Dorsal Arch Research Articles

First Report of Meloidogyne incognita on Daylily (Hemerocallis citrina) in Shaanxi, China.

Daylilies (Hemerocallis citrina Baroni) are herbaceous perennials grown extensively as ornamental plants worldwide. In China, daylilies are important cash crops, which are used for their roots, leaves, and flowers as both food and medicine (Guo et al., 2022). Dali County, Shaanxi Province, is an important production region for the commercial cultivation of daylily in China. The daylily cultivation area of Dali County was 43.33 million m2 and the output reached 227 thousand kg, which worth more than 109.12 million dollars. In July 2021, numerous daylily plants (cv. Shayuan) showed chlorotic leaves and stunted growth in a field in Dali County. The area of daylily field we investigated was about 2000 m2, and the incidence of root-knot nematode disease was more than 90%. The inflorescences of diseased plants decreased by nearly 30%, which affected the yield seriously. The diseased plants exhibited obvious galling on the roots which were typical symptoms of infection by root-knot nematodes (RKNs). Population densities of second-stage juveniles (J2s) ranged from 300 to 350 in 100g soil layer of 10-20 cm. Nematodes were collected from root samples (n = 15) and were found in all of the diseased plant samples. Morphological and molecular analysis were conducted using females, males, and J2s. The perineal patterns of females (n = 20) showed a high dorsal arch, and with wavy striae, which mostly lacking obvious lateral lines. Morphological measurements of adult females (n = 20) include body length (BL) = 668.99 ± 24.56 (487.57-897.84) μm, body width (BW) = 433.73 ±12.84 (343.71-551.61) μm, stylet length = 15.64 ± 1.45 (10.86-28.26) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 2.57 ± 0.20 (1.41-3.68) μm, vulval slit length = 20.44 ± 0.91 (16.00-24.22) μm, and vulval slit to anus distance = 18.05 ± 1.06 (14.58-24.90) μm. The males showed a trapezoidal labial region, with a high head cap and concaved at the center of the top end in lateral view; and the stylet knobs were prominent, usually demarcated from the shaft. The morphological characters of males (n = 7) were as follows: BL = 1124.56 ± 53.97 (998.37-1336.52) μm, BW = 33.60 ± 0.79 (30.21-36.52) μm, stylet length = 23.63 ± 0.78 (20.14-26.37) μm, DGO = 3.04 ± 0.09 (2.69-3.38) μm, spicule length = 25.72 ± 0.57 (23.97-28.33) μm. The key morphometrics of J2s: BL = 439.13 ± 6.52 (398.32-481.33) μm, BW = 15.14 ± 0.26 (13.91-16.66) μm, stylet length = 13.44 ± 0.29 (10.96-14.60) μm, DGO = 2.13 ± 0.18 (1.22-3.10) μm, tail length = 57.46 ± 4.89 (38.85-101.33) μm, hyaline tail terminus = 16.93 ± 0.97 (11.45-22.54) μm. The morphological features of the females, males, and J2s match the original description of Meloidogyne incognita (Eisenback and Hirschmann, 1981). Eleven individual females were transferred to eleven different tubes for DNA extraction and the species-specific primers Mi2F4/Mi1R1 (ATGAAGCTAAGACTTTGGGCT/TCCCGCTACACCCTCAACTTC) were used for the identification of M. incognita (Kiewnick et al. 2013). A 300 bp target fragment was amplified by the primer pairs, confirming the RKNs collected from daylily plants were M. incognita. To confirm the result of species identification, the NADH dehydrogenase subunit 5 (nad5) from the mitochondrial DNA region was amplified using primers NAD5-F/R (TATTTTTTGTTTGAGATATATTAG/CGTGAATCTTGATTTTCCATTTTT) (Janssen et al. 2016). A fragment of 611 bp was obtained and the sequence (GenBank Accession No.OP115729) was 100% identical to the known sequence of M. incognita (GenBank Accession No. MT683461). The ITS region was amplified using the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992). The sequences from the ITS region were 768 bp (GenBank Accession No. OP095037) and showed 100% identical to the known sequence of M. incognita (GenBank Accession No. MH113856). An infection test was conducted in greenhouse conditions. Eighteen 5-weeks-old healthy daylily seedlings (cv. Shayuan) were individually cultured in 9 L pots filled with autoclaved-soil and each plant was inoculated with 3,000 J2s. Six non-inoculated daylily plants served as negative controls. After 60 days, all of the inoculated plant roots showed galling symptoms which were similar to those observed in the field, the nematodes were extracted from roots and were identified as M. incognita with the sequence-specificprimers Mi2F4/Mi1R1. No obvious symptoms were observed on control plants. An average of 9635 J2s were recovered from inoculated plants, (reproductive factor = 3.21), which confirmed the pathogenicity of M. incognita on daylily. Although it was reported that daylily was a host of M. incognita in Florida (Inserra et al. 1995), to our knowledge, this is the first evidence that M. incognita naturally infecting daylily in China. This root-knot disease leads to the yield reduction of daylily and may cause serious economic losses, so further studies should focus on the occurrence and effective control of this disease.

Molecular phylogeny and morphological studies reveal a 30‐year‐old rain tree (Samanea saman) maintains populations of Meloidogyne enterolobii, a new host plant in Thailand

AbstractSamanea saman (Jacq.) Merr., commonly known as rain tree, is a crucial shade tree with traditional medicinal properties. In our study, 50 soil samples were collected around the rhizosphere of rain tree in Bangkok, Pathum Thani, Uttaradit, Khon Kaen and Ubon Ratchathani Provinces in Thailand. Meloidogyne populations were only found in soil samples from Mueang district, Khon Kaen Province and a 30‐year‐old rain tree exhibited root gall symptoms caused by root‐knot nematodes (Meloidogyne) on its adventitious roots. The species of the nematodes were identified based on its morphological and molecular characteristics. The results demonstrated that the perineal patterns and morphometrics of the nematodes were highly similar to the original description of M. enterolobii, except for a squarish dorsal arch and two faint lateral lines. During the molecular analysis, nematode DNA was extracted and amplified using three primer sets, C2F3/1108, D2A/D3B and MK7F/MK7R SCAR primer, to generate polymerase chain reaction (PCR) products of 700, 750 and 520 bp, respectively. The polygenetic tree of the two markers displayed similarity among the COII and the 16S rRNA gene in mitochondria and the D2/D3 region in 28S rRNA. Therefore, the nematodes were identified as M. enterolobii Yang and Eisenback, 1983. This study reports a new host record of M. enterolobii on rain tree.

Detection of root-knot nematodes infecting weedy rice in San Juan, Batangas, Philippines

Weedy rice collected from a rice field was found to be infected with root-knot nematodes. Perineal patterns of root-knot nematode females from galled weedy rice roots revealed Meloidogyne graminicola morphology with vulva-anus complex showing egg-like appearance, moderately high dorsal arch, smooth striae on the edge with distinct striations near the smooth vulval lips and absence of lateral ridges. DNA amplification based on M. graminicola-specific marker yielded positive detection. ITS-rDNA-based characterization revealed 99.81% similarity of the local isolate to M. graminicola sequences from NCBI GenBank®. ITS-based maximum-likelihood phylogram placed the isolate in M. graminicola clade with a high bootstrap support.

PRESUMPTIVE DIAGNOSIS OF SPINA BIFIDA IN CANINE PATIENT

The aim of this report is to describe a presumptive diagnosis of spina bifida in a mixed breed dog, due to previous diagnostic inconsistencies. Spina bifida is an uncommon congenital anomaly characterized by poor bone formation due to incomplete closure or the absence of the dorsal arch of the vertebral structure during the process of embryogenesis. Animals with this condition may have difficulties in the locomotion process, which constantly threatens the quality and survival of those affected. Spina bifida can present itself in four different forms and to varying degrees. A 5-month-old mixed breed dog was seen at a veterinary clinic in Conselheiro Lafaiete/MG with difficulties in the locomotion process and previous diagnostic inconsistencies in other veterinary services. On physical examination, he had kyphosis in the thoracic region and decreased proprioceptive capacity in the hind limbs. After radiographs were taken, morphological thoracic alterations were observed in the segment between the T5 to T9 vertebrae, with duplicated spinous processes and a decrease in the dimensions of the intervertebral space. The radiographic examination suggested presumptive evidence of thoracic spina bifida due to the unavailability of the tutor to perform more sensitive exams such as tomography and magnetic resonance. Therefore, drugs for pain and neuropathic control such as gabapentin and pregabalin were prescribed, at different times, until new recommendations, which have shown therapeutic efficacy to the patient. Currently, the patient uses a wheelchair adapted for locomotion due to the loss of movement of the hind limbs, in addition to weekly physical therapy follow-up and acupuncture sessions.

First Report of the Root-Knot Nematode Meloidogyne enterolobii Parasitizing Eggplant in Mexico.

Eggplant (Solanum melongena L.) is an important vegetable cultivated in Mexico and the state of Sinaloa is the largest producer of eggplants with 90% of the country's total production. In April 2022, eggplants cv. Barcelona exhibiting root-knot, stunted growth, and yellowing were detected in a greenhouse in Culiacán, Sinaloa, Mexico. Disease incidence was approximately 10% (1000 plants evaluated). Ten soil samples were collected from the greenhouse. An average of 400 root-knot nematode second-stage juveniles (J2s) were extracted from 100 g of soil for each sample. Roots were washed with tap water and dissected. Females and egg masses were obtained by dissecting galls. Microscopic examination of the perineal pattern of mature females (n= 10) was round to ovoid, with rounded and high dorsal arch. Females (n= 20) were globular to pear-shaped, body length of 645 to 739 µm, body width of 470 to 559 μm; the stylet was dorsally curved, 15.1 to 16.2 μm long, and with rounded stylet knobs; neck length of 195 to 202 µm and the distance from the base of the stylet to the dorsal gland orifice (DGO) was 4.2 to 5.8 µm. Second-stage juveniles were vermiform, annulated, and tapering at both ends. Morphological characteristics of the females and J2s were consistent with those reported for Meloidogyne enterolobii (Yang and Eisenback 1983). For molecular identification, total DNA was extracted from individual females according to the extraction protocol described by Hu et al. (2011), and the ribosomal intergenic spacer 2 (IGS2) was amplified by PCR using the specific primers Me-F/Me-R for M. enterolobii (Long et al. 2006). PCR amplification generated a 236-bp fragment for the analyzed sample and the amplicon was sequenced. The sequence was deposited in GenBank under the accession number OP004802. BLASTn searches showed 100% identity with available sequences of M. enterolobii from the USA (MH800967) and China (KP411228, MT742011). A phylogenetic tree including published IGS2 sequences for Meloidogyne spp. was constructed based on Maximum Likelihood method. The phylogenetic analysis placed the sequence MeCUB in the same clade with Meloidogyne enterolobii. Pathogenicity tests were performed under greenhouse conditions by inoculating 5000 eggs of a pure population of M. enterolobii on 10 healthy eggplants cv. Barcelona (30-day-old) grown in pots with sterilized soil. Five uninoculated eggplants were used as control. Plants were maintained at 26 to 34°C in a greenhouse for 35 days. Stunted growth and root-galling symptoms appeared on inoculated plants after 21 days, whereas control plants remained symptomless. Nematode reproduction factor (final population density/initial population density) was 0.93 and 2.28 at 28 and 35 days after inoculation, respectively. The nematode on the inoculated roots was morphologically identical to that observed on naturally infected roots in the field. The pathogenicity test was carried out twice with similar results. Meloidogyne enterolobii has been previously reported on eggplants in Puerto Rico (Rammah and Hirschmann 1988). To our knowledge, this is the first report of M. enterolobii causing root-knot of eggplant in Mexico. This nematode is widely distributed in Sinaloa affecting other vegetable crops such as tomato (Martínez-Gallardo et al. 2015), chili (Carrillo-Fasio et al. 2020), and cucumber (Gómez-González et al. 2020), so future studies are required to evaluate integrated management strategies.

Meloidogyne paramali n. sp. (Nematoda: Meloidogyninae) and First Report of M. marylandi in maple and yacca tree from Japan.

Meloidogyne paramali n. sp. was detected from Japanese maple trees (Acer palmatum) from Chiba, Japan during quarantine inspections in China. This species is characterized by second-stage juveniles (J2) with short tail length 32.2 (24-36.8) μm, finely rounded to broadly pointed tail terminus with extremely short hyaline tail terminus 4.3 (3.0-4.9) μm; perineal patterns of females characterized by an oval or irregular appearance, with round and low dorsal arch, and fine and smooth striae. M. paramali n. sp. is very similar to M. mali in that the perineal pattern has fine, smooth striae and both J2 have a short tail, but it can be distinguished from the latter by perineal pattern of the female (lateral field distinct vs. indistinct), shorter J2 hyaline tail terminus (4.3 [3.0-4.9] μm vs. 8.2 [4.8-12.7] μm, and by J2 tail with finely rounded to broadly pointed tail terminus, never sharply pointed vs. finely rounded and almost pointed. The polytomous key codes of the new species are as follows: Female: A21, B2, C32, D4; Male: A21, B3, C2, D1, E2, F2; J2: A2, B23, C43, D34, E12, F34. Detailed phylogenetic analysis based on partial 18S, ITS, D2-D3 28S, and partial mtCOI sequences also confirmed it as a new species, which is very close to M. mali and M. vitis and forms molecular group VIII. M. marylandi and other Meloidogyne species detected from plants from Japan in China are also discussed.

Postoperative pharmacological ventilation in a dog following surgical stabilisation of the first and second cervical vertebrae

AbstractA 7‐month‐old, crossbreed dog presented for collapsing episodes and acute non‐ambulatory tetraparesis. Magnetic resonance imaging and computed tomography revealed absence of the dorsal arch of the first cervical vertebrae and displacement of the second cervical vertebrae, with severe spinal cord compression. Surgical spinal stabilisation was performed under general anaesthesia. Postoperatively, attempts to wean the animal from mechanical ventilation were unsuccessful. Despite the dog's efforts to breathe spontaneously, severe hypercapnia (EtCO2 11.4 kPa [85.5 mmHg]) developed. Due to a lack of appropriate resources, pharmacological support of ventilation was attempted, using doxapram (2 mg/kg intravenously), followed by a variable‐rate infusion (5–30 µg/kg/min) maintained for 48 hours. The dog was discharged 48 hours after doxapram discontinuation.

Morphology Root-Knot Nematode Meloidogyna incognita on Cucumber Plant in Southern Iraq

Isolated root-knot nematodes. Meloidogyne sp from the roots of the cucumber plant from different regions of southern Iraq, and the morphological study showed the presence of type M. incognita. It showed the perineal pattern characterized by the presence of a squarish dorsal arch located at the dorsal apex of the perineal pattern, and jagged and jagged cuticle lines, in addition to the unclear lateral fields and the presence of wrinkles or breaks instead. The measurements of the second larvae phase showed that the average body length (L) was 444 μm, while the largest body length was 496 μm and the lowest body length was 386 μm, the average length of the spear was 11.8 μm, the largest length of the shaft was 12.5 μm and the minimum length was 11 μm. The average tail length was 61.9 μm, the largest tail length was 66 μm, and the minimum tail length was 60 μm. As for hyaline, the largest length was 13 μm and the lowest length was 11 μm.

First report of the root-knot nematode Meloidogyne incognita on Salvia miltiorrhiza Bunge in Henan Province, China.

First report of the root-knot nematode Meloidogyne incognita on Salvia miltiorrhiza Bunge in Henan Province, China.

First Report of Meloidogyne arenaria Infecting Maize in Guizhou Province of China.

Maize (Zea mays L.) as the most important crops is globally cultivated for food, feedstuff and industrial raw materials. During August to September 2021, we carried out a survey on the soil-borne diseases of tobacco in Guizhou Province. Poorly developed maize plants were observed in the same field of root-knot nematode (RKN) infected tobacco (Nicotiana tabacum L.) in Dafang County, Bijie City (106º00'08"E, 22º24'81"N) (Figure 1A). Roots of maize plant were taken back to laboratory for nematode identification and infecting confirmation in greenhouse. Females, males, second-stage juveniles (J2s) and eggs were collected from the sampling roots and nematodes were identified based on morphological and molecular characteristics. The identification of the nematode was performed by observations of morphological characters of adults (n= 30) and molecular analysis. Perineal pattern of female showed distinct characteristics of a low dorsal arch and lateral field marked by forked and broken striae and without punctate markings between the anus and tail terminus (Fig. 1B). J2s hatched from eggs demonstrated the morphometric characters of body length = 433.25 µm, body width = 16.31 µm, stylet length = 10.43 µm. DGO = 3.62 μm, tail length = 52.78 μm, and hyaline tail terminus = 11.14 μm (Fig. 1C). For molecular analysis, females from infected roots of maize in fields and in Koch's postulate experiment were definitively identified via PCR using the M. arenaria species-specific markers (Far/Rar：TCGGCGATAGAGGTAAATGAC/TCGGCGATAGACACTACAACT). PCR products of females amplification were run in the agar gel, and a PCR product of 420 bp band was identified for M. arenaria for all tested female samples (Fig. 1E). The obtained specific fragment was sequenced and submitted to GenBank with accession number of OP503512. A 100% identity of the Fare/Rare sequence with M. arenaria (Accession: GQ395518.1, J. Phytopathol. 160(2): 59-66, 2012, MZ555757.1，MZ555753.1, U42342.1）were found through NCBI blast. Therefore, based on morphological and molecular analysis, the nematodes from maize were determined to be M. arenaria according to the related description of (Perry et al., 2009). Koch's postulate was conducted in greenhouse by inoculation of J2 from the original population to pots containing two-week old maize seedlings (n= 15, 1000 J2/seedling) and 5 seedlings were nonincubated as controls. Plants were maintained in greenhouse at 26 to 28°C. On day 50 after inoculation, all the inoculated plants showed typical RKN symptoms such as stunting and galled roots which were similar to those observed in the field (Fig. 2A). Females, J2 and eggs were found in the roots after staining(Fig. 2B, C, D) by the method of Bybd et al. (1983), while uninoculated control plants presented normal development, confirming that Maize was a host of M. arenaria. M. arenaria is one of the most damaging plant-parasitic nematodes, which can infect many crops worldwide, resulting in great losses on the crop quality and yield. The Southern Root-Knot Nematode (M. incognita) had been known to cause root-knot nematode disease on maize in Shandong Province of China(Shi et al.,2020). As a major rotation crop, maize was recommended for the management of RKNs and most soil-born pathogens in tobacco planting systems in China. However, the findings of M. arenaria on maize demonstrates that further investigation and management strategies should be conduct. To our knowledge, this is the first report of M. arenaria parasitizing maize in Guizhou province of China.

First Report of Northern Root-Knot Nematode Meloidogyne hapla on Atractylodes lancea in Hubei Province, China.

Atractylodes lancea (Thunb.) DC. is a well-known medicinal plant with high medicinal and economic value, and currently more than 6000 hectares are planted in China. Root-knot nematodes Meloidogyne hapla has been one of the most important pathogens on A. lancea. In September 2019, A. lancea plants exhibiting symptoms of severely stunting and gall formation in the roots associated with root-knot nematode (RKN; Meloidogyne spp.) were detected in a commercial production field in Yingshan, Hubei Province, China (30.96°N; 115.94° E). Females and second-stage juveniles (J2s) collected from roots had the following morphometric characteristics: females (n=20) were pear-shaped, the front part of the worm had a prominent neck, and the stylet was short and obvious. The perineal pattern of females were generally round hexagonal or round-shaped, with a squared-off dorsal arch or a rounded-off arch, some had lateral lines marked (Eisenback et al. 1980). Body length (L) = 750.49 ± 87.02 μm (578.75 - 902.65 μm), maximum body width (W) = 471.97 ± 70.95 μm (318.7 - 586.3 μm), stylet length = 15.18 ± 0.96 μm (13.52 - 17.04 μm), dorsal pharyngeal gland orifice to stylet base (DGO) = 3.07 ± 0.37 μm (2.60 - 3.80μm). The second-stage juveniles (n=20): L = 480.05 ± 42.73 μm (375.3 - 552.5 μm), stylet length =12.59 ± 1.39 μm (10.5 - 16.8 μm), tail length= 53.35 ± 1.55 μm (51.8 - 54.9 μm), hyaline tail terminus =11.45 ± 0.65 μm (10.2 - 12.1 μm). The morphological characteristics matched the original description of M. hapla (Chitwood 1949). Males were not found. Matrix code for the polytomous key proposed by Castillo (Castillo et al. 2021): Female: A23, B43, C213, D1 (A, Body length; B, Stylet length; C, The excretory pore position in the female in relation to the stylet length (EP/ST) ratio; D, Perineal pattern morphology); J2: A3, B3, C34, D324, E32, F3 (A, Body length; B, Stylet length; C, Tail length; D, Hyaline region length; E, The long tail length to the short tail length ratio; F, The long hyaline region length to the short hyaline region length ratio). The DNA, extracted from six single females, was used for species identification, and 28S rDNA D2/D3 universal primers D2A (5'ACAAGTACCGTGAGGGAAAGTTG3') and D3B (5'TCGGAAGGAACCAGCTACTA3') were used (Nunn 1992). The DNA fragment obtained showed that the amplified sequences of the D2/D3 region (GenBank Accession No. MZ 570969, 769bp) shared 100% homology with the sequences of M. hapla (MN752204.1, MN752204.1, MN752204.1). Furthermore, species-specific SCAR primers JMV1 (5'GGATGGCGTGCTTTCAAC3') and JMV hapla (5'AAAAATCCCCTCGAAAAATCCACC3') were used as described by Dong et al. (2015). PCR produced 442-bp sequences. Fragments were sequenced (GenBank Accession No. OM 864510, 442bp) and compared with available sequences on NCBI. Sequences were 99%-100% identical to the M. hapla sequences (GenBank Accession Nos. AJ421708.1, GQ130137.1 and AJ421707.1). To verify the nematode pathogenicity on A. lancea, ten RKN-free A. lancea seedlings were transplanted into plastic pots. After 21 days, the roots of eight plants were inoculated with 1,200 J2s and eggs of M. hapla that were the same isolate collected from the field per plant and two uninoculated plants were used as control. Plants were maintained in a greenhouse at 25°C and 70% relative humidity with a 12-h/12-h light/dark photoperiod. After 70 days, all inoculated plants exhibited stunting and had scarce galling on roots. This is similar to those fieldgrown plants. No galling or symptoms were observed on the control plants. The nematode reproduction factor (RF = final population/initial population) was 2.3. These results had confirmed that the root-knot nematode population on A. lancea was M. hapla. The rhizome yields and quality of the A. lancea infected by M. hapla were seriously affected, which caused severe economic losses. Moreover, the infected plants tended to be more susceptible to some bacterial and fungal diseases, such as root rot disease. To our knowledge, this is the first report of A. lancea as a new host of M. hapla in Hubei Province, China.

First Report of Meloidogyne arenaria on Cynanchum versicolor Bunge in China.

'Baiwei' (swallowwort root, Cynanchum versicolor Bunge), is a perennial cranberry type of Chinese medicinal herb, and grows in mountains with wide distribution in many provinces including Shandong, Henan, Hebei, Liaoning, Anhui and others. The functions of 'Baiwei' are strengthening myocardial contraction, detoxifying, and as a diuretic; thus it is one of very important herbs in China (Yunsi Su et al. 2021). With the increasing need for this herbal medicine in China, farmers are trying to cultivate the wild type of 'Baiwei'. In 2019, we found severe crop damage in a second-year planting of 'Baiwei' with many dead plants in a field (Fig. S1A, B) in Mengyin County of Shandong Province, China. Root galls were clearly seen in the roots and the typical root-knot nematode (Meloidogyne spp.) symptoms were observed (Fig. S1C). The previous crop was peanut. Peanut is widely planted in Shandong Province and peanut root-knot nematode (M. arenaria) is one of its major root-knot nematode pests. We suspected that the damage was caused by peanut root-knot nematode. The roots were taken to the lab and kept at 10℃ for morphological and molecular identification of root-knot nematodes, and pathogenicity testing. Twenty females were picked up from the infected roots for perineal pattern observation. The perineal pattern had distinct characteristics such as a low dorsal arch and lateral field marked by forked and broken striae and without punctate markings between the anus and tail terminus (Fig. S2A), which is similar to the description of M. arenaria (Eisenback et al., 1981). Eggs were extracted from roots and hatched to second-stage juveniles (J2s). The morphometric characters of J2s (n = 30) demonstrated body length = 437.35 ± SE 3.51 µm, body width = 16.74 ± 0.16 µm, stylet length = 11.31 ± 0.20 µm, DGO = 3.87 ± 0.07 µm, tail length = 53.32 ± 0.99 µm, and hyaline tail terminus = 11.14 ± 0.12 µm. The universal primer 194/195 (5.8S-18S rDNA TTAACTTGCCAGATCGGACG/TCTAATGAGCCGTACGC) for confirmation of Meloidogyne spp. was chosen and the sequence characterized amplified region (SCAR) PCR specific markers for M. incognita (Finc/Rinc GGGATGTGTAAATGCTCCTG/CCCGCTACACCCTCAACTTC), M. javanica (Fjav/Rjav ACGCTAGAATTCGACCCTGG/GGTACCAGAAGCAGCCATGC), M. enterolobii (Fent/Rent GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC), M. arenaria (Fare/Rare TCGGCGATAGAGGTAAATGAC/TCGGCGATAGACACTACAACT), M. hapla (Fhap/Rhap TGACGGCGGTGAGTGCGA/TGACGGCGGTACCTCATAG) and M. chitwoodi (Fchi/Rchi TGGAGAGCAGCAGGAGAAAGA/GGTCTGAGTGAGGACAAGAGTA) were utilized for species identification (Mao et al., 2019). PCR products of J2 amplification were run in the agar gel (Fig. S2B). A PCR product of 750 bp was obtained for 194/195 primer pair and a 420 bp band was identified for M. arenaria for all tested J2 samples. There were no bands for other specific primers. The amplicons from 194/195 and M. arenaria primer pairs were sequenced. A 100% identity of the Fare/Rare sequence (MZ522722.1) with M. arenaria KP234264.1 and a 99.8% identity with M. arenaria MW315990.1 were found through NCBI blast. A 100% identity of the 194/195 sequence (MZ555753.1) with both M. arenaria GQ395518.1 and U42342.1 and M. thailandica HF568829.1. To confirm the pathogenicity, 2000 J2s obtained from the same population as described above were used to inoculate each plant of one-month old 'Baiwei' seedlings (n = 5) and of one-month-old tomato cv. 'Zhongshu4' seedlings (n = 5) growing in 15-cm-diameter and 10-cm-height plastic pot containing sand and soil (2:1 ratio) in the glasshouse at 22-28℃ and 16/8 h day/night. Plants without J2s were used as control. Sixty days later, roots were stained with erioglaucine (Omwega et al. 1988) and an average of 107 ± SE 59 and 276 ± SE 31 egg masses per gram root were produced in each infected 'Baiwei' (Fig. S3A) and tomato (Fig. S3B) root, respectively. PCR amplification of the hatched J2s reconfirmed the reproduced nematode in 'Baiwei' and tomato was M. arenaria. This is the first report on M. arenaria parasitizing the medicinal herb C. versicolor in China.

First report of Meloidogyne hapla infecting Salvia miltiorrhiza in Shaanxi, China.

Salvia miltiorrhiza is a perennial herbaceous plant for traditional Chinese medicine. It has been extensively applied for many hundred years to treat various diseases (Su et al. 2015). It is also a kind of important cash crop that is widely cultivated in southern Shaanxi province. In June of 2021, in a field in Luonan County, Shaanxi Province, some S. miltiorrhiza plants with stunting and leaf wilting symptoms were observed. The diseased plants exhibited a large number of globular galling on the secondary and tertiary roots. The symptoms were typical of infection by root-knot nematodes. Population densities of second-stage juveniles (J2s) ranged from 330 to 650 per 100 cm3. To identify the species of the root-knot nematodes, J2s and males were collected from the soil in the root zone, and females were isolated from diseased roots. The perineal patterns of females (n = 12) were round-shaped, with low dorsal arches, obvious lateral lines, and characteristic small punctations near anus. Morphological measurements of females (n = 20) included body length (L) = 565.25 ± 33.9 (503.35 - 632.47) μm, body width (BW) = 420.00 ± 21.28 (378.27 - 452.51) μm, stylet = 11.11 ± 0.73 (10.05-12.29) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.69 ± 0.45 (3.82-5.32) μm, vulval slit length = 21.1 ± 1.33 (18.38-22.96) μm, and vulval slit to anus distance = 15.76 ± 1.24 (13.38-17.45) μm. The morphological characters of males (n = 7): L = 1098.14 ± 82.99 (962.83-1193.87) μm, BW = 28.44 ± 1.18 (26.59-29.83) μm, stylet = 18.27 ± 0.97 (16.57-19.28) μm, DGO = 4.89 ± 0.62 (3.82-5.68) μm, and spicule length = 24.04 ± 1.80 (21.30-26.71) μm. The key morphometrics of J2s: L = 380.24 ± 18.24 (354.43-423.13) μm, BW = 13.94 ± 0.70 (12.88-15.34) μm, stylet = 11.82 ± 0.49 (10.96-12.61) μm, DGO = 3.68 ± 0.42 (3.09-4.56) μm, tail length = 55.42 ± 5.81 (46.97-67.03) μm, and hyaline tail terminus = 13.79 ± 1.24 (12.0-16.51) μm. These morphological characteristics are consistent with Meloidogyne hapla as described by Whitehead (1968). Ten individual females were transferred to ten different tubes for DNA extraction. The DNA extraction followed the method described by Htay et al. (2016). The species-specific primers JMV1 (5'-GGATGGCGTGCTTTCAAC-3') and JMV (5'-AAAAATCCCCTCGAAAAATCCACC-3') were used for the identification of M. hapla (Adam et al. 2007). A single 440 bp fragment was amplified by this pair of primers, confirming their identities as M. hapla. To confirm species identification, the ITS region was amplified using the primers 18S/26S (5'-TTGATTACGTCCCTGCCCTTT-3'/5'-TTTCACTCGCCGTTACTAAGG-3') (Vrain et al. 1992). The sequence from the ITS region was 768 bp (GenBank Accession No. OM049198) and was 100% identical to the sequences of M. hapla (GenBank Accession Nos. MT249016 and KJ572385). The mitochondrial DNA (mtDNA) region between COII and the lRNA gene was amplified using primers C2F3 (5'-GGTCAATGTTCAGAAATTTGTGG-3') and 1108 (5'-TACCTTTGACCAATCACGCT-3') (Powers and Harris, 1993). A fragment of 529 bp was obtained and the sequence (GenBank Accession No. OM055828) was 100% identical to the known sequence of M. hapla from Taiwan (GenBank Accession No. KJ598134). An infection test was conducted in greenhouse conditions. Six 2-month-old S. miltiorrhiza plants were individually maintained in 12-cm diameter, 10-cm deep plastic pots containing sterilized soil and each plant was inoculated with 3000 J2s hatched from egg masses of collected M. hapla samples. Two non-inoculated S. miltiorrhiza plants served as negative controls. After 60 days, inoculated plants exhibited galled roots similar to those observed in the field. Many galls (61.33 ± 8.52) and egg masses (26.17 ± 4.79) were found on each root system. The nematode reproduction factor (RF = final population/initial population) was 4.5. No symptoms were observed in control plants. The nematode was reisolated from root tissue and identified to be M. hapla with its sequence-specific primers JMV1/JMV. These results confirmed that the nematode population could infect S. miltiorrhiza. To our knowledge, this is the first time of natural infection of S. miltiorrhiza with M. hapla in China. Including S. miltiorrhiza, the medicinal ingredients of many traditional Chinese herbal medicines were extracted from the roots of the plants. The infection of root-knot nematode will cause a serious decline in the quality of Chinese medicinal materials. Therefore, it is necessary to identify the species of root-knot nematode in different Chinese herbal medicines.

First Report of the Root-Knot Nematode Meloidogyne enterolobii infecting Acalypha australis in China.

Copperleaf (Acalypha australis; Euphorbiaceae), widely cultivated in China, is a traditional Chinese herbal medicine that is used for clearing heat and detoxifying, astringency and hemostasis (Zhang and Zhang 1994). In September 2021, wild Asian copperleaf plants showed leaf yellowing in a corner outside a greenhouse (22°50' N; 108°17' E), Guangxi Province, China. Galls and egg masses were observed on the plant roots on approximately 60% of plants. Females and second-stage juveniles (J2) were dissected and extracted from roots with galls. The perineal pattern of females was dorsal-ventrally oval with low and round dorsal arches, lacking clear lateral lines. Morphological measurements of females (n=20; mean ± standard error) were body length (BL) 697.7 ± 17.3 μm, maximum body width (BW) 521.5 ± 18.3 μm, stylet length 14.8 ± 0.3 μm, and dorsal pharyngeal gland orifice to stylet base (DGO) 5.1 ± 0.2μm. J2s (n = 20) were vermiform, had a slender tail, with a tapering to rounded tip with distinct hyaline region at the tail terminus and had the following morphological measurements: BL 475.5 ± 32.7 μm, BW 16.7 ± 0.6 μm, stylet length 14.4 ± 1.4 μm, DGO 3.9 ± 0.1 μm, hyaline tail length 18.0 ± 0.6 μm, and tail length 50.1 ± 1.2 μm. These morphological characteristics fit the description for Meloidogyne enterolobii (Yang and Eisenback 1983). In order to confirm species identification, genomic DNA was extracted from 12 single J2 (Luo et al. 2020). Species identity was further explored by the rDNA-internal transcribed spacer (ITS) region using primers V5367/26S (Vrain et al. 1992), and the D2-D3 fragment of the 28S ribosomal RNA gene using primers D2A/D3B (De Ley et al. 1999). The sequences for the target genes were 733 bp (GenBank accession no. OM168996) and 734 bp (GenBank accession no. OM177195), respectively. Homologies were 99 to 100% identical with those in GenBank for known sequences of M. enterolobii. Furthermore, species identification was confirmed using PCR to amplify a portion of the rDNA-IGS2 with M. enterolobii-specific primers Me-F/Me-R (Long et al. 2006). Koch's postulates was tested in a greenhouse at 25 to 28˚C temperature. Eggs were multiplied on tomato in the greenhouse using a single egg mass hand-picked from originally natural infected A. australis roots. Fifteen A. australis seedlings maintained in 14.5-cm diameter and 10-cm high pots containing autoclaved sandy soil (sand/soil = 3:1), one seedling/pot, inoculated with 5,000 eggs/plant, and five noninoculated seedlings were used as controls. After 60 days, all inoculated plants showed galling root symptoms and the control plants displayed no symptoms. The reproduction factor (Rutter et al. 2021) on A. australis was 4.3. Furthermore, the morphological and molecular characterization of the nematode was identical to the original samples. To our knowledge, this is the first report of M. enterolobii infecting Asian copperleaf that is cultivated in 29 provinces/regions of China. The growers should be aware of this nematode and take measures to avoid spread and serious economic losses.

First Report of Root-Knot Nematode, Meloidogyne incognita, Infecting Buckwheat, Fagopyrum esculentum, in State of São Paulo, Brazil.

Buckwheat (Fagopyrum esculentum Moench) belongs to the Polygonaceae family and has been widely cultivated due to its high nutritional, nutraceutical, and medicinal properties. Brazil ranks seventh-largest producer, with 66,000 tons produced in 2018. Buckwheat is also valued for its adaptability as a cover crop, in grain fields of soybean (Glycine max (L.) Merr., maize (Zea mays L.), and sorghum (Sorghum bicolor (L.) Moench) (Görgen et al. 2016, Babu et al. 2018) especially in fields highly infested with plant-parasitic nematodes (PPN). PPN cause severe root damage, suppressing plant development and yield production. In October 2018, six samples of roots and soil were collected in symptomatic patches of buckwheat, in Guaíra SP (20° 19' 32"S 48° 13' 15.4"W). Samples were analyzed in the Nematology Laboratory (LabNema), UNESP, Jaboticabal, SP, BR. Plants presented symptoms of yellow leaves and galled and volume-reduced roots. Meloidogyne sp. was found, comprising 6,320 eggs and second-stage juveniles (J2s) from 10 g of root and 1,628 J2s in 100 cm³ of soil. Adult morphological characteristics, isoenzyme phenotype of esterase, and molecular analysis were performed to identify the Meloidogyne species. The perineal patterns presented high and trapezoidal dorsal arch (n=15), and the males showed a trapezoidal labial region, including a high head cap formed by a large round labial disc that is raised above the medial lips and centrally concave (n=15) (Eisenback and Hirscmann 1981). These characteristics are typical in Meloidogyne incognita (Kofoid and White, 1912) Chitwood, 1949 (Nascimento et al., 2020; Eisenback and Hirschmann 1981; Netscher and Taylor 1974). The enzymatic phenotype was performed with females (n=8), and the phenotype I1 was verified, described by Esbenshade and Triantaphyllou (1985) as typical for M. incognita. To confirm the species DNA samples were extracted from individual females (n=6) and PCR with specific primers for M. incognita (Mi-F 5'- GTGAGGATTCAGCTCCCCAG-3' and Mi-R 5'-ACGAGGAA CATACTTCTCCGTCC-3') and M. javanica (Treub) Chitwood 1949 (Fjav 5'-GGTGCGCGATTGAACTGAGC-3' and Rjav 5'-CAG GCCCTTCAGTGGAACTATAC-3') that amplify SCAR markers described by Meng et al. (2004) and Zijlstra et al. (2000), respectively, and specific primers for M. enterolobii Yang & Eisenback 1983 that amplify rDNA-IGS2 region (Me-F 5'-AACTTTTG TGAAAGTGCCGCTG-3' and Me-R 5'-TCAGTTCAGGCAGG ATCAACC-3') described by Long et al. (2006) were tested. A fragment of 955 pb DNA size was amplified in Mi-F/R primer, which confirmed the M. incognita identification (Meng et. al., 2004). The original population was used to execute pathogenicity test. In a greenhouse, single buckwheat seeds (cv. IPR 91 Baili) were sown in six 5L pots filled with autoclaved-soil and inoculated with 3,000 eggs and J2s per pot (n=6) and control (n=6). After 60 days, the nematodes were extracted from roots and the M. incognita was confirmed. An average of 15,738 eggs and J2s were recovered, (reproductive factor = 5.24), which confirmed buckwheat as a host to M. incognita. The inoculated plants showed symptoms as those observed in the field. No symptom or nematode was noted on the control. Meloidogyne incognita has been reported causing high damage to the F. esculentum in California (Gardner and Caswell-Chen 1994) plus several crops in Brazil (Nascimento et al., 2020). However, this is the first report of this nematode infecting buckwheat in Brazil. Given the importance of buckwheat in Brazil, with extensive use as forage, cover crop, and its nutritional properties, this report is essential to specific management measures are adopted to avoid further losses.

Geometric morphometric analysis of morphological variation in Bogor and Solok populations of bony lip barb (Osteochilus vittatus)

Bony lip barb (Osteochilus vittatus) represents a freshwater species belonging to the Cyprinidae family, which is naturally widely distributed in Southeast Asia. In Indonesia, it is reported to occur widely in the inland waters of the main islands of Java, Sumatra, and Kalimantan. Geographic isolation may contribute to divergent evolution, resulting in phenotypic diversity. The present study used the geometric morphometric method to identify and describe morphological feature differences between geographically distant populations, namely Bogor (West Java) and Solok (West Sumatera). Seventy individual samples were collected from Bogor and Solok, respectively. Images of each sample were taken using a digital camera, then digitized on 17 landmark points using tpsdig software, followed by shape analysis using MorphoJ software. Results showed that Geometric Morphometric analysis could identify and distinguish the body shape of both populations. Morphologically, the Bogor population had a slender body shape, while the Solok population had a shorter and broader (stubby) body shape. A combination of landmark points forming the dorsal arch (LMs 2, 3, and 15), those forming the ventral curve (LMs 9-14), and those located in the peduncle area (LM15) contributed most to the body shape differences. Possible factors causing the observed phenomena are discussed.

Application of a Modified Dorsal Wiring Method in Toy Breed Dogs With Atlantoaxial Subluxation.

Atlantoaxial subluxation (AAS) is a congenital or traumatic condition that often requires surgical stabilization. Surgery is performed via a ventral or dorsal approach. A ventral approach is challenging in toy breed dogs due to their small-sized bones. Reducing AAS by orthopedic wire via a dorsal approach can cause iatrogenic spinal cord damage. Due to these limitations, a Kishigami atlantoaxial tension band (Kishigami AATB) that remains in the epidural space has been devised. Similar to the Kishigami AATB, the present study developed a modified dorsal wiring method and evaluated it in toy breed dogs with AAS. Medical data of toy breed dogs with AAS that underwent surgical stabilization using the modified dorsal wiring method from 2017 to 2020 were retrospectively reviewed. A total of 10 dogs were analyzed. Regarding the history of these dogs, six dogs had congenital AAS, and the remaining four dogs had traumatic AAS. Evaluation via computed tomography was available for five dogs, of which two dogs were identified as having incomplete ossification of their atlas. Although four dogs required a revision surgery because of recurrence of clinical signs or fracture of the atlas, final functional improvement was achieved in nine dogs. One dog showed worsened neurological status that led to death. Clinical results with the modified dorsal wiring method were similar to those with the Kishigami AATB. The modified dorsal wiring method is versatile as it could be applied to various shapes of dogs' atlas. Considering the shape of the atlas, it is recommended to apply the implant as far from the midline of the dorsal arch as possible to avoid fractures. With selection of suitable patients, this modified dorsal wiring method can be applied to dorsal stabilization of AAS in toy breed dogs.

NOT ALL THAT WHEEZES IS ASTHMA: A CASE OF KOMMERELL DIVERTICULUM

NOT ALL THAT WHEEZES IS ASTHMA: A CASE OF KOMMERELL DIVERTICULUM

First Report of Southern Root-Knot Nematode (Meloidogyne incognita) on Gynostemma pentaphyllum in China.

Gynostemma pentaphyllum, belonging to Cucurbitaceae, is a herbaceous climbing plant with multiple medicinal values (Li et al., 2019). It has been planted in Pingli County (109.35 E, 32.39 N), Ankang, Shaanxi province, China for a long history with more than 3000 ha per year. In April 2021, typical root-knot nematode disease symptoms, stunting and galled roots with massive egg masses, were observed on local G. pentaphyllum plants in several gardens. Meloidogyne females and egg masses were dissected from the infected roots. The female was spherical in body shape with a project neck; the excretory pore was at level of or posterior to stylet knobs, 10-20 annules behind head; the perineal pattern had a high dorsal arch, sometimes square or trapezoidal in shape, without obvious lateral lines. The male head was not offset with body, head cap was of stepped outline and concaved at center of top end in lateral view; stylet knobs were prominent, usually demarcated from shaft. Morphological measurements of females (n=20) were: body length (L)= 851.78 ± 83.55 µm (700.15 µm to 986.48 µm); maximum body width (W)= 633.11 ± 71.69 µm (453.09 µm to 746.31 µm); stylet length (ST)= 14.81 ± 0.69 µm (13.31 µm to 15.76 µm); stylet knob height (STKH)= 1.54 ± 0.09 µm (1.45 µm to 1.81 µm); stylet knob width (STKW)= 3.61 ± 0.11 µm (3.38 µm to 3.87 µm); and distance from dorsal esophageal gland opening to the stylet (DGO)= 3.56 ± 0.13 µm (3.28 µm to 4.90 µm). Measurements of males (n=20) were: L=1756.96 ± 67.81 µm (1643.58 µm to 1862.14 µm); W=55.37 ± 1.28 µm (53.46 µm to 57.66 µm); ST= 22.75 ± 1.05µm (19.14 µm to 24.88 µm); STKH= 2.59 ± 0.14 µm (2.45 µm to 2.72 µm); STKW= 3.66 ± 0.13 µm (3.27 µm to 3.91 µm); and DGO= 3.52 ± 0.18 µm (3.38 µm to 4.72 µm). Measurements of second-stage juveniles (J2) (n=20) were: L= 418.99 ± 22.04 µm (376.89 µm to 450.66 µm); W= 14.77 ± 1.15 µm (13.03 µm to 17.77 µm); ST= 12.84 ± 0.45µm (12.05 µm to 13.75 µm); STKH= 1.44 ± 0.13 µm (1.14 µm to 1.71 µm); STKW= 2.25 ± 0.23 µm (1.81 µm to 2.76 µm); and DGO= 1.81 ± 0.31 µm (0.38 µm to 2.56 µm). The morphological characteristics of this nematode were consistent with Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949 (Williams, 1973; Eisenback and Hirschmann, 1981). Identification was further confirmed with DNA extracted from 20 individual females. Part of the rDNA spanning internal transcribed spacer (ITS) 1, 5.8S gene, and ITS2 was amplified with the pair of primers: rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). A 768 bp fragment (GenBank Accession No. MZ613806) was obtained, showing 100% identical (768 bp to 768 bp) to the known sequences of M. incognita (GenBank Accession Nos. MH113856, KC464469, and MT921010). Species identification was also confirmed by amplifying part of the NADH dehydrogenase subunit 5 (nad5) from mitochondrial DNA with primers: NAD5-F/R (TATTTTTTGTTTGAGATATATTAG/CGTGAATCTTGATTTTCCATTTTT) (Janssen et al., 2016). The resulting 611 bp fragment was deposited in GenBank with Accession No. MZ613807. The fragment showed a highest identity of 99.67% (601 bp out of 611 bp) with sequences from other M. incognita isolates (GenBank Accession Nos. MW759707, MW759706, MW759705). Based on both morphological and molecular data, the root-knot nematode from G. pentaphyllum was identified as M. incognita. A pathogenicity test was carried out by inoculating 1500 J2 hatched from the egg masses dissected from the diseased roots to a 4-weeks-old healthy G. pentaphyllum seedling cultured in sterilized sandy soil in pot, 15 plants were inoculated and 5 non-inoculated plants served as controls. After maintained at 25°C for 6 weeks, all of the inoculated plant roots showed galling symptoms which were similar to those observed in the field. Nematodes were collected from root and soil, and an average reproduction factor value of 3.51 was obtained. While no galls were observed on the control plants. For further confirmation, all egg masses dissected from inoculated plants were identified to be M. incognita with its sequence specific primers Mi-F/Mi-R (GGGCAAGTAAGGATGCTCTGAC/CTTTCATAGCCACGTCGCGATC) (Ray et al., 1994). In this study, G. pentaphyllum has been identified as a new host of M. incognita, hence the occurrence status and control of root-knot disease on G. pentaphyllum caused by this pathogen would be new problems in production and need further study.

First Report of Meloidogyne enterolobii Infecting Ixora chinensis in China.

Ixora chinensis is a common flowering ornamental shrub native to China and parts of south east Asia. It has been introduced to tropical and subtropical regions of the world. In August 2021, the lab received heavily galled roots of the cutting plants from Lishui Town（23°17'1.8564"S，113°5'34.89"W), Guangdong Province, China for disease diagnosis purpose. The roots of the plants presented galls similar to those associated with root-knot nematodes (RKN), Meloidogyne spp. Upon inspection, there were one to several females of RKN in each gall, and the egg masses were often completely embedded within the gall. Males were found in the galls. Symptoms included severely reduced growth of the plants coupled with leaf yellowing. Morphological and molecular analyses were conducted to identify the species present. Females and egg masses were collected from the roots, and egg mass was incubated in water at 25°C to obtain J2. Morphological measurements from 20 second-stage juveniles and perineal patterns from 20 adult females matched the original description (Yang and Eisenback 1983). The perineal patterns were round to oval with fine and dense stripes, the dorsal arches were moderately high to high, and mostly lacking lateral lines, but when present, the lines were not conspicuous. Measurements of J2s included stylet = 13.2 ± 0.5 µm (12.4 to 14.0 µm), DGO= 51.8 ± 3.0 µm (47.0 to 56.8 µm), tail = 51.8 ± 3.0 µm (47.0 to 56.8 µm), and hyaline tail terminus = 16.0 ± 2.0 µm (11.3 to 17.7 µm). Amplification and sequencing of the rDNA-internal transcribed spacer (ITS1_5.8S_ITS2) region with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/ TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992) and the D2-D3 region of the 28S rDNA with primers D2A/D3B (ACAAGTACCGTG AGGGAAAGT/TCGGAAGGAACCAGCTACTA) (Subbotin et al. 2006) was accomplished, respectively. A DNA fragment of 765 bp in length for the ITS region was obtained and the sequences (GenBank Accession Nos.OL444880-OL444882) were compared with those in GenBank using BLAST and showed 99.16%-99.87% identity with known sequences of M. enterolobii from China (MK850138, MK850135 and MT406251). The D2-D3 region sequence of the 28S rRNA (GenBank Accession Nos.OL455021-OL455023) were 99.21%-100% identical to M. enterolobill sequences obtained from China (MN017115，MN017118 and MT193450). Identification was also further confirmed by using PCR by a species-specific primer set Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) (Long et al. 2006). For pathogenicity tests, a single seedling (12-15 cm) from stem cutting of I. chinensis was maintained in 16-cm diameter pots with sterilized sandy loam. Six replicates were inoculated with 5000 freshly hatched J2s of the original population, and another six replicates without inoculation were established as control plants. The plants were maintained in a glasshouse at temperatures ranging from 25 to 30°C and relative humidity from 65 to 80%. After 60 days, all plants inoculated were stunted and yellowing, galling symptoms on root tips and secondary feeder root were similar to plants observed in the field, and the females and egg masses were obtained by dissecting gallsnematode. No gall symptoms were observed on control plants. These results confirmed the nematodes' pathogenicity. M. enterolobii is considered as one of the most damaging species of RKN, due to its wide host range, pathogenicity and ability to develop and reproduce on several crops carrying resistance genes (Castagnone-Sereno, 2012). To our knowledge, this is the first report of infection of M. enterolobii on I. chinensis. As cuttings are generally used for the propagation of I. chinensis, the spread of this nematode through infested soil and infected cutting seedling of I. chinensis is favored. Considering the increasing importance of the nematode in China, this report is essential for control measures of the nematode to be taken in order to avoid its spread to other regions or host crops.