Binding Entropy Research Articles

Characterization and theoretical studies of synthesized (E)-2((3-methylbenzilidene) amino) phenol complexes for the fabrication of novel electrochemical sensor for determination of Pb2+ and Hg2+ ions

A Schiff base (E)-2((3-methylbenzilidene) amino) phenol (EMBAP)/multi-walled carbon nanotube modified carbon paste electrode was applied to the selective and accurate determination of Hg2+ and Pb2+ ions by voltammetric methods. The morphology of electrodes surface was characterized, and a density functional theory (DFT) based on the interaction of target ions with EMBAP was investigated. The theoretical binding energies, entropies, free energies and formation constants were calculated. The results indicated that complexes are stable, and formation is spontaneous. The synergistic advantages of EMBAP and MWNTs caused higher sensitivity, fast electron transfer, well reproducibility, long time stability, and well anti-interference capability. The theoretical studies showed that the most important interaction is the electron-donating O lone pair to the contacting LP* of metal ions. Under optimum conditions, the peak current was linear in 0.1–200 μmol L−1 and 0.1–250 μmol L−1 concentration of Hg2+ and Pb2+ with limits of detection (S/N = 3) of 28 nmol L−1 and 41 nmol L−1 for Hg2+ and Pb2+, respectively. The current method was applied for the simultaneous determination of Hg2+ and Pb2+ in algae samples with comparable accuracy and precision respect to reference methods.

Diastereomeric Crowding Effects in the Competitive DNA Intercalation of Ru(phenanthroline)2dipyridophenazine2+ Enantiomers.

The biexponential excited-state emission decay characteristic of DNA intercalated tris-bidentate dppz-based ruthenium complexes of the general form Ru(L)2dppz2+ has previously been explained by a binding model with two distinct geometry orientations of the bound ligands, with a distinct lifetime associated with each orientation. However, it has been found that upon DNA binding of Ru(phen)2dppz2+ the fractions of short and long lifetimes are strongly dependent on environmental factors such as salt concentration and, in particular, temperature. Analyzing isothermal titration calorimetry for competitive binding of Ru(phen)2dppz2+ enantiomers to poly(dAdT)2, we find that a consistent binding model must assume that the short and long lifetimes states of intercalated complexes are in equilibrium and that this equilibrium is altered when neighboring bound ligands affect each other. The degree of intercomplex binding is found to be a subtle manifestation of several attractive and repulsive factors that are highly likely to directly reflect the strong diastereomeric difference in the binding enthalpy and entropy values. In addition, as the titration progresses and the binding sites on the DNA lattice become increasingly occupied, a general resistance for the saturation of the binding sites is observed, suggesting diastereomeric crowding of the neighboring bound ligands.

Study on interactions of vitamin B1 with sodium dodecyl sulfate for potential food applications: Conductometric, volumetric, calorimetric and spectroscopic approach

As vitamin B1 (thiamine hydrochloride, THC) is being oxidized by food preservatives and light, therefore the advantages of surfactant micelles as protecting agent are taken into consideration in the present study. Keeping this in mind the impact of THC on the SDS micellar system has been studied by using conductance, volumetric, calorimetric and spectroscopic techniques. From conductance measurements, various parameters like critical micellization concentration (CMC), degree of dissociation (α) and thermodynamics of micellization (ΔGᴼm, ΔHᴼm and ΔSᴼm) have been calculated. Apparent molar volume (VΦ) and apparent molar compressibility (Ks,2,Φ) have been calculated from density and sound velocity measurements which have been discussed in terms of solute-solute and solute-solvent interactions. The binding and partitioning of THC into SDS micelles have been studied by using UV–visible spectroscopy and calorimetric studies. Calorimetric studies have also been used to address the interactions of THC with monomers of SDS. The values of binding/partitioning constant (K), enthalpy, entropy, free energy and stoichiometry of binding have been determined in the pre-micellar and post-micellar regions from isothermal titration calorimetery (ITC). In addition, proton (1H) NMR studies have been performed to determine the locus and orientation of THC within SDS micelles.

The impact of water molecules on binding affinity of the anti-diabetic thiazolidinediones for catalase: Kinetic and mechanistic approaches

Water molecules play a vital role in efficient drug binding to its target. Thiazolidinediones (TZDs), a class of anti-diabetic drugs, are widely used for treatment of type 2 diabetes mellitus. In the present study, the possible contribution of water molecules to the binding of TZDs to catalase, a potential target in the liver, was investigated by different experimental and theoretical methods. These studies indicated that TZDs could significantly improve the catalase catalytic function with a significant contribution from water molecules. As a probe for the differential number of released water molecules during the catalase transition from E to E* states, the activity of TZDs-catalase complexes was demonstrated to be mainly dependent on water activity. However, free catalase decomposed the substrate more independently. In addition, the spectrofluorimetry studies showed that the binding of TZDs to catalase needed the release of water molecules from the enzyme's binding pocket. The thermodynamic studies indicated that the binding enthalpy and entropy of TZDs for catalase were decreased with lower water activity. The favorable process contributes to release of water molecules from the binding pocket through the formation of hydrophobic interactions between catalase and TZDs in an enthalpic manner. Molecular docking simulations confirmed that the depletion of water molecules from the binding cavity is essential for effective interactions between TZDs and catalase.

Binding of L-Argininamide to a DNA Aptamer: A Volumetric Study

We use a combination of volumetric and spectroscopic techniques to characterize the binding of L-argininamide to its aptamer, the 24-base DNA hairpin 5′- d(GATCGAAACGTAGCGCCTTCGATC)-3′. The binding causes increases in volume, ΔV, and adiabatic compressibility, ΔKS, of 12 ± 7 cm3 mol−1 and (73 ± 8) × 10−4 cm3 mol−1 bar−1, respectively. These volumetric results combined with structural data reveal that the binding is accompanied by release of 73 ± 27 waters from the hydration shells of the interacting molecules to the bulk. We use the estimated change in hydration to estimate the hydration, ΔShyd, and configurational, ΔSconf, contributions to the binding entropy. The large and unfavorable change in configurational entropy, ΔSconf, is nearly compensated by a favorable change in the hydration contribution, ΔShyd.

A combined calorimetric, spectroscopic and molecular dynamic simulation study on the inclusion complexation of (E)-piceatannol with hydroxypropyl-β-cyclodextrin in various alcohol + water cosolvents

(E)-Piceatannol, a naturally occurring polyphenol, has gained increasing interests in pharmaceutical and food industries due to the health-promoting effects. However, the application of (E)-piceatannol is severely limited by its low solubility and poor bioavailability. Cosolvation and complexation are two effective methods to increase the solubility of insoluble active compounds. The effect of alcohol + water cosolvents on the inclusion complexation of (E)-piceatannol with hydroxypropyl-β-cyclodextrin (HP-β-CD) was investigated using isothermal titration calorimetry, fluorescence spectroscopy and molecular dynamics simulation. The stoichiometry and thermodynamic parameters for the complexation process were obtained. The results showed a 1:1 stoichiometry between (E)-piceatannol and HP-β-CD. The complexation constants decreased with the increase of the alcohol concentration and the alkyl chain length, but increased with the increasing number of hydroxyl groups of the alcohols. The main driving forces for the inclusion process were obtained from the enthalpy and entropy changes. The effect of temperature on the inclusion complexation was discussed in terms of the heat capacity change calculated from the temperature dependence of enthalpy change. The differences in thermodynamic parameters in different cosolvents were explained in detail based on the assumption that the alcohol acts both as a solvent and as a competitor to (E)-piceatannol. Both binding enthalpy and binding entropy exhibited a noticeable temperature dependence with almost complete enthalpy–entropy compensation. Fluorescence intensity of (E)-piceatannol increased with the increasing concentration of HP-β-CD and showed a slight hypsochromic shift. The microscopic structure of the inclusion complex in different alcoholic cosolvents was obtained from the molecular dynamics simulation. These results illustrated the importance of optimizing the solvent systems when utilizing cyclodextrins as food or drug carriers.

Interplay between Conformational Entropy and Solvation Entropy in Protein-Ligand Binding.

Understanding the driving forces underlying molecular recognition is of fundamental importance in chemistry and biology. The challenge is to unravel the binding thermodynamics into separate contributions and to interpret these in molecular terms. Entropic contributions to the free energy of binding are particularly difficult to assess in this regard. Here we pinpoint the molecular determinants underlying differences in ligand affinity to the carbohydrate recognition domain of galectin-3, using a combination of isothermal titration calorimetry, X-ray crystallography, NMR relaxation, and molecular dynamics simulations followed by conformational entropy and grid inhomogeneous solvation theory (GIST) analyses. Using a pair of diastereomeric ligands that have essentially identical chemical potential in the unbound state, we reduced the problem of dissecting the thermodynamics to a comparison of the two protein-ligand complexes. While the free energies of binding are nearly equal for the R and S diastereomers, greater differences are observed for the enthalpy and entropy, which consequently exhibit compensatory behavior, ΔΔ H°(R - S) = -5 ± 1 kJ/mol and - TΔΔ S°(R - S) = 3 ± 1 kJ/mol. NMR relaxation experiments and molecular dynamics simulations indicate that the protein in complex with the S-stereoisomer has greater conformational entropy than in the R-complex. GIST calculations reveal additional, but smaller, contributions from solvation entropy, again in favor of the S-complex. Thus, conformational entropy apparently dominates over solvation entropy in dictating the difference in the overall entropy of binding. This case highlights an interplay between conformational entropy and solvation entropy, pointing to both opportunities and challenges in drug design.

Thermodynamic Analysis of Protein-Lipid Interactions by Isothermal Titration Calorimetry.

Isothermal titration calorimetry is a highly sensitive and powerful technique for the study of molecular interactions. This method can be applied universally for studying the interaction between moleculeAbstracts, molecular assembles and ions as it measures the heat changes resulting from such interactions and does not need any probe molecule/moiety to be incorporated into the system under investigation. This method has been applied quite extensively to investigate the interaction of proteins with other biomolecules such as small ligands, other proteins, nucleic acids, lipid membranes as well as to study the interaction of antibodies, drugs, metal ions and nanoparticles with target proteins or antigens, nucleic acids, and membranes. In this chapter, we describe the application of ITC for the investigation of thermodynamics of protein-lipid interaction. A number of important parameters such as enthalpy of binding (ΔH), entropy of binding (ΔS), association constant (Ka), binding stoichiometry (n) and free energy of binding (ΔG) can be obtained from a single calorimetric titration, providing a complete thermodynamic characterization of the interaction. The method is described in detail taking the major protein of the bovine seminal plasma, PDC-109, which exhibits a high preference for interaction with choline-containing lipids, as an example. The method can be applied to investigate thermodynamicparameters associated with the interaction of other soluble proteins with lipid membranes.

Affinity Improvement of a Cancer-Targeted Antibody through Alanine-Induced Adjustment of Antigen-Antibody Interface

To investigate favorable single amino acid substitutions that improve antigen-antibody interactions, alanine (Ala) mutagenesis scanning of the interfacial residues of a cancer-targeted antibody, B5209B, was performed based on X-ray crystallography analysis. Two substitutions were shown to significantly enhance the binding affinity for the antigen, by up to 30-fold. One substitution improved the affinity by a gain of binding enthalpy, whereas the other substitution improved the affinity by a gain of binding entropy. Molecular dynamics simulations showed that the enthalpic improvement could be attributed to the stabilization of distant salt bridges located at the periphery of the antigen-antibody interface. The entropic improvement was due to the release of water molecules that were stably trapped in the antigen-antibody interface of the wild-type antibody. Importantly, these effects of the Ala substitutions were caused by subtle adjustments of the binding interface. These results will be helpful to design high-affinity antibodies with avoiding entropy-enthalpy compensation.

Differential Regulation of Thermodynamic Binding Forces of Levocetirizine and (S)-Cetirizine by Lys191 in Human Histamine H₁ Receptors.

Cetirizine is a zwitterionic second-generation antihistamine containing R- and S-enantiomers, levocetirizine, and (S)-cetirizine. Levocetirizine is known to have a higher affinity for the histamine H1 receptors than (S)-cetirizine; ligand-receptor docking simulations have suggested the importance of the formation of a salt bridge (electrostatic interaction) between the carboxylic group of levocetirizine and the Lys191 residue at the fifth transmembrane domain of human histamine H1 receptors. In this study, we evaluated the roles of Lys191 in the regulation of the thermodynamic binding forces of levocetirizine in comparison with (S)-cetirizine. The binding enthalpy and entropy of these compounds were estimated from the van ‘t Hoff equation, by using the dissociation constants obtained from their displacement curves against the binding of [3H]mepyramine to the membrane preparations of Chinese hamster ovary cells expressing wild-type human H1 receptors and their Lys191 mutants to alanine at various temperatures. We found that the higher binding affinity of wild-type H1 receptors for levocetirizine than (S)-cetirizine was achieved by stronger forces of entropy-dependent hydrophobic binding of levocetirizine. The mutation of Lys191 to alanine reduced the affinities for levocetirizine and (S)-cetirizine, through a reduction in the entropy-dependent hydrophobic binding forces of levocetirizine and the enthalpy-dependent electrostatic binding forces of (S)-cetirizine. These results suggested that Lys191 differentially regulates the binding enthalpy and entropy of these enantiomers, and that Lys191 negatively regulates the enthalpy-dependent electrostatic binding forces of levocetirizine, contrary to the predictions derived from the ligand-receptor docking simulations.

Dissipative Self-Assembly of Anisotropic Nanoparticle Chains with Combined Electrodynamic and Electrostatic Interactions.

Dissipative self-assembly of colloidal nanoparticles offers the prospect of creating reconfigurable artificial materials and systems, yet the phenomenon only occurs far from thermodynamic equilibrium. Therefore, it is usually difficult to predict and control. Here, a dissipative colloidal solution system, where anisotropic chains with different interparticle separations in two perpendicular directions transiently arise among largely disordered silver nanoparticles illuminated by a laser beam, is reported. The optical field creates a nonequilibrium dissipative state, where a disorder-to-order transition occurs driven by anisotropic electrodynamic interactions coupled with electrostatic interactions. Investigation of the temporal dynamics and spatial arrangements of the nanoparticle system shows that the optical binding strength and entropy of the system are two crucial parameters for the formation of the anisotropic chains and responsible for adaptive behaviors, such as self-replication of dimer units. Formation of anisotropic nanoparticle chains is also observed among colloidal nanoparticles made from other metal (e.g., Au), polymer (e.g., polystyrene), ceramic (e.g., CeO2 ), and hybrid materials (e.g., SiO2 @Au core-shell), suggesting that light-driven self-organization will provide a wide range of opportunities to discover new dissipative structures under thermal fluctuations and build novel anisotropic materials with nanoscale order.

Nanomolar binding affinity of quinine-based antimalarial compounds by the cocaine-binding aptamer.

An unusual feature of the cocaine-binding aptamer is that it binds quinine much tighter than the ligand it was selected for, cocaine. Here we expand the repertoire of ligands that this aptamer binds to include the quinine-based antimalarial compounds amodiaquine, mefloquine, chloroquine and primaquine. Using isothermal titration calorimetry (ITC) we show that amodiaquine is bound by the cocaine-binding aptamer with an affinity of (7 ± 4) nM, one of the tightest aptamer-small molecule affinities currently known. Amodiaquine, mefloquine and chloroquine binding are driven by both a favorable entropy and enthalpy of binding, while primaquine, quinine and cocaine binding are enthalpy driven with unfavorable binding entropy. Using nuclear magnetic resonance (NMR) and ITC methods we show that these ligands compete for the same binding sites in the aptamer. Our identification of such a tight binding ligand for this aptamer should prove useful in developing new biosensor techniques and applications using the cocaine-binding aptamer as a model system.

Thermodynamics of the Binding of Lysozyme to a Dendritic Polyelectrolyte: Electrostatics Versus Hydration.

The interaction between dendritic polyglycerol sulfate (dPGS) of the second generation and lysozyme was studied by isothermal titration calorimetry (ITC) at different temperatures and salt concentrations. Analysis by ITC showed that 2–3 lysozyme molecules were bound to each dPGS. The resulting binding constant Kb and the Gibbs free energy ΔGo decreased markedly with increasing salt concentration but were nearly independent of temperature. The salt dependence of Kb led to the conclusion that ca. 3 counterions bound to dPGS were released upon complex formation. The gain in entropy ΔGci by this counterion-release scales logarithmically with salt concentration and is the main driving force for binding. The temperature dependence of ΔGo was analyzed by the nonlinear van’t Hoff plot, taking into account a finite heat capacity change ΔCp,vH. This evaluation led to the binding enthalpy ΔHvH and the binding entropy ΔSvH. Both quantities varied strongly with temperature and even changed sign, but they compensated each other throughout the entire range of temperature. Coarse-grained computer simulations with explicit salt and implicit water were used to obtain the binding free energies that agreed with ITC results. Thus, electrostatic factors were the driving forces for binding whereas all hydration contributions leading to the strongly varying ΔHvH and ΔSvH canceled out. The calorimetric enthalpy ΔHITC measured directly by ITC differed largely from ΔHvH. ITC measurements done in two buffer systems with different ionization enthalpies revealed that binding was linked to buffer ionization and a partial protonation of the protein.

Binding of l-Argininamide to a DNA Aptamer: A Volumetric Study.

We use a combination of volumetric and spectroscopic techniques to characterize the binding of l-argininamide to its aptamer, the 24-base DNA hairpin 5'-d(GATCGAAACGTAGCGCCTTCGATC)-3'. The binding causes increases in volume, Δ V, and adiabatic compressibility, Δ KS, of 12 ± 7 cm3 mol-1 bar and (73 ± 8) × 10-4 cm3 mol-1 bar-1, respectively. These volumetric results combined with structural data reveal that the binding is accompanied by release of 73 ± 27 waters from the hydration shells of the interacting molecules to the bulk. We use the estimated change in hydration to estimate the hydration, Δ Shyd, and configurational, Δ Sconf, contributions to the binding entropy. The large and unfavorable change in configurational entropy, Δ Sconf, is nearly compensated by a favorable change in the hydration contribution, Δ Shyd.

Functional Role of Solvent Entropy and Conformational Entropy of Metal Binding in a Dynamically Driven Allosteric System.

Allostery is a regulatory phenomenon whereby ligand binding to one site influences the binding of the same or a different ligand to another site on a macromolecule. The physical origins of allosteric regulation remain under intense investigation. In general terms, ligand-induced structural changes, perturbations of residue-specific dynamics, and surrounding solvent molecules all potentially contribute to the global energetics of allostery. While the role of solvent is generally well understood in regulatory events associated with major protein structural rearrangements, the degree to which protein dynamics impact solvent degrees of freedom is unclear, particularly in cases of dynamically driven allostery. With the aid of new crystal structures, extensive calorimetric and residue-specific dynamics studies over a range of time scales and temperatures, we dissect for the first time the relative degree to which changes in solvent entropy and residue-specific dynamics impact dynamically driven, allosteric inhibition of DNA binding by Zn in the zinc efflux repressor, CzrA (chromosomal zinc-regulated repressor). We show that non-native residue-specific dynamics in allosterically impaired CzrA mutants are accompanied by significant perturbations in solvent entropy that cannot be predicted from crystal structures. We conclude that functional dynamics are not necessarily restricted to protein residues but involve surface water molecules that may be responding to ligand (Zn)-mediated perturbations in protein internal motions that define the conformational ensemble, rather than major structural rearrangements.

Design of two-tail compounds with rotationally fixed benzenesulfonamide ring as inhibitors of carbonic anhydrases

Rational design of compounds that would bind specific pockets of the target proteins is a difficult task in drug design. The 12 isoforms of catalytically active human carbonic anhydrases (CAs) have highly similar active sites that make it difficult to design inhibitors selective for one or several CA isoforms. A series of CA inhibitors based on 2-chloro/bromo-benzenesulfonamide that is largely fixed in the CA active site together with one or two tails yielded compounds that were synthesized and evaluated as inhibitors of CA isoforms. Introduction of a second tail had significant influence on the binding affinity and two-tailed compounds in most cases provided high affinity and selectivity for CA IX and CA XIV. The contacts between several compounds and CA amino acids were determined by X-ray crystallography. Together with the intrinsic enthalpy and entropy of binding they provided the structure-thermodynamics correlations for this series of compounds with the insight how to rationally build compounds with desired CA isoform as a target.

Protein-ligand binding enthalpies from near-millisecond simulations: Analysis of a preorganization paradox.

Calorimetric studies of protein-ligand binding sometimes yield thermodynamic data that are difficult to understand. Today, molecular simulations can be used to seek insight into such calorimetric puzzles, and, when simulations and experiments diverge, the results can usefully motivate further improvements in computational methods. Here, we apply near-millisecond duration simulations to estimate the relative binding enthalpies of four peptidic ligands with the Grb2 SH2 domain. The ligands fall into matched pairs, where one member of each pair has an added bond that preorganizes the ligand for binding and thus may be expected to favor binding entropically, due to a smaller loss in configurational entropy. Calorimetric studies have shown that the constrained ligands do in fact bind the SH2 domain more tightly than the flexible ones, but, paradoxically, the improvement in affinity for the constrained ligands is enthalpic, rather than entropic. The present enthalpy calculations yield the opposite trend, as they suggest that the flexible ligands bind more exothermically. Additionally, the small relative binding enthalpies are found to be balances of large differences in the energies of structural components such as ligand and the binding site residues. As a consequence, the deviations from experiment in the relative binding enthalpies represent small differences between these large numbers and hence may be particularly susceptible to error, due, for example, to approximations in the force field. We also computed first-order estimates of changes in configurational entropy on binding. These too are, arguably, paradoxical, as they tend to favor binding of the flexible ligands. The paradox is explained in part by the fact that the more rigid constrained ligands reduce the entropy of binding site residues more than their flexible analogs do, at least in the simulations. This result offers a rather general counterargument to the expectation that preorganized ligands should be associated with more favorable binding entropies, other things being equal.

Entropy as a Driver of Selectivity for Inhibitor Binding to Histone Deacetylase 6.

Among the metal-dependent histone deacetylases, the class IIb isozyme HDAC6 is remarkable because of its role in the regulation of microtubule dynamics in the cytosol. Selective inhibition of HDAC6 results in microtubule hyperacetylation, leading to cell cycle arrest and apoptosis, which is a validated strategy for cancer chemotherapy and the treatment of other disorders. HDAC6 inhibitors generally consist of a Zn2+-binding group such as a hydroxamate, a linker, and a capping group; the capping group is a critical determinant of isozyme selectivity. Surprisingly, however, even "capless" inhibitors exhibit appreciable HDAC6 selectivity. To probe the chemical basis for this selectivity, we now report high-resolution crystal structures of HDAC6 complexed with capless cycloalkyl hydroxamate inhibitors 1-4. Each inhibitor hydroxamate group coordinates to the catalytic Zn2+ ion with canonical bidentate geometry. Additionally, the olefin moieties of compounds 2 and 4 bind in an aromatic crevice between the side chains of F583 and F643. Reasoning that similar binding could be achieved in the representative class I isozyme HDAC8, we employed isothermal titration calorimetry to study the thermodynamics of inhibitor binding. These measurements indicate that the entropy of inhibitor binding is generally positive for binding to HDAC6 and negative for binding to HDAC8, resulting in ≤313-fold selectivity for binding to HDAC6 relative to HDAC8. Thus, favorable binding entropy contributes to HDAC6 selectivity. Notably, cyclohexenyl hydroxamate 2 represents a promising lead for derivatization with capping groups that may further enhance its impressive 313-fold thermodynamic selectivity for HDAC6 inhibition.

The binding of boronated peptides to low affinity mammalian saccharides

AbstractA 54‐member library of boronated octapeptides, with all but the boronated residue being proteinogenic, was tested for affinity to a set of saccharides commonly found on the terminus of mammalian glycans. After experimentation with a high‐throughput dye‐displacement assay, attention was focused on isothermal titration calorimetry as a tool to provide reliable affinity data, including enthalpy and entropy of binding. A small number of boronated peptides showed higher affinity and significant selectivity for N‐acetylneuraminic acid over methyl‐α‐d‐galactopyranoside, methyl‐α/β‐l‐fucopyranoside and N‐acetyl‐d‐glucosamine. Thermodynamic data showed that for most of the boronated peptides studied, saccharide binding was associated with a significant increase in entropy, presumably resulting from the displacement of semiordered water molecules from around the sugar and/or peptide.

Investigation on complex coacervation between fish skin gelatin from cold-water fish and gum arabic: Phase behavior, thermodynamic, and structural properties

The study is aimed to investigate phase behavior, thermodynamic, and structural properties based on complex coacervation between fish skin gelatin (FSG) from cold-water fish and gum arabic (GA). Phase separation behavior between FSG and GA was investigated as a function of pH through varying mixing ratios from 4:1 to 1:4 at 25 °C and 1.0 wt% of total biopolymer concentration. The turbidity of FSG-GA mixture reached the maximum (1.743) at the 1:2 of mixing ratio and pHopt 3.5, and stabilized at zero. Then physicochemical properties of FSG-GA coacervates at pHopt 3.5 and FSG-GA mixtures at pH 6.0 (>pHc) were evaluated. Scanning electron microscope (SEM) and X-ray diffraction (XRD) showed that the interactions between FSG and GA occurred at pHopt 3.5 and were very weak at pH 6.0 (>pHc). The isothermal titration calorimetry (ITC) results including the negative Gibbs free energy change (ΔG = −18.71 ± 1.300 kJ/mol), binding enthalpy (ΔH = −41.81 ± 1.300 kJ/mol) and binding entropy (TΔS = −23.10 kJ/mol) indicated that the complexation between FSG and GA was spontaneous and driven by negative enthalpy owing to the electrostatic interaction and hydrogen bondings. The zeta potential (ZP) of FSG-GA coacervates at pHopt 3.5 was −9.00 ± 0.79 mV that was not close to electrically neutral, indicating other interactions besides electronic interaction. Hydrogen bondings in FSG-GA mixtures at pH 6.0 and 3.5 were found to be stronger than pure FSG at pH 6.0 and 3.5 owing to that the amide II peaks shifted to high wavenumbers. Electronic interaction was proven to exist in FSG-GA mixtures at pH 6.0 through the vanishment of asymmetric COO− stretching. However, the electronic interaction in FSG-GA coacervates at pHopt 3.5 was obviously stronger than FSG-GA mixtures at pH 6.0, resulting from the vanishment of asymmetric and symmetric COO− stretching vibration and the positively charged FSG and GA. The intrinsic fluorescence represented that the introduction of GA changed the microenvironment of tyrosine residues in FSG, which may be owing to the unfolding of the tertiary conformation. Moreover, the decrease of pH could promote the formation of random coils of FSG through circular dichroism (CD). Therefore the addition of GA into FSG and decrease of pH might enhance the conformation freedom of FSG, which would bring about favorable entropic effects and contribute to the complexation.