Binding of L-Argininamide to a DNA Aptamer: A Volumetric Study

Abstract

We use a combination of volumetric and spectroscopic techniques to characterize the binding of L-argininamide to its aptamer, the 24-base DNA hairpin 5′- d(GATCGAAACGTAGCGCCTTCGATC)-3′. The binding causes increases in volume, ΔV, and adiabatic compressibility, ΔKS, of 12 ± 7 cm3 mol−1 and (73 ± 8) × 10−4 cm3 mol−1 bar−1, respectively. These volumetric results combined with structural data reveal that the binding is accompanied by release of 73 ± 27 waters from the hydration shells of the interacting molecules to the bulk. We use the estimated change in hydration to estimate the hydration, ΔShyd, and configurational, ΔSconf, contributions to the binding entropy. The large and unfavorable change in configurational entropy, ΔSconf, is nearly compensated by a favorable change in the hydration contribution, ΔShyd.