraine in terms of joining the European Union energy market

First report of Odontoglossum ringspot virus in Vanilla (Orchidaceae) in Madagascar.

Vanilla (Vanilla planifolia, Orchidaceae) is Madagascar's leading agricultural export resource which provides 80% of world's consumption. During a phytosanitary survey conducted from November 2019 to March 2021 in the main vanilla production regions of Madagascar, 250 plots were indexed for cymbidium mosaic virus (CymMV, Potexvirus genus) and odontoglossum ringspot virus (ORSV, Tobamovirus genus) the two most prevalent viruses of cultivated orchids worldwide (Zettler et al., 1990). For each plot, bulk samples (ten leaves taken at random) were assayed using Immunostrips (AGDIA, ISK 13301). A quarter of the plots (63/250) tested positive for CymMV. The highest prevalence of CymMV was observed in the SAVA region (57 out of 153 plots = 37,2%) where the virus has been reported since 1997 (Grisoni et al., 2010). Six plots located in the district of Mahanoro (Atsinanana) tested positive for ORSV. A few plants in these plots showed chlorotic often annular spots on their leaves. They were individually tested positive for ORSV, and negative for CymMV and potyviruses (Immunostrips AGDIA ISK 27200), the other two viruses reported so far in vanilla in Madagascar. To confirm the diagnosis of ORSV, leaf samples from five of the six infected plots were analysed by Tube Capture-RT-PCR (Grisoni et al., 2017) using two pairs of primers flanking the ORSV coat protein (CP) gene: OrCP1 (GGTCGGTAATGGTGTTAG) / OrCP2 (TGCATTATCGTATGCTCC), and CPOR-F(ATGTCTTACACTATTACAGACC) / CPOR-R(TTAGGAAGAGGTCCAAGTAAG). The five samples gave amplicons of the expected size (820 nt and 476 nt, respectively) and were sequenced with Sanger technology (Macrogen, The Netherlands). The ORSV-CP sequences of the Mahanoro isolates showed very close similarity to 198 ORSV-CP sequences from GenBank (95.8% to 99.6% nucleotide and 94.5 to 100% amino-acid identities), and less than 75.4% nucleotide (80.1% amino-acid) identities with Bell pepper mosaic virus (DQ355023), the tobamovirus closest to ORSV. The five ORSV-CP sequences from vanilla were deposited in GenBank under accessions numbers OM847399 to OM847403. These data confirmed that ORSV infects vanilla vines in Madagascar. To our knowledge, this is the first report of this virus in Madagascar and of its ability to infect symptomatically V. planifolia. The five ORSV isolates from vanilla had more than 98.7 % nucleotide identities of CP gene and clustered into a monophyletic group in maximum likelihood phylogenetic tree, suggesting a single origin of these isolates. To further investigate the origin of ORSV in Madagascar, we made use of RNA sequences isolated at different points in time to infer the timing of evolutionary events (Rieux et al., 2016). We estimated the CP gene substitution rate to 4.8E-4 subst/site/year [95%HPD 2.1E-4 - 8.7E-4] which is close to the estimate of He et al. (2019) based on a slightly different sequences set (1.25E-3 subst/site/year). We dated the initial contamination of vanilla plts by ORSV between 2004 and 2013. Both ORSV and CymMV have deleterious effects on many ornamental orchids, and the pathogenicity of CymMV is exacerbated when co-infecting with ORSV (Lee et al., 2021). Therefore, ORSV represents a new threat to the Malagasy vanilla crop, especially in regions where CymMV is already rife. Given the economic importance of vanilla cultivation in the country, the implementation of prophylactic measures aimed at preventing the spread of ORSV, in particular through the sanitary control of cuttings, should be a priority for the vanilla industry.

Russia's Position in the System of International Trade Relations in the Context of Sanctions Imposed Against Russia

International trade, which constitutes liaison between producers of goods and services from different countries, is vital for any country in the modern world. International trade is based on the division of labor and characterized by mutual economic dependence. Russia in 2022 is still one of the main trading partners in the system of international trade relations due to its role as a key exporter of energy resources. In this context, it is relevant to study the current situation in Russia's foreign trade greatly affected by the sanction policy of Western countries. The purpose of this study is to identify some negative effects of the imposed sanctions on Russia's export-import operations and outline possible areas of trade development and trade diversification, which could result in strengthening Russia's position in the global market. The methodology of the study is based on analyzing dynamics of Russia's foreign trade under sanctions, as well as comparing and generalizing modern methods of national and international regulations of foreign trade. The informational and empirical basis of the study is the data of statistical reports of the Federal State Statistics Service and the Federal Customs Service. The object of observation is Russia's foreign trade from 2013 to 2022. Scientific novelty lies in introducing new approaches to solving the identified problems of development of Russia's foreign trade, as well as outlining prospects of altering commodity range and geographic structure of exports and imports. The conducted research has revealed that Russia’s economy and foreign trade is affected by the politics-related restrictions; that Russia needs to develop its own innovative technologies and production on their basis, which will reform the structure of Russia's export.

서방의 대 러시아 에너지 부문 제재와 러시아의 대응

Energy industry sanctions, which form the core of economic sanctions against Russia, began in earnest after Russia annexed Crimea in 2014. Following the outbreak of war in Ukraine in February 2022, the US and EU significantly strengthened sanctions on the energy industry, which is the backbone of Russia's economy and accounts for more than 50% of its exports. Russia is not only Europe's No. 1 supplier of energy resources, but also occupies a very important position in world energy trade, accounting for 20% of total global trades of energy commodities. Political conflicts between major exporters and importers such as Russia, the US and Europe have greatly increased uncertainties in the energy market. This is having a huge impact on the world economy. As a result of the sanctions, the Russian energy industry has been forced to change its structure. If the previous goal was to develop the energy industry and further strengthen its position as the largest exporter of natural resources, the current goal has to be revised to minimize losses caused by sanctions. In the future, Russia is expected to increase exports to the Asian market, focusing on cooperation with China and India. It is expected that costs will increase because productivity and efficiency decrease as access to foreign technology and equipment becomes difficult. The policy to localize Western equipment and technology subject to sanctions will be pushed more strongly, but this will inevitably cost considerable money and time. At present, Russia's exports of energy regenerate maintain a high export value due to high prices, although the export volume has decreased. It is difficult for Europe to fully replace Russian energy resources in the short term. For the time being, due to increased exports to Asia and relatively high energy commodity prices, Russia's energy resource exports are expected to remain high for a considerable period of time. The Russian energy industry will play an important role in the Russian economy and international energy market for some time, but its current share will decline more rapidly than previously anticipated. In an unprecedented and unpredictable situation, the Russian energy industry is facing a previously unimaginable challenge to maintain the status quo or to minimize the decline in production and exports.

Analyzing the trade potential of SIDs with a focus on CARICOM’s small resource exporters

For developing economies, exporting broadens the horizon for facilitating effective integration into the global economy and improving overall competitiveness. While small developing states are particularly at high risk given their fundamental characteristics, the expected impact of these exogenous shocks on small resource dependent economies are amplified given the high possibility of lower levels of diversification. This paper therefore assesses the determinants of exports and exporting potential of SIDS (small island developing states) with a focus on Caribbean resource-based countries. Using non resource exports, in an aggregate and disaggregate form, as the dependent variable, the traditional gravity model was augmented to include a revealed comparative advantage (RCA) index, the real effective exchange rate (REER) of the exporter and the export sophistication (EXPY) index. The main findings indicate that an appreciation of the REER has an inverse impact on exports of non-resource commodities and that trade according to comparative advantage and differences in export sophistication occurs mainly in the agricultural sector.

Forecasting the Impact of the COVID-19 Outbreak on China’s Cotton Exports by Modified Discrete Grey Model with Limited Data

The sudden outbreak of COVID-19 has created dramatic challenges for public health and textile export trade worldwide. Such abrupt changes are difficult to predict due to the inherently high complexity and nonlinearity, especially with limited data. This article proposes a novel modified discrete grey model with weakening buffer operators, called BODGM (1,1), for forecasting the impact of pandemic-induced uncertainty on the volatility of cotton exports in China under limited samples. First, the Mann–Kendall test examines how pandemic-induced uncertainty affects cotton exports, based on China’s monthly cotton export data from June 2014 to August 2022. Second, buffer operators are employed to weaken the nonlinear trends and correct the tentative predictions of the discrete grey model. Then, the BODGM (1,1) model was validated by comparison with four alternative models. The results indicate that the BODGM (1,1) model was particularly promising for identifying mutational fluctuations in cotton exports and outperformed the GM (1,1), DGM (1,1), ARIMA and linear regression models in fitting and prediction accuracy under volatility and limited data. The BODGM (1,1) model forecast results for China showed that cotton export volume was expected to show signs of recovery over the next 12 months. The findings of this study may provide a basis for formulating trade policies to mitigate the impact of the COVID-19 outbreak on export resources and build their resilience to future pandemics.

Assessing factors driving international trade in natural resources 1995–2018

Natural resources are essential for economic growth. Understanding the factors driving flows of natural resources is crucial for the design of sustainable development pathways. This paper seeks to quantify such determinants in a unified framework of gravity model of trade with a focus on various policy measures. To do so, a list of resource goods is developed. With the comprehensive trade dataset covering all economies in the world over 1995–2018, different samples and estimators are employed. Several findings stand out. In baseline results with the whole sample, open trade policy is a key factor increasing resource exports by at least 24%, whereas a 10% improvement in resource efficiency lowers the exports by about 2%. It specifically provides some evidence regarding the role of environmental policy. A 10% increase in energy tax in the importing economy can drive resource imports by about 1.16%, and by 6.51% for the same increase in resource tax. This suggests the reallocation of resource extraction. The results can help policymakers better manage the trade-offs between economic growth, resource security and environmental consequences.

The macroeconomic role of the collateral constraint in resource-rich countries

In this paper, we consider DSGE model of a small open economy highly dependent on resource export. The aim of the study is to identify the role of the collateral constraint in the terms-of-trade (TOT) shock transmission. The model contains two non-linear constraints in the form of inequalities: the collateral constraint and the zero lower bound constraint. We have found that if the monetary policy is not inertial, then under a series of unidirectional TOT shocks, the response of the economy is highly skewed with respect to positive and negative shocks. Both inequalities bind and reduce the positive impact of the TOT shock. If the monetary policy is inertial or the central bank reacts poorly to inflation change, then only the collateral constraint binds, and the effect of asymmetry almost disappears

ПЕРЕСЕЛЕНЧЕСКОЕ УПРАВЛЕНИЕ И СОПС О «РАЦИОНАЛИЗАЦИИ ПРИРОДОПОЛЬЗОВАНИЯ» ПРИ ОСВОЕНИИ СИБИРИ (1900–1910-е и 1970–1980-е гг.)

The article analyzes the approaches to nature management of two departments responsible for the development of Siberia in the Russian Empire and the USSR: the Resettlement Administration and the Council for the Study of Productive Forces (Sovet po izucheniyu proizvoditel’nyh sil — SOPS). Both structures were established in the late imperial period, carried out practice-oriented research on the outskirts for the purpose of economic planning and development of Asian regions, and then, to varying degrees, were integrated into the Soviet system. Comparison of the views of the experts from these two structures makes it possible to reveal the peculiarities of understanding the problems of nature management in the late imperial and late Soviet periods, the development of Asian regions, continuity and gaps between the two regimes. Studying the approaches of the Resettlement Administration and SOPS to nature management demonstrates that the development of Siberia was a way to build not only a new society, but also new approaches to the interaction between society and the environment. The article concludes that the goals of the experts of the Resettlement Administration and SOPS were not purely commercial in nature, their expertise contributed to the solution of political, social, environmental issues, such as the shortage of land in the European part of the Russian Empire; the danger of transferring this problem to the east; dependence on resource exports; uneven distribution of hazardous industries and the associated with it excessive concentration of pollution in industrialized regions. Thus, the deconcentration of the population and industries and their more even distribution, according to the experts, would not only contribute to the development of regions on the periphery, but also weaken environmental problems in the center.

Specific features of the energy sector in Russia’s eastern regions and their influence on shaping the Eastern direction in the new geopolitical landscape

The paper presents an analysis of regional features of energy systems in the eastern regions of Russia. The analysis aims to identify their effect on the development of the territorial and production structure of the energy sector, energy consumption, the transportation infrastructure, the export of energy resources to the countries of the Asia-Pacific region, and the efficiency of energy supply to consumers in the off-grid and hard-to-reach territories. Several categories of features are distinguished for the regional energy systems in the eastern regions of Russia. These are socio-economic, infrastructural, sectoral, environmental, and climatic. All these features are interrelated and require consideration when building the energy development scenarios, in particular those with a focus on the transition to low-carbon technologies.

Каспийский регион: новые процессы

The Caspian region has entered a new stage of its development. The geopolitical rivalry over the choice of routes for the export of hydrocarbon resources to foreign markets, as well as the fierce negotiation process in light of the preparation of the Convention on the international legal status of the Caspian Sea have overshadowed the issues of economic cooperation between the countries of the region. Implementation of transport projects, expansion of shipping, and growth of mutual trade turnover became priority issues in the policies of the Caspian littoral states and countries that are not members of the Caspian Five. These processes give Russia new opportunities to strengthen its position in the Caspian Sea and at the same time require it to take new approaches to realization of its national interests.

ЛЕСНАЯ ПРОМЫШЛЕННОСТЬ И РЕГИОНАЛЬНОЕ РАЗВИТИЕ СОВЕТСКОГО СЕВЕРА В ГОДЫ ПЕРВЫХ ПЯТИЛЕТОК

The purpose of the article aims at studying the timber industry in the conditions of the formation of regional administrative-territorial and economic structures in the north of the Soviet Union during the first five-year plans. The forestry industry had to ensure the export of forest resources and materials to obtain foreign exchange funds and meet the domestic needs of the country. Plans for the development of the industry and their implementation turned out to be closely related to the administrative and territorial transformations in the 1920s and 1930s, the creation and functioning of economic organizations. In the poorly developed northern and eastern regions of the country, they became a significant trump card in the actions of party-state and economic figures. This led to a number of contradictions and conflicts, which is shown by the examples of Northern Krai and the Igarka district. The potential of the decisions taken turned out to be short-lived — to achieve specific, narrow goals, but at the same time affected large territories. The result of the regional and economic — in relation to the forest industry — policy of the Soviet government was, in addition to the unbundling of the regions, the gradual reorientation of the industry to meet domestic needs. This process was based on the production and transport infrastructure created in the late 1920s — early 1930s for the export of wood. The projects of enterprises designed for meeting the domestic needs of the country, for the most part, have not been implemented.

Participation of Kazakhstan in the world energy market: problems and development prospects

Currently, the situation that has developed in the sphere of trade in energy resources is determined by factors not only of economic competition, but also of geopolitical confrontation. These factors are a significant limitation for Kazakhstan, the geopolitical location of which does not make it possible to fully realize its own energy potential. The current situation is largely determined by the factors of political confrontation between Russia and Western countries, and in this struggle, the Kazakh exporter of energy resources becomes a factor of economic impact on political processes. In this regard, Kazakhstan is faced with the task of increasing its export potential based on the search for ways to achieve independence in the field of energy policy.

ВЛИЯНИЕ НОВЕЙШИХ ГЕОПОЛИТИЧЕСКИХ ФАКТОРОВ НА ДИНАМИКУ МИРОВОГО ГАЗОВОГО РЫНКА

In 2022, there was a sharp change in the geopolitical situation in the world, which significantly affected both the global economy as a whole, and the energy and gas industry in particular. European countries have begun to refuse to supply Russian natural gas. The European Union has developed documents that develop measures for gradual and painless exclusion from the consumption of Russian gas. In this regard the extraction and export of the fundamental natural resource from Russia sharply decreased. In the medium term, the EU countries plan to completely switch to alternative sources. In this regard, the Russian gas industry faces huge risks and problems in reorienting the released volumes of natural gas. This article is devoted to the analysis of the situation on the gas market, prospects and forecasts of Russia’s role in it in connection with the changing geopolitical situation.

ENERGY REORIENTATION OF EUROPE AS A RESULT OF THE WAR IN UKRAINE

The purpose of this research paper is to analyze different options available to the EU Member States regarding the refusal to extend contracts related to energy trade with Russian Federation. In 2022, Russia's unprovoked and unjustified war against Ukraine changed global perspectives. Most importantly, this war has a devastating human toll and also threatens global economy. The energy sector turned out to be the most vulnerable due to sanctions imposed against Russia as a leading exporter of energy resources. These sanctions have created uncertainty about the future of energy trade between Russia and the EU, as well as the reliability of Russian energy supplies. This has highlighted the need for EU to diversify their energy sources and phase out their energy imports from Russia, which has been a longstanding issue. Therefore, it is important to consider the potential economic and political consequences of such a decision.

Топливно-энергетический комплекс Дальнего Востока: трансформация институциональной среды

The fuel and energy complex (FEC) is a complex inter-industry complex of the Far East, whose activities continue to focus on increasing the volume of production and export of energy resources. The introduction of sanctions against the oil and gas complex led to a violation of the logistics of export deliveries. The process of diversification of energy supplies to the rapidly developing market of the countries of the Asia-Pacific region and the domestic market that has begun requires the implementation of infrastructure projects of the fuel and energy complex for the construction of pipeline transport facilities. Termination of supplies of the European technologies and equipment, existing contracts for the maintenance of supplied equipment, as well as a ban on investments, exacerbated the problem of technical equipment and modernization of organizations of the complex. The state of the fuel and energy complex of the Far East is characterized by a low level of development and competitiveness of its processing sector. Under the current conditions, the formation of a modern institutional environment is becoming an important condition for improving the efficiency of the fuel and energy complex and ensuring effective domestic demand for the energy resources of the Far East. Many problems of the development of the fuel and energy complex can be solved only through a competent combination of market mechanisms for self-development and effective mechanisms of state regulation. The purpose of this study is to study the transformation of the institutional environment of the fuel and energy complex and analyze the influence of institutions on the development of the complex in the Far-Eastern federal district (FEFD). The article gives description of the political, legal and economic institutions of regulation and development institutions that form the institutional environment for the functioning of the fuel and energy complex. The main forms and methods of state support for organizations of the fuel and energy complex are systematized. The main functions of the fuel and energy complex are considered. The study was performed using the methods of systemic and comparative analysis.

Российские энергоресурсы на рынках стран Японии, Республики Корея, Китая и Индии в новых условиях

The article analyzes the main markets of the Asia-Pacific region from the perspective of assessing the niche of Russian energy resources: NEA-3 countries (Japan, the Republic of Korea, China) and India. Based on a synthesis of expert assessments from the leading research groups, it is shown that reduction in the size of the fossil fuel energy markets of Japan and the Republic of Korea is occurring at the fastest rate. Significant reduction in exports to these countries is predicted since these markets are traditional for Russia in the Asia-Pacific region. It was determined that in the current situation, the most promising in terms of export of Russian energy resources are India and China, whose role has increased many times under the conditions of sanctions restrictions imposed on Russia since 2022. It is shown that compensatory capabilities of the economies of China and India to compensate closed to Russia energy markets are limited. In the medium term there is a still high potential for increasing exports, in the long term this requires expansion of the transport infrastructure. However, despite all these limitations, it is possible to predict partial preservation of market niches in the markets of NEA-3 and India for the Russian fossil fuels. In the emerging hydrogen market, the niches of Japan and the Republic of Korea will likely be closed to Russia; in the markets of China and India, which focused on their own production, Russian products will most likely lose out in price competition.

Determinants Of The Instability Of The Russian Economic Growth

Based on a detailed comparative analysis of the concepts of "economic growth" and "economic development", the article provides arguments in favor of the thesis that from the post-default period to the present day, the Russian economy demonstrates not only steadily fading average annual GDP expansion rates, but also the so-called "impoverishing growth", "growth without development". The leading characteristic of the low-quality growth is recognized as the long-term evolution of the domestic economy in the vein of the historically futile natural resource export model, which, through the mechanisms of the "Dutch disease" and regular fluctuations in global energy prices, moves in an excessively cyclical form, inevitably making the socio-economic development of the country unstable. Significant determinants of its unstable growth, carefully concealed by the methods of misleading macroeconomic statistics presented in the article, are also uncovered being the dominance of extensive factors over the intensive ones associated with increasing macroeconomic efficiency and achieving accumulation rates close to the optimum values, the socially conflicting nature of GDP growth, accompanied by the excessive income inequality, both in terms of income and property, even in the relatively favorable conditions compared to global practice, and the resource-intensive and wasteful nature of the dynamics of the national economy.

Does trade openness improve the quality of domestic institutions? Evidence from Africa

Research background: The research article deals with impacts of international trade openness on institutions in less developed economies, namely in Africa. Purpose of the article: It investigates the impacts of international trade openness on institutional quality in Africa measured by twelve various variables. Methods: It applies generalized methods of moments to a dynamic panel data of 34 African countries in the period of 1988?2012. Institutional quality data come from International Country Risk Guide, the rest from World Development Indicators and UNESCO databases. Findings & value added: Our results indicate that in the case of Africa, trade openness seems to be a positive and significant determinant of institutional quality, however, it differs across various institutional variables. Trade openness brings a positive impact on government stability, bureaucracy and law and order, we also identify its conflict-mitigating effects. This happens, unfortunately, with an exemption for natural resources exports. Trade openness also positively influences security and socioeconomic conditions, although we find the link much weaker. Regarding our control variables, we find two interesting results. First, GDP per capita has a strong and positive association with institutional quality when measured by one bundled indicator, however, individual variables show different intensities. Second, we find a strong and positive association of net foreign direct investment inflows and government stability. The added value of this research lies not only in focus on the less researched relationship, i.e., how trade impacts the institutional quality, but dominantly in focus on many institutional variables at once and comparison of their effects. Other empirical studies usually focus on selected variables only, or on selected trade items (natural resources).