Maize Ear Rot Research Articles

Talaromyces funiculosus, a Novel Causal Agent of Maize Ear Rot and Its Sensitivity to Fungicides.

Ear rot is one of the most prevalent and destructive diseases of maize. During field surveys, it was found that a Penicillium ear rot broke out in some areas of Shanxi, Shaanxi, Hebei, and Tianjin in China, with an incidence of 3 to 90%. A Penicillium sp. was isolated from diseased kernels covered with greyish green mold, and three isolates were identified by morphologic and molecular characteristics. The pathogenicity of isolate ZBS205 to maize ears was further determined by artificial inoculation in a field. Furthermore, the sensitivity of isolate ZBS205 against six commonly used fungicides was also evaluated. According to macro- and micromorphologic characteristics, isolate ZBS205 was generally identical to Talaromyces funiculosus (teleomorph of Penicillium funiculosum). The partial gene sequences of the nuclear ribosomal ITS1-5.8S-ITS2 (ITS) region, β-tubulin, putative ribosome biogenesis protein (Tsr1), and the second largest subunit of the RNA polymerase II (RPB2) from isolates ZBS205, D49-1, and S73-1 showed the highest nucleotide identity to T. funiculosus strain X33, and the phylogenetic analysis conducted by the neighbor-joining method with the combined data of the four genes demonstrated that these three isolates clustered with T. funiculosus strain X33. These results suggested that the fungus isolated from diseased maize kernels was T. funiculosus. Pathogenicity testing showed that the T. funiculosus isolate ZBS205 was pathogenic to maize ears, which showed symptoms of rotted cob and deteriorated kernels. This is the first report of T. funiculosus as the definitive pathogen causing maize ear rot. The result of fungal sensitivity against fungicides showed that pyraclostrobin exhibited the highest toxicity to mycelial growth and could be used as a candidate agent for the prevention and control of T. funiculosus ear rot. The results of the present study provide a basis for understanding ear rot caused by T. funiculosus, and they should play an important role in disease management.

First Report of Sea buckthorn Stem Wilt Caused by Fusarium sporotrichioides in Gansu, China.

Sea buckthorn (Hippophae rhamnoides) is an important deciduous shrub for fruit and ecological restoration in arid and semi-arid regions of China. Twelve Chinese and Russian cultivars (cv. Shenqiuhong, eshi01, ... eshi11) were planted about 1.6 acre area in a seedling nursery, located in Qingyang City of Gansu province in northwest China, where high mortality (more than 70%) of sea buckthorn was observed in late July 2019. Symptoms consisted of massive chlorosis, drooping leaves and dried-up stems on 5-year-old trees. Pieces of tree roots and stems with irregular light-brown discoloration in the xylem vessels were selected. Small pieces of discolored tissue were surface disinfested (1 min in 1% sodium hypochlorite, followed by three rinses with sterile distilled water), air-dried, and placed on potato dextrose agar (PDA) medium for 5 days at 25°C in the dark. A fungus was consistently isolated from both diseased roots and stems tissues. Colonies on PDA grew rapidly. Dense mycelia were pinky-white initially, and became carmine red color with age on the undersurface of the plate. Macroconidia were moderately curved, 3 to 5 marked septa, hyaline, thick walled, and measuring 27.8± 3.6 µm × 4.8 ± 0.5 µm (n = 30). Microconidia were abundant, pear-shaped, ellipsoid to fusoid, often with a papilla at the base, and 8.4 ± 2.2 µm ×3.1 ± 0.3 µm (n = 30). Genomic DNA was extracted for amplification and sequencing of the internal transcribed spacer region (ITS1 and ITS4 primers) (White et al. 1990) of the ribosomal DNA (Accession Nos. MN160235 to MN160238) and translation elongation factor-1 alpha (EF1 and EF2 primers, accession Nos. MN429075 to MN429078) (O'Donnell et al. 1998). The sequences revealed 99% similarity to the sequences of the ITS (AY188917), and 100% identity with EF1-α (JF740808) regions of Fusarium sporotrichioides. Based on morphological and molecular characteristics, the fungus was identified as F. sporotrichioides (Leslie and Summerell 2006). Koch's postulates were fulfilled on healthy, potted 1-year-old sea buckthorn seedings using two isolates in a greenhouse at 25 °C, 90% relative humidity, and 12-hour light/dark photoperiod. Ten potted seedings were inoculated on the stems by placing a 5-mm-diameter mycelial plug (5-day-old PDA cultures for each isolate) into the surface of a wound created with a needle, and the inoculation sites were covered with Parafilm to maintain moisture. Ten seedings were inoculated with PDA plugs as controls. Seven to ten days after inoculation, typical symptoms of dark-brown necrotic lesions on chlorotic leaf margins were observed. About 2 weeks after inoculation, the inoculated stems were gradually dry up, accompanied by withering and fallen leaves. Control plants remained asymptomatic. Pathogens were successfully isolated from the inoculated stems again, exhibiting morphological characteristics identical to those of F. sporotrichioides. Previous papers reported F. sporotrichioides as a common pathogen caused lavender wilt (Cosic et al. 2012), foliar spots on forage corn (Moya-Elizondo et al. 2013) and maize ear rot (Wang et al. 2019). To our knowledge, this is the first report of sea buckthorn stem wilt caused by F. sporotrichioides on several Chinese and Russian cultivars in Gansu province of China. In Heilongjiang province, the same disease was reported in 2010 (Song et al. 2010), nearly 30 longitudes away from Gansu province. Therefore, this disease appears to be a serious risk for future sea buckthorn production.

First Report of Maize Stalk Rot Caused by Fusarium kyushuense in China.

During 2017 to 2019, a field survey for maize stalk rot was conducted in 21 counties (districts) across the Guangxi province of China. This disease caused yield losses ranging from 20% to 30%. Maize plants with stalk rot were collected during the late milk stage and pieces of diseased pith tissue were cultured as previously described (Shan et al. 2017). Fungal colonies and mycelia with morphological characteristics of Fusarium species were subcultured onto fresh potato dextrose agar (PDA) and carnation leaf agar (CLA) plates. Based on morphological characteristics and molecular detection by amplification of Fusarium genus-specific primers (Duan et al. 2016), 39 Fusarium isolates were identified. Among them, five isolates from Du'an, Pingguo, Debao, and Daxin had abundant, pale orange to yellow aerial mycelium with deep red pigments when grown on PDA (Fig. 1A; 1B). The average growth rate was 8.0 to 12.0 mm per day at 25°C in the dark. The fungi produced two types of spores on CLA. Microconidia were ovoid to clavate, generally 0- to 3-septate, and 4.6 to 9.4 μm in length (n = 30) (Fig. 1D); Macroconidia were slightly curved with an acute apical cell, mostly 3- to 4- septate, and 19.4 to 38.2 μm in length (n = 30) (Fig. 1C). No chlamydospores were observed. These five isolates were initially identified as Fusarium kyushuense based on morphological features. PCR was performed to amplify three phylogenetic genes (TEF1-α, RPB1, and RPB2) (O'Donnell et al. 1998) and species specific primers kyuR1F/kyuR1R (5-TTTTCCTCACCAAGGAGCAGATCATG-3/5-TCCAATGGACTGGGCAGCCAAAACACC-3), kyuR2F/kyuR2R (5-CAGATATACATTTGCCTCGACAC-3/5-TACTTGAGCACGGAGCTTG-3) were used to confirm species identity. The obtained sequences were deposited in GenBank under the accession numbers MT997084, MT997080, MT997081 (TEF1-α); MT550012, MT997085, MT997086 (RPB1); MT550009, MT997089, and MT997090 (RPB2), respectively. Using BLAST, sequences of TEF1-α, RPB1, and RPB2 of the isolates were 99.33% (MH582297.1) to 100% (MG282364.1) similar to those of F. kyushuense strains (Supplementary Table 1). Based on phylogenetic analysis with maximum likelihood methods using tools of the website of CIPRES (http://www.phylo.org), isolates GX27, GX167, and GX204 clustered with F. kyushuense with 100% bootstrap support (Fig. 2). The pathogenicity of the three isolates was tested using young seedlings and adult plants as previously described with modification (Ye et al. 2013; Zhang et al. 2016). The primary roots of three-leaf-old seedlings were inoculated by immersing the roots into a 1 × 106 macroconidia solution, incubating for 6 h at 25°C, and transferring to normal growth conditions (26°C, 16 h light/22°C, 8 h dark). The second or third internode above the soil surface of flowering stage plants grown in a greenhouse was bored with a Bosch electric drill to make a hole (ca. 8 mm in diameter) and inoculated with 0.5 mL of mycelia plug then sealed with petrolatum. The inoculum was created by homogenizing five plates of flourish hyphal mats (approximately 125 mL) with kitchen blender and adjusting to a final volume of 200 mL with sterilized ddH2O. No symptoms were observed in the seedlings or adult plants that were mock-inoculated with PDA plugs. Three days post-inoculation (dpi), roots of the infected seedling turned dark-brown and shrunk and the leaves wilted (Fig. 1E). Typical stalk rot symptoms observed in the inoculated plants were premature wilting of entire plant and hollow and weak stalks, leading to lodging; the longitudinal section of the internodes exhibited obvious dark brown necrosis and reddish discoloration at 14 dpi and 30 dpi, respectively (Fig. 1F). Fusarium kyushuense was re-isolated from the inoculated stalk lesions but not from the control. This is the first record of stalk rot caused by F. kyushuense on maize plants in China. However, F. kyushuense is known to cause maize ear rot in China (Wang et al. 2014) and can produce type A and type B trichothecene mycotoxins in kernels (Aoki and O'Donnell 1998). The occurrence of maize stalk rot and ear rot caused by F. kyushuense should be monitored in China due to the potential risk for crop loss and mycotoxin contamination.

The Dominance of Fusarium meridionale Over F. graminearum Causing Gibberella Ear Rot in Brazil May Be Due to Increased Aggressiveness and Competitiveness

In Brazil, Gibberella ear rot (GER) of maize is caused mainly by Fusarium meridionale (Fmer), while F. graminearum (Fgra) is a minor contributor. To test the hypothesis that Fmer is more aggressive than Fgra on maize, six experiments were conducted in the south (summer), and one in the central-south (winter), totaling seven conditions (year ✕ location ✕ hybrid). Treatments consisted of Fgra or Fmer (two isolates of each) inoculated once four days after silk; inoculated sequentially and alternately (Fgra⇾Fmer or Fmer⇾Fgra) six days apart; or (in the central-south) inoculated sequentially without alternating species (Fmer⇾Fmer or Fgra⇾Fgra). Overall, severity was two times greater in the south (37.0%) where summer temperatures were warmer (20 to 25oC) than in central-south. In the south, severity was greatest in Fmer treatments (67.8%); followed by Fmer⇾Fgra (41.1%); then Fgra⇾Fmer (19.4%); and lowest in Fgra (2.1%), suggesting an antagonistic relationship. In the central-south (15 to 20oC), severity was generally higher in the sequential non-alternating inoculation treatments (Fmer⇾Fmer or Fgra⇾Fgra) than when either species was inoculated only once. Only nivalenol (NIV) or deoxynivalenol (DON) were detected when Fmer or Fgra, respectively, were inoculated singly, or sequentially with no alternation. Both toxins were found in grains harvested from the Fmer⇾Fgra treatment, while only NIV was found in kernels from the Fgra⇾Fmer treatment, suggesting that Fmer was more competitive than Fgra in co-inoculations. The dominance of Fmer as a cause of GER in Brazil may be due in part to its higher aggressiveness and competitiveness compared with Fgra.

BIOCONTROL POTENTIAL OF ENDOPHYTIC Aspergillus spp. AGAINST Fusarium verticillioides

Fusarium verticillioides is the causal agent of ear, stalk and root rot of maize that results in the severe reduction in yields and quality of infected products. Endophytic fungi have been purported as potential candidates in controlling pathogens since they are considered strong plant mutualists that confer disease resilience to their host. The present study was carried out to determine the in vitro antagonistic activity and biocontrol potential of endophytic Aspergillus spp. associated with P. amboinicus leaves against F. verticillioides. Three fungal endophytes from the genus Aspergillus were isolated and identified from the leaves of P. amboinicus, namely A. flavus, A. terreus and A. niger. The fungal isolates were tested for antagonism against F. verticillioides in dual culture plates. Results indicate that the Aspergillus endophytes can restrict growth of F. verticillioides and employ varying mechanisms of antagonism. A. niger inhibited F. verticillioides by 47.37%, followed by A. flavus (41.02%) and A. terreus (27.91%) respectively. Observations of dual culture plates revealed that A. flavus and A. niger antagonized the pathogen via overgrowth mechanism while A. terreus employed antibiosis to restrict the growth of F. verticillioides. The varying degrees of antagonism exhibited by the Aspergillus endophytes show their potential as biocontrol agents and source of bioactive compounds

BIOCONTROL POTENTIAL OF ENDOPHYTIC Aspergillus spp. AGAINST Fusarium verticillioides

Fusarium verticillioides is the causal agent of ear, stalk and root rot of maize that results in the severe reduction in yields and quality of infected products. Endophytic fungi have been purported as potential candidates in controlling pathogens since they are considered strong plant mutualists that confer disease resilience to their host. The present study was carried out to determine the in vitro antagonistic activity and biocontrol potential of endophytic Aspergillus spp. associated with P. amboinicus leaves against F. verticillioides. Three fungal endophytes from the genus Aspergillus were isolated and identified from the leaves of P. amboinicus, namely A. flavus, A. terreus and A. niger. The fungal isolates were tested for antagonism against F. verticillioides in dual culture plates. Results indicate that the Aspergillus endophytes can restrict growth of F. verticillioides and employ varying mechanisms of antagonism. A. niger inhibited F. verticillioides by 47.37%, followed by A. flavus (41.02%) and A. terreus (27.91%) respectively. Observations of dual culture plates revealed that A. flavus and A. niger antagonized the pathogen via overgrowth mechanism while A. terreus employed antibiosis to restrict the growth of F. verticillioides. The varying degrees of antagonism exhibited by the Aspergillus endophytes show their potential as biocontrol agents and source of bioactive compounds

Effects of artificial inoculation on trait correlations with resistance to Fusarium ear rot and fumonisin contamination in maize

AbstractBreeding for resistance to Fusarium ear rot (FER; Fusarium verticillioides Nirenberg) and fumonisin (FUM) contamination in maize (Zea mays L.) is labor intensive, time consuming, and expensive. The objective of this study is to explore three possible shortcuts to improve the efficiency of breeding for resistance to FER and FUM: relying on natural instead of artificial inoculation of Fusarium verticillioides, selecting inbred lines per se instead of topcross hybrids, and using grain test weight (TW) as an indirect selection criterion. We selected the 27 most resistant and 26 most susceptible S0:1 lines from the third cycle of a broad‐based recurrent selection population and topcrossed them to a common inbred line. The resulting topcross hybrids were evaluated in three North Carolina environments under artificial and natural inoculation of F. verticillioides. The entry‐mean heritabilities for FER and FUM are considerably reduced under natural conditions compared to artificial inoculation; therefore, artificial inoculation should be practiced for efficient selection for resistance. We found a high correlation between FER and FUM content of S0:1 lines per se and their topcross hybrids, suggesting that selection among early generation inbred lines per se is an efficient method to improve resistance in their topcross hybrids. The TW of inoculated S0:1 lines per se was strongly and negatively correlated with FER and FUM of their topcross hybrids, suggesting that TW can be utilized as an indirect selection criterion to improve resistance to FER and FUM contamination.

Effect of pydiflumetofen onGibberella ear rot andFusarium mycotoxin accumulation in maize grain

In Ontario, Canada,Fusarium graminearum Schwabe causesGibberella ear rot (GER) in maize, resulting in the accumulation of mycotoxins, mainly deoxynivalenol (DON), DON-3-glucoside (DON-3G) and zearalenone (ZEN) in infected kernels. Fungicides can be an important tool for managing GER and DON and otherFusarium mycotoxins in maize. Until recently, all fungicides available to growers were triazoles, thus no resistance management strategy through fungicide use was possible. In this study, a novel carboxamide fungicide active ingredient (pydiflumetofen) was evaluated against conventional triazole fungicides and mixtures for: (1) effectiveness on mycotoxins (2) optimal application timing; and (3) efficacy of application, with and without an insecticide, under natural and inoculated-misted conditions. The best timing for fungicide application was at full silk, resulting in the highest reduction of GER symptoms and lowest accumulation ofF. graminearum mycotoxins in harvested grain. DON and DON-3G concentrations were reduced by at least 50% with a fungicide application at full silk. Fungicide treatments did not affect fumonisin concentrations in grain. Pydiflumetofen (94 g active ingredients (AI)/ha) and fungicides containing pydiflumetofen (75-94 g AI/ha) were similar to standard triazole fungicides (prothioconazole at 200 g AI/ha and metconazole at 90 g AI/ha) for reducing GER andF. graminearum mycotoxins under misted-inoculated plots and commercial field conditions; as a result, we expect pydiflumetofen to be competitive with triazole-only chemistries in the marketplace, which should delay the onset of fungicide resistance.

First Report of Root Rot Caused by Bipolaris zeicola on Maize in Hebei Province.

Maize (Zea mays L.) is one of the most important cereal crops in China, and the planting area reached 41.3 million hectares in 2019. Root rot is a widespread disease that occurs at the seedling stage of maize, resulting in leaf wilting, root rot and even plant death, and consequently yield and quality losses. During an investigation of spring maize in 2020, seedlings with wilted leaves and dark brown necrotic spots on root were observed in the fields in Kuancheng Manchu Autonomous County, Hebei Province, China. Symptomatic plants were collected for pathogen isolation and identification. The soil on roots was washed off with running water. Then, 2-3 mm necrotic root segments were sampled and surface sterilized with 75% ethanol for 2 min, rinsed three times with sterile distilled water, air-dried on sterile filter paper, and plated on potato dextrose agar (PDA). Plates were incubated at 28℃ in darkness for 3 days. A nonsporulating, dematiaceous fungus growing from root segments was transferred to fresh PDA plates. The colonies were round or irregular round, black, villiform with dense grayish white mycelia. Water agar amended with wheat straw was used for sporulation. Conidiophores were single, light brown, multiseptate, geniculate. Conidia were 38.68 x 10.69 to 71.98 x 20.57 μm, brown, oval, slightly curved, with 2 to 8 septa, and an obviously flattened hilum on the basal cell. Conidia germinated from both poles. The causal agent was identified as Bipolaris zeicola (G.L. Stout) Shoemaker (teleomorph = Cochliobolus carbonum R. R. Nelson) based on its morphological features. For molecular identification, genomic DNA was extracted from fresh mycelia cultured on PDA plates. Partial sequences of ITS-rDNA region and Brn1 reductase melanin biosynthesis gene were amplified using primers ITS1/ ITS4 (TCCGTAGGTGAACCTGCGG/ TCCTCCGCTTATTGATATGC) (White et al. 1990) and Brn01/ Brn02 (GCCAACATCGAGCAAACATGG/ GCAAGCAGCACCGTCAATACCAAT) (Shimizu et al. 1998), respectively. A DNA fragment of 532 bp was obtained from ITS-rDNA region and the sequence (GenBank Accession No. MW407046) was 100% identical to sequence of B. zeicola (GenBank Accession MH864760). The sequence of Brn1 gene was 816 bp (GenBank Accession No. MW415899) and was 99.75% identical to sequence of C. carbonum (GenBank Accession No. AB011658). The morphological and molecular evidence proved that the causal agent isolated from maize roots in Hebei province was B. zeicola. Pathogenicity assays were conducted with one week old (V1 stage) maize seedlings grown from the surface-sterilized seed of cv. Zhengdan 958. The mesocotyl and radicle of each plant (N=3) were inoculated with a 5 mm fungal disk of B. zeicola. Mock-inoculated plants (N=3) with sterile PDA disk served as the negative control. After 7 days, plants inoculated with B. zeicola were wilted with dark brown necrotic spots on mesocotyl and radicle. Meanwhile, the negative controls did not present any symptoms. Koch's postulate was proved with successful re-isolation of the same fungus from the inoculated maize plants. These results confirmed the pathogenicity of B. zeicola on maize root. B. zeicola mainly causes an important foliar disease in many regions of the world, known as Northern corn leaf spot, in addition, it can also cause ear rot and stalk rot of maize (Liu et al. 2015). To our knowledge, this is the first report of root rot caused by B. zeicola on maize in China, which extends the known agents of maize root rot. Therefore, it is necessary to explore effective seed-applied fungicides for disease control. Also, more attention should be paid to develop hybrids with resistance to this disease.

Effect of Harvest Time and Insect Control as Agriculture Practices on Maize Ear Rot Disease and Kernels Contamination by Some Mycotoxins

Under field conditions, reaction of maize (Zea mays) genotypes against ear and kernels rot disease was studied under natural infection at two different harvest time and insect control at Sakha Agricultural Research Station, Egypt, seasons 2019 and 2020. In the field, split-plot design with three replicates was applied, maize hybrids were allocated in main plots, harvest time and insect control were assigned in sub plots. Results concluded that, hybrids of TWC353, SCs176 and 131 showed the highest mean ears rot infection and contamination with fumonisin (FB1) and aflatoxins, as well as the lowest yield weight. In reverse to, SCs10, 128 and 130 hybrids, they recorded the lowest response to disease infection and toxin contamination beside they gave the highest yield. Moreover, interaction between harvest time showed that, insect control by Pestban insecticide with normal harvest followed by early harvest led to yield enhancement and caused reduction on ear rot disease and its severity, FB1 and aflatoxins accumulation compared to normal harvest without controlling insects. Concerning of interaction between maize genotypes and insect control with normal harvest, it was found a reduction in grains contamination by toxins in most tested maize hybrids as a result to reduction of ear rot disease which affected by controlling of insect injury by Pestban insecticide, followed by interaction between early harvest and maize hybrids.

Incidence of Maize Ear Rot and Stem Borer Participatory Rural Appraisal Efficacy Relationship by Farmers in Western Kenya

Maize has become Africa’s second most important food crop after cassava. Maize is Kenya’s staple food and is grown by about 90% of rural households. Among the pests and disease, stem borers are considered to be the most serious insect pests and ear rot the most important disease. A participatory rural appraisal (PRA) was carried out in Malakisi and Sirisia Divisions of Bungoma County, Western Kenya (N00°68.824 - N00°78.641and E34°38.076-E34°55.604). The PRA involved focused group discussions and 100 questionnaires were used in each Division to gather information from maize farmers. The focused groups consisted of the males and females who had engaged in maize production for at least 5 years. The two Divisions were perceived to have different levels of ear rot causing fungi because of different agro-ecological zones. This determined the farmers’ knowledge on the relationship between maize ear rot and stem borer damage, yield losses and farmer’s livelihoods. Farmers put 54% of their farms under maize production with mean yields of 9.8bags/acre and 10.9bags/acre for Malakisi and Sirisia Divisions respectively. Most farmers planted maize early 78% and 83% for Malakisi and Sirisia. The use of certified seeds especially hybrids was high in both Divisions with Malakisi 74% while Sirisia had 84%. Only 63% and 66% of the population for Malakisi and Sirisia respectively were food secure. The yields per unit area is far less than the potential due low levels of inorganic fertilizer use and unexploited organic manure utilization. But the government intervention/subsidy through National accelerated agricultural input and access programme (NAAIAP) programme in both Divisions realized significant increase in the yields of 20-30 bags /acre). All farmers affirmed knowing both maize stem borers and ear rot. The occurrence of stem borers was 16% in long rain season while 84% in short rains season. There were No stem borer tolerant varieties with farmers, local stockists and traders. Farmers in Malakisi 46% and Sirisia 37% recognized the relationship as a pathway between stem borer damage and ear rot incidence. Some farmers and traders admix their maize grains with Malakisi 25% and Sirisia 13%. Rotten ears are used as livestock, poultry feeds, local brews and human food during hunger months. Coupled with the high number of traditional stores which are grass thatched and dilapidated, this predisposes the populace to mycotoxins associated with ear rot posing a health risk.

The impact of fusarium ear rot in Poland and methods to reduce losses caused by the disease

Maize has a significant economic impact all over the world. Fungi in the genus Fusarium that cause fusarium ear rot of maize have significant effect on the yeld quality and quantity. The main threat is the contamination of grain with the mycotoxins they produce - as these are harmful to humans and animals. Such mycotoxins are a group of secondary metabolites of varied structure, which belong mainly to trichothecenes, fumonisins and zearalenones. As no efficient chemical control read and pink rot in the field is possible, prevention relies on cultural practices and use resistant hybrids. Insects play an important role in the infection, which is why it is recommended to control their prevalence during growing season.

Multi-parent QTL mapping reveals stable QTL conferring resistance to Gibberella ear rot in maize

Maize production is on risk by Gibberella ear rot (GER) caused by Fusarium graminearum. This is one of the most important ear rot diseases in temperate zones as it leads to yield losses and production of harmful mycotoxins. We investigated, for the first time, the potential use of Brazilian tropical maize to increase resistance levels to GER in temperate European flint germplasm by analyzing six interconnected biparental populations. We assessed GER symptoms in Brazil and in Europe in up to six environments (= location × year combinations) during the growing seasons of 2018 and 2019. We conducted multi-parent QTL and biparental QTL mapping, and identified four QTLs with additive gene action, each explaining 5.4 to 21.8% of the total genotypic variance for GER resistance. Among them, QTL q1 was stable across test environments, populations, and between inbred lines and testcrosses. The accuracies of genomic prediction ranged from 0.50 to 0.59 depending on the resistance donor and prediction model. Jointly, our study reveals the potential use of Brazilian resistance sources to increase GER resistance levels by genomics-assisted breeding.

First Report of Fusarium miscanthi Causing Ear Rot on Maize in China.

Maize (Zea mays L.), an important food and feed crop worldwide, can be infected by Fusarium pathogens that can contaminate grain with mycotoxins. From August to October in 2018 and 2019, a field survey for maize ear rot was conducted in 76 counties of Guizhou province. The incidence ranged from 3% to 15% at individual fields in different areas. A total of 175 diseased maize ears with similar symptoms, including kernels covered with white, pink or salmon-colored mold or exhibiting a white streaking ("starburst") symptom, were collected from fields. Symptomatic kernels were surface-sterilized by soaking for 30 s in 70% alcohol and for another 2 min in 2% sodium hypochlorite solution, followed by five rinses with sterile water. Each kernel was cut into half and placed on potato dextrose agar (PDA). After incubation at 28 °C in the dark for 5 days, colonies displaying morphological characteristics of Fusarium were transferred to fresh PDA (Leslie and Summerell 2006). Single-sporing was conducted to purify the putative Fusarium colonies. A total of 120 isolates belonged to 16 Fusarium species were determined and F. meridionale was the dominant species. Five isolates from Huaxi district of Guiyang City were identified as F. miscanthi (Gams et al. 1999). Colonies on PDA were white and floccose, and pigmentation as viewed from the underside of the Petri dish was violet. The average growth rate was 7.5-8.0 mm/day at 28 °C in the dark. In cultures grown on PDA, 0-1-septate microconidia were produced in slimy heads. Microconidia were clavate to fusiform with a truncate base and a broadly rounded tip, 4.8-13.3 μm × 1.8-3.3 μm (n=110). In cultures grown on half-strength CMC broth (Xu et al. 2010), macroconidia were mostly 3-septate, almost straight for most of the length, with a slightly foot-shaped basal cell and curved apical cell that gradually tapered, 17.8-71.3 μm × 2.0-4.3 μm (n=78). The identity of the fungus was confirmed by sequence comparison of the partial translation elongation factor-1α (TEF-1α), RNA polymerase II subunit (RPB2), mitochondrial small subunit rDNA (mtSSU) and β-tubulin genes (Mirete et al. 2004; O'Donnell et al. 2010; O'Donnell and Cigelnik 1997). BLASTn searches of GenBank, using the partial TEF-1α (MN750829), RPB2 (MN750834), mtSSU (MT594104) and β-tubulin (MT584781) sequences of representative isolate GYHXB03 as the queries, revealed 99.84%, 99%, 100% and 100% sequence identity, respectively, to F. miscanthi NRRL 26231 accessions AF324331, JX171634, AF060371 and AF060384. Inoculum of isolate GYHXB03 was prepared (Xu et al. 2010), and a pathogenicity test was conducted on maize hybrid "Shundan7" and repeated twice. A 106/mL spore suspension (2 mL) or sterile water was injected into each of 8 maize ears through the silk channel at the blister stage of reproductive development in field (Duan et al. 2019). After three weeks, typical Fusarium kernel rot symptoms the same as those previously shown in the field was observed on all pathogen-inoculated plants, while the controls were asymptomatic. The pathogens re-isolated from two diseased kernels were identified as F. miscanthi based on morphology and TEF-1α and mtSSU analyses. F. miscanthi was first isolated from Miscanthus sinensis in Denmark (Gams et al. 1999), and also identified from M. × giganteus rhizomes in Belgium (Scauflaire et al. 2013). To our knowledge, this is the first report of F. miscanthi causing maize ear rot in China. This disease should be monitored in Guizhou due to its threat to maize production.

Exploiting genetic diversity in two European maize landraces for improving Gibberella ear rot resistance using genomic tools

Key messageHigh genetic variation in two European maize landraces can be harnessed to improve Gibberella ear rot resistance by integrated genomic tools.Fusarium graminearum (Fg) causes Gibberella ear rot (GER) in maize leading to yield reduction and contamination of grains with several mycotoxins. This study aimed to elucidate the molecular basis of GER resistance among 500 doubled haploid lines derived from two European maize landraces, “Kemater Landmais Gelb” (KE) and “Petkuser Ferdinand Rot” (PE). The two landraces were analyzed individually using genome-wide association studies and genomic selection (GS). The lines were genotyped with a 600-k maize array and phenotyped for GER severity, days to silking, plant height, and seed-set in four environments using artificial infection with a highly aggressive Fg isolate. High genotypic variances and broad-sense heritabilities were found for all traits. Genotype-environment interaction was important throughout. The phenotypic (r) and genotypic ({r}_{g}) correlations between GER severity and three agronomic traits were low (r = − 0.27 to 0.20; {r}_{g}hspace{0.17em}= − 0.32 to 0.22). For GER severity, eight QTLs were detected in KE jointly explaining 34% of the genetic variance. In PE, no significant QTLs for GER severity were detected. No common QTLs were found between GER severity and the three agronomic traits. The mean prediction accuracies (rho ) of weighted GS (wRR-BLUP) were higher than rho of marker-assisted selection (MAS) and unweighted GS (RR-BLUP) for GER severity. Using KE as the training set and PE as the validation set resulted in very low rho that could be improved by using fixed marker effects in the GS model.

In vitro effect of some commercial fungicides on mycelial growth of Fusarium species causing maize ear rot disease in China

Fusarium ear rot is an important disease of maize and requires several fungicide treatments to achieve satisfactory control in China. The extensive use of common fungicides to control this disease has caused fungicides resistance of pathogens. In this study, we tested the effect of different commercial fungicides on mycelial growth of Fusarium graminearum and Fusarium oxysporum isolates collected from different fields in the Jilin Province of China in 2014. The effect of concentration on mycelial growth varied significantly (p < 0.05) between tested commercial fungicides. Our results showed that among the 10 tested commercial fungicides, prochloraz and polyoxin-D highly reduced the mycelial growth of Fusarium graminearum by 3.4 cm and 4.1 cm, respectively as compared to other fungicides at a concentration of 0.1 mg/L. Moreover, a 0.1 mg/L concentration of polyoxin-D, tebuconazole, fosetyl-Al, fludioxonil, azoxystrobin, and carbendazim were also highly effective to decrease the mycelial growth of Fusarium oxysporum with 3.1 cm, 3.1 cm, 3.4 cm, 3.8 cm, and 4.4 cm as compared to other fungicides at the same concentration. These results will provide useful information to select suitable fungicides for management and control of maize ear rot disease caused by Fusarium graminearum and Fusarium oxysporum and further increase our understanding of the effects of different fungicides concentrations on Fusarium graminearum and Fusarium oxysporum.

Molecular diversity of the Fusarium fujikuroi species complex from maize

Random amplified polymorphic DNA (RAPD) markers were used to estimate genetic relationship and diversity of Fusarium species associated with pink ear rot of maize. Three Fusarium species – F. verticillioides, F. temperatum and F. subglutinans sensu stricto were collected from contaminated corn kernels. A collection of 41 randomly selected Fusarium isolates (16 F. verticillioides, 16 F. temperatum and nine F. subglutinans sensu stricto) was screened for polymorphism with thirty decamer primers. Seventeen primers that had generated a high number of polymorphic loci were used for the analysis of genetic diversity. The primers yielded a total of 146 polymorphic loci, an average of 8.59 polymorphic bands per primer. The percentage of polymorphic bands (%P) was 46.1%. The RAPD-based UPGMA analysis demonstrated that although F. temperatum and F. subglutinans s.s. form two distinct groups they are more similar to each other than to F. verticillioides. Fusarium verticillioides was the most heterogenous species (Nei’s genetic diversity 0.180), while the least heterogenous one was F. subglutinans s.s. whose genetic diversity was 0.098. The analysis of the translation elongation factor 1-α and β-tubulin gene sequences as well as the mating type ratio were employed to support the RAPD data.

First Report of Fusarium fujikuroi Causing Leaf spot of Dalbergia odorifera T.Chen in China.

Dalbergia odorifera T. Chen is a national second-grade protected and one of the four famous trees in China, with high medicinal and economic value. Leaf spot disease in this plant can cause the leaves to dry up, perforate or even fall off, which affects the growth and development, and also has a great influence on its products. In May 2019, the leaf spot of Dalbergia odorifera T. Chen was found and observed in Chengmai County (N19°40', E110°0'), Hainan Province, China, and the symptomatic leaves were brought back to the laboratory for research; According to our survey at that time, the incidence of the disease was between 10% and 15%. A sterile stainless-steel scalpel was used to cut the tissues at the junction of the leaf lesions and placed on a clean bench, soaked in alcohol (75 %) for 30 s, and rinsed thrice with sterile water. Then it was inserted obliquely onto lactic acid-containing potato dextrose agar (PDA) and incubated at 28 °C for 5 days. The growing prominent colonies were singled out and re-inoculated on PDA and SNA plates. Preliminary identification was based on morphological characteristics, followed by molecular identification of strains by evaluating genes for translation elongation factor-1α(TEF-1α), beta-tubulin, mitochondrial small subunit (mtSSU)( Duan et al. 2019; Cao et al.2019; Stenglein et al.2010), and histone H3 (Jacobs, et al. 2010) . Through morphological observation, the isolate was identified as Fusarium fujikuroi. At the initial stage of growth on PDA, the strain produced a large number of white hyphae, followed by pink and purple-brown hyphae in the center of the colony which spread to the surrounding area. The microspores were abundant, colorless, elliptic or clavate, without septum or at 1-2 septate, and the size was about 3.3 to 13.5 × 1.2 to 3.2 µm. After nine days of culturing on SNA medium, few, large conidia were observed, typically sickle-like, with 3-4 septa with a size of about 20 to 40.2 × 2.3 to 4.4 μm. The identity of the strains was determined by comparing the gene sequences of TEF-1α, mtSSU, beta-tubulin and histone H3 by NCBI BLAST. The results showed that TEF-1 α (MN958396), mtSSU (MN958394), β - tubulin (MN958395), and histone H3 (MN958397) from the target strain (jxht0302) had 100% sequence homology with F. fujikuroi (GenBank, accession numbers KF604040.1, MF984420.1, XM023575231.1, and MF356523.1 respectively). Next, the infection of D. odorifera T. Chen seedlings with and without injury was studied using a fungus block, with PDA as a control. Two days after inoculation with injury, obvious lesions were observed on the leaves, which appeared at least 5 days post- inoculation without injury, with no lesions in the control group. F. fujikuroi could be re-isolated from the leaves with lesions, but not from the control group. F. fujikuroi causes Black Rot of Macleaya cordata and maize ear rot (Yull et al.2019; Duan et al. 2019). As far as we know, this is the first report of F. fujikuroi causing leaf spot disease of D. odorifera T. Chen. Given the importance of D. odorifera T. Chen products, this disease needs more attention to tackle it.

QTL mapping of resistance to Gibberella ear rot in maize

Gibberella ear rot (GER), caused by the fungal pathogen Fusarium graminearum, is becoming one of the most prominent pathogens responsible for ear rot in maize. In this study three F2 populations, F2-C, F2-D, and F2-J, and their corresponding F2:3 families, were constructed by crossing three highly GER-resistant inbred lines—Cheng351, Dan598, and JiV203—with the susceptible line ZW18. We used this cross for genetic analysis and QTL mapping of resistance to GER. Analysis of variance of GER in the three F2 populations revealed the presence of significant differences among genotypes and between locations. The broad-sense heritability (H2) of GER resistance was estimated to be 0.68, 0.63, and 0.64 in the three F2 populations, indicating that genetic factors play a key role in the development of phenotypic variation. Seventeen QTLs conferring resistance to GER were detected in the three F2 populations, among which the QTL qRger7.1, originating from the resistant parent Cheng351, explained 20.16–41.84% of the phenotypic variation. The physical support interval of qRger7.1 exhibited approximately 2 Mb overlap with that of qRger7.2, which was derived from the resistant parent Dan598, supporting the identification of potential “hotspots” of the target QTLs. QTLs derived from the resistant parents Dan598 and JiV203 accounted for 59.67–61.28% and 65.82–66.90%, respectively, of the phenotypic variation. The GER-resistant QTLs identified in this study are useful candidates for improving the resistance to GER in maize using molecular marker-assisted selection.

Mycotoxins produced by fusarium species associated with maize ear rot in Iran

Mycotoxins contamination is one of the most important problems worldwide in maize that can cause serious threat for human and animal health. The aim of this study was to determine the ability of Fusarium species associated with maize ear rot to produce diverse mycotoxins. The results showed, One out of three isolates of F. subglutinans produced detectable level of Beauvericin (BEA); the only isolate of F. temperatum produced 302 µg/g of BEA. Two out of five isolates of F. redolens produced enniatin B1and four isolates of this species produced high levels of BEA. As well, 21 isolates of Fusarium incarnatum-equiseti species complex (FIESC) and one isolates of F. brachygibbosum were evaluated for production of trichothecens (T-2 toxin, HT-2 toxin, Diacetoxyscirpenol (DAS), nivalenol (NIV) and deoxynivalenol (DON)), zearalenone (ZEN), enniatins (ENN A, A1, B and B1) and BEA by HPLC. Production of trichothecens, ZEN and BEA with one, three and four isolates of FIESC, respectively were observed and one isolate of F. brachygibbosum only produced detectable level of DAS and ENN B1. Analyzing of moniliformin production of F. proliferatum (26 isolates), FIESC (21 isolates) and F.thapsinum (10 isolates) showed none of them produce this toxin. These results revealed the ability of Fusarium spp. from maize to produce a varied range of mycotoxins which are harmful to human and animal’s health. Therefore, the occurrence of such broad number of different species on Iranian maize could be reason of great concern because of the toxigenic risk associated to these species.