Crowding Conditions Research Articles

Effect of Larval Density on Food Utilization Efficiency of Tenebrio molitor (Coleoptera: Tenebrionidae).

Crowding conditions of larvae may have a significant impact on commercial production efficiency of some insects, such as Tenebrio molitor L. (Coleoptera: Tenebrionidae). Although larval densities are known to affect developmental time and growth in T. molitor, no reports were found on the effects of crowding on food utilization. The effect of larval density on food utilization efficiency of T. molitor larvae was studied by measuring efficiency of ingested food conversion (ECI), efficiency of digested food conversion (EDC), and mg of larval weight gain per gram of food consumed (LWGpFC) at increasing larval densities (12, 24, 36, 48, 50, 62, 74, and 96 larvae per dm(2)) over four consecutive 3-wk periods. Individual larval weight gain and food consumption were negatively impacted by larval density. Similarly, ECI, ECD, and LWGpFC were negatively impacted by larval density. Larval ageing, measured as four consecutive 3-wk periods, significantly and independently impacted ECI, ECD, and LWGpFC in a negative way. General linear model analysis showed that age had a higher impact than density on food utilization parameters of T. molitor larvae. Larval growth was determined to be responsible for the age effects, as measurements of larval mass density (in grams of larvae per dm(2)) had a significant impact on food utilization parameters across ages and density treatments (in number of larvae per dm(2)). The importance of mass versus numbers per unit of area as measurements of larval density and the implications of negative effects of density on food utilization for insect biomass production are discussed.

Crowding is proportional to visual acuity in young and aging eyes.

Spatial crowding decreases object recognition and conscious visual perception in clutter. In a previous study we used brief presentation times to reveal the effects of a crowded presentation in the fovea. Here we aimed to test the relationships between varying visual acuity (VA) and crowding in the fovea, under the assumption that in uncorrected presbyopia, the processing is relatively normal, whereas the retinal input is blurred. We tested whether normal participants whose near VA is gradually reduced due to age-related deterioration (presbyopia, or "aging eye") will show an acuity-dependent increase in foveal crowding. We used brief presentations and acuity-threshold letter targets in order to magnify the crowding-effect amplitude in the fovea. A total of 195 participants with an age range of 20-68 years and an average of 44.3 ± 11.7 years (M ± SD) were divided into four age groups, all without any optical correction for the near distance. Our findings show that crowding is proportional to VA. This proportionality is affected by VA-age dependency, with a nonlinear S-shaped pattern: A steep VA reduction begins to develop, which is compatible with the normal onset age of presbyopia symptoms and a saturation in the VA-age dependency in the oldest age group, for which we propose a VA-eccentricity account. Finally, there is a high variance in the crowding amplitude in the young, even before the onset age of presbyopia symptoms, suggesting crowding conditions with limited presentation times as a highly sensitive measure of VA, which predicts visual performance in complex tasks, such as reading.

Implications of macromolecular crowding and reducing conditions for in vitro ribosome construction.

In vitro construction of Escherichia coli ribosomes could elucidate a deeper understanding of these complex molecular machines and make possible the production of synthetic variants with new functions. Toward this goal, we recently developed an integrated synthesis, assembly and translation (iSAT) system that allows for co-activation of ribosomal RNA (rRNA) transcription and ribosome assembly, mRNA transcription and protein translation without intact cells. Here, we discovered that macromolecular crowding and reducing agents increase overall iSAT protein synthesis; the combination of 6% w/v Ficoll 400 and 2 mM DTBA yielded approximately a five-fold increase in overall iSAT protein synthesis activity. By utilizing a fluorescent RNA aptamer, fluorescent reporter proteins and ribosome sedimentation analysis, we showed that crowding agents increase iSAT yields by enhancing translation while reducing agents increase rRNA transcription and ribosome assembly. Finally, we showed that iSAT ribosomes possess ∼70% of the protein synthesis activity of in vivo-assembled E. coli ribosomes. This work improves iSAT protein synthesis through the addition of crowding and reducing agents, provides a thorough understanding of the effect of these additives within the iSAT system and demonstrates how iSAT allows for manipulation and analysis of ribosome biogenesis in the context of an in vitro transcription-translation system.

Divalent cations and molecular crowding buffers stabilize G-triplex at physiologically relevant temperatures.

G-triplexes are non-canonical DNA structures formed by G-rich sequences with three G-tracts. Putative G-triplex-forming sequences are expected to be more prevalent than putative G-quadruplex-forming sequences. However, the research on G-triplexes is rare. In this work, the effects of molecular crowding and several physiologically important metal ions on the formation and stability of G-triplexes were examined using a combination of circular dichroism, thermodynamics, optical tweezers and calorimetry techniques. We determined that molecular crowding conditions and cations, such as Na+, K+, Mg2+ and Ca2+, promote the formation of G-triplexes and stabilize these structures. Of these four metal cations, Ca2+ has the strongest stabilizing effect, followed by K+, Mg2+, and Na+ in a decreasing order. The binding of K+ to G-triplexes is accompanied by exothermic heats, and the binding of Ca2+ with G-triplexes is characterized by endothermic heats. G-triplexes formed from two G-triad layers are not stable at physiological temperatures; however, G-triplexes formed from three G-triads exhibit melting temperatures higher than 37°C, especially under the molecular crowding conditions and in the presence of K+ or Ca2+. These observations imply that stable G-triplexes may be formed under physiological conditions.

Effects of osmolytes on protein-solvent interactions in crowded environment: Analyzing the effect of TMAO on proteins in crowded solutions

We analyzed the effect of a natural osmolyte, trimethylamine N-oxide (TMAO), on structural properties and conformational stabilities of several proteins under macromolecular crowding conditions by a set of biophysical techniques. We also used the solvent interaction analysis method to look at the peculiarities of the TMAO-protein interactions under crowded conditions. To this end, we analyzed the partitioning of these proteins in TMAO-free and TMAO-containing aqueous two-phase systems (ATPSs). These ATPSs had the same polymer composition of 6.0wt.% PEG-8000 and 12.0wt.% dextran-75, and same ionic composition of 0.01M K/NaPB, pH 7.4. These analyses revealed that there is no direct interaction of TMAO with proteins, suggesting that the TMAO effects on the protein structure in crowded solutions occur via the effects of this osmolyte on solvent properties of aqueous media. The effects of TMAO on protein structure in the presence of polymers were rather complex and protein-specific. Curiously, our study revealed that in highly concentrated polymer solutions, TMAO does not always act to promote further protein folding.

Effect of Ca2+ and Mg2+ ions on oligomeric state and chaperone-like activity of αB-crystallin in crowded media

The main function of small heat shock proteins acting as suppressors of aggregation of non-native proteins is greatly influenced by crowded environment in the cell and the presence of divalent metal ions. The goal of the present work was to study the effects of Ca2+ and Mg2+ ions on the quaternary structure and anti-aggregation activity of αB-crystallin under crowding conditions. We showed that Ca2+ and Mg2+ ions induced formation of suboligomeric forms of αB-crystallin. This effect was retained in the presence of crowder (polyethylene glycol), although to a lesser degree. The chaperone-like activity of αB-crystallin was analyzed using heat-induced aggregation of myosin subfragment 1 (S1) at 40°C. In the absence of crowding agents chaperone-like activity of αB-crystallin exhibited low sensitivity to the presence of Ca2+ and Mg2+ ions. The addition of the crowding agents (polyethylene glycol 20000, Ficoll 70) dramatically increased S1 aggregation rates and significantly depressed anti-aggregation activity of αB-crystallin. Low concentrations of Ca2+ (0.1mM) and Mg2+ (10mM) partially restored the chaperone-like activity of αB-crystallin in the presence of crowders. This effect was observed at relatively low values of [αB-crystallin]/[S1] molar ratio, however, at [αB-crystallin]/[S1]>0.2 the stimulating effect of Ca2+ became less pronounced. These findings might indicate that under crowded cell conditions different factors, including divalent cations, can effectively modulate chaperone-like activity of protein chaperones, which otherwise cannot properly cope with crowding-provoked accelerated rates of substrates aggregation.

Mass gathering and globalization of respiratory pathogens during the 2013 Hajj

Every year, more than 10 million pilgrims arrive in the Kingdom of Saudi Arabia for the Hajj or Umrah. Crowding conditions lead to high rates of respiratory infections among the pilgrims, representing a significant cause of morbidity and a major cause of hospitalization. Pre- and post-Hajj nasal specimens were prospectively obtained from a paired cohort (692 pilgrims) and from nonpaired cohorts (514 arriving and 470 departing pilgrims) from 13 countries. The countries of residence included Africa (44.2%), Asia (40.2%), the United States (8.4%) and Europe (7.2%). Nasal specimens were tested for 34 respiratory pathogens using RT-PCR. A total of 80 512 PCRs were performed. The prevalence of viruses and bacteria increased, from 7.4% and 15.4% before the Hajj to 45.4% and 31.0% after the Hajj, respectively, due to the acquisition of rhinovirus, coronaviruses (229E, HKU1, OC43), influenza A H1N1, Streptococcus pneumoniae, Haemophilus influenzae and Staphylococcus aureus. We did not identify Middle East respiratory coronavirus carriage. At arrival, the prevalence of several viruses was clearly dependent on the pilgrim's country of origin. After Hajj participation, these viruses were isolated among pilgrims from all countries, with few exceptions. No significant differences were observed between paired and nonpaired cohort results. Our results strongly suggest that, given the particularly crowded conditions during the rituals, an international mass gathering such as the Hajj may contribute to the globalization of respiratory pathogens after the cross-contamination of pilgrims harbouring pathogens that easily spread among participants. Influenza and pneumococcal vaccination, face mask use and hand hygiene should be considered in the context of the Hajj.

Paramètres socio-spatiaux, réseaux sociaux et budget d'activité chez un groupe de mâles chimpanzés : stabilité dans le temps et effet de la réduction spatiale

Within chimpanzee communities, males are well known for forming strong social bonds with one another. These bonds are most evident in the non-random patterns of associations, affiliations and proximity exhibited by males. In captivity, crowding conditions, demographic changes and other factors such as individuals’ maturity can modify social relationships, the type of interactions and also the way individuals manage conflicts. We believe that the combined study of grouping patterns, social networks, and activity budgets can provide a deeper understanding of the processes that drive behavioral changes under different conditions. With this in mind, we studied a group of male chimpanzees housed at La Vallee des Singes in France under two housing conditions, indoors (spatial crowding condition) and outdoors; and at two different time-points, in 2007 and 2009. In this period, the two most significant demographic changes were that most individuals reached maturity and that a chimpanzee died. We studied their grouping patterns (i.e. sociality, closeness and gregariousness), their social network and their activity budgets to examine how different changes of diverse nature affected their social structure and their interactions. Compared to outdoors, in the indoor condition, individuals stayed closer and were more sociable and gregarious. They also affiliated and aggressed more often indoor than outdoors. Their social network also varied, being the diameter smaller and the density higher indoors than outdoors. After analyzing the stability across time no differences were found in sociality, closeness and gregariousness but we observed an increase in self-directed behaviors from 2007 to 2009. Their social network varied, decreasing its diameter and increasing its density from 2007 to 2009. Our data would be in agreement with a coping model for conflict management since the chimpanzees altered their behavior by increasing affiliative behaviors and reducing proximity distances under spatial crowding conditions. Across time, changes in maturity and the death of a member did not affect proximity patterns in this colony. The mentioned increase of self-directed behaviors is usually interpreted as an index of stress; however, our data, as agonism and other measures remained stable from 2007 to 2009, should be interpreted with caution. Together with grouping patterns and activity budgets, the analysis of social networks allowed a better understanding of the variation in the social structure of this group. Partly funded by project grant SFRH/BD/69069/2010 to NAV and PSI2011-29016-C02-01 to FC.

Effects of Crowding and Attention on High-Levels of Motion Processing and Motion Adaptation

The motion after-effect (MAE) persists in crowding conditions, i.e., when the adaptation direction cannot be reliably perceived. The MAE originating from complex moving patterns spreads into non-adapted sectors of a multi-sector adapting display (i.e., phantom MAE). In the present study we used global rotating patterns to measure the strength of the conventional and phantom MAEs in crowded and non-crowded conditions, and when attention was directed to the adapting stimulus and when it was diverted away from the adapting stimulus. The results show that: (i) the phantom MAE is weaker than the conventional MAE, for both non-crowded and crowded conditions, and when attention was focused on the adapting stimulus and when it was diverted from it, (ii) conventional and phantom MAEs in the crowded condition are weaker than in the non-crowded condition. Analysis conducted to assess the effect of crowding on high-level of motion adaptation suggests that crowding is likely to affect the awareness of the adapting stimulus rather than degrading its sensory representation, (iii) for high-level of motion processing the attentional manipulation does not affect the strength of either conventional or phantom MAEs, neither in the non-crowded nor in the crowded conditions. These results suggest that high-level MAEs do not depend on attention and that at high-level of motion adaptation the effects of crowding are not modulated by attention.

Role of the osmolyte taurine on the folding of a model protein, hen egg white lysozyme, under a crowding condition.

Taurine is one of the osmolytes that maintain the structure of proteins in cells exposed to denaturing environmental stressors. Recently, cryoelectron tomographic analysis of eukaryotic cells has revealed that their cytoplasms are crowded with proteins. Such crowding conditions would be expected to hinder the efficient folding of nascent polypeptide chains. Therefore, we examined the role of taurine on the folding of denatured and reduced lysozyme, as a model protein, under a crowding condition. The results confirmed that taurine had a better effect on protein folding than did β-alanine, which has a similar chemical structure, when the protein to be folded was present at submillimolar concentration. NMR analyses further revealed that under the crowding condition, taurine had more interactions than did β-alanine with the lysozyme molecule in both the folded and denatured states. We concluded that taurine improves the folding of the reduced lysozyme at submillimolar concentration to allow it to interact more favorably with the lysozyme molecule. Thus, the role of taurine, as an osmolyte in vivo, may be to assist in the efficient folding of proteins.

Macromolecular crowding conditions enhance glycation and oxidation of whey proteins in ultrasound-induced Maillard reaction

High intensity ultrasound (HIUS) can promote Maillard reaction (MR). Macromolecular crowding conditions accelerate reactions and stabilise protein structure. The aim of this study was to investigate if combined application of ultrasound and macromolecular crowding can improve efficiency of MR. The presence of crowding agent (polyethylene glycol) significantly increased ultrasound-induced whey protein (WP) glycation by arabinose. An increase in glycation efficiency results only in slight change of WP structure. Macromolecular crowding intensifies oxidative modifications of WP, as well as formation of amyloid-like structures by enhancement of MR. Solubility at different pH, thermal stability and antioxidative capacity of glycated WP were increased, especially in the presence of crowding agent, compared to sonicated nonglycated proteins. The application of HIUS under crowding conditions can be a new approach for enhancement of reactions in general, enabling short processing time and mild conditions, while preserving protein structure and minimising protein aggregation.

Study on Indoor Air Movement under the Crowding Conditions by Numerical Simulations and PIV Small-scale Experiments

In the mechanical ventilation room, human body will block the air flows and change the original airflow organization. In the crowd places, the influence of the crowd may greatly change the indoor air movement and even worsen the environment. So the effect can not be ignored. The paper studied the influence of the human body to the indoor air movement by using the method of Particle Image Velocimetry (PIV) and numerical simulation (CFD). The PIV experiment and numerical simulation contain two conditions. One condition is an empty room and another contains models of human body in the room. The paper compared the result of experiment and numerical simulation. Numerical simulations are demonstrated to be accurate in the two conditions, and the Standard k-ɛ model most accurately predicts the flow in a room contains crowd model. In this study, the numerical simulation and measurements show that the crowds will greatly change the air distribution and the residence time of the flows in the building. Therefore, it is important that crowds be considered in ventilation design.

Effects of Molecular Crowding on the Binding Affinity of Dihydrofolate for Dihydrofolate Reductase

The reduction of dihydrofolate (DHF) to tetrahydrofolate (THF) by the enzyme dihydrofolate reductase (DHFR), using NADPH as a cofactor, is an essential part of the folate cycle. The inhibition of DHFR leads to interruption of DNA synthesis and consequently cell death, making this enzyme a crucial target in the treatment of cancer and other diseases. Previous studies examined the effects of small molecule osmolytes on the substrate interactions with two non-homologous DHFRs, E. coli chromosomal DHFR (EcDHFR) and R67 DHFR, with vastly different active site structures. The results indicated that DHF weakly interacts with the osmolytes in solution, shifting the binding equilibrium from DHF bound to DHFR to unbound DHF. It is hypothesized that similar weak, nonspecific interactions may also occur between cellular proteins and DHF. Weak interactions between cellular proteins and DHF would have consequences in vivo, where the concentration of the cellular milieu is approximately 300 g/L. Under the crowded conditions in the cell, there is a higher propensity for intermolecular interaction.Crowding effects of macromolecules in concentrations similar to those in vivo were examined. Isothermal titration calorimetry (ITC) and enzyme kinetic assays were used to detect effects of molecular crowders by monitoring activity of the (DHFR)-NADPH or DHF complex and the ternary DHFR-DHF-NADPH complex in the presence of these crowders. To recreate the conditions of molecular crowding in vivo, the binding of the enzyme-ligand complexes in the presence of molecular weight crowding agents (lysozyme or casein) was examined. Analysis of the Kd's and Km's indicated a correlation between increased molecular crowding in the solution and weakened binding of the DHFR-substrate complexes. These findings indicate an importance of molecular crowding on EcDHFR activity in vivo.

Determinants of Self Aggregation of H-Tel

Guanine rich oligodeoxyribonucleotides (ODNs) can form non-canonical DNA structures known as G-quadruplexes. These are four stranded structures stabilized by monovalent sodium and potassium cations. The topologies of folded G-quadruplexes are highly polymorphic. H-Tel, an ODN with four consecutive repeats of the human telomeric sequence, [d(AGGGTTAGGGTTAGGGTTAGGG)], can assume different monomolecular G-quadruplex topologies depending on the type of cation present in solution. In vivo a large portion of cellular volume is occupied by macromolecules; which can also affect the topology adopted by folded H-Tel. At high concentrations the DNA itself can also contribute to the crowding conditions, which may be relevant to the behaviour of DNA in the cell. Our previous work demonstrated that at high concentrations of the guanine rich sequences, the monomolecular G-quadruplexes formed by H-Tel self-associate to form higher order structures. Such aggregates display a circular dichroism spectrum similar to that of an all-parallel structure. We are investigating the energetics and mechanism of the interaction between the individual folded H-Tel monomers. Using H-Tel and H-Tel derivative ODNs with modified loop sequences, we are studying the contributions of the loops interactions to the self-association of monomolecular G-quadru-plexes folded by H-Tel. The structural change from a G-quadruplex monomer to an aggregate is studied as a function of time and ODN concentrations. Specifically, we used circular dichroism spectroscopy (CD), UV spectroscopy, and gel electrophoresis to study the thermodynamics and kinetics of the folding and self-aggregation of these ODNs. We are also studying the energetics of the folding of the cytosine-rich complementary strand with the same methods. The thermodynamics of the concomitant folding of the G-rich and C-rich strands may play a role in the behaviour of these sequences in the cell.

Epigenetics and Other Factors that Affect Folding and Stability of DNA I-Motif Structures

The four-stranded i-motif (iM) conformation of cytosine-rich DNA has importance to a wide variety of biochemical systems that range from their use in nanomaterials to potential roles in oncogene regulation. The iM structure is formed at slightly acidic pH, where hemi-protonation of cytosine results in a stable C-C+ base pair. Fundamental studies to understand iM formation from C-rich strands of DNA are described. We present a systematic characterization of the consequences of epigenetic modifications, molecular crowding, degree of hydration, and DNA sequence on the stabilities of iM-forming sequences. We used a number of biophysical techniques to characterize both the folded iM and the folding kinetics of an iM. We established a mechanism for the folding. We observed that the C-C+ hydrogen bonding of certain bases initiates the folding of the iM structure. We also observed that substitutions in the loop regions of iMs give a distinctly different kinetic signature during folding as compared to those bases that are intercalated. Our data reveal that the iM passes through a distinct intermediate form between the unfolded and folded form. In the course of determining this folding pathway, we established that the fluorescent dC analogs tC° and PdC can be used to monitor individual residues of an iM structure and can be used to determine the pKa of an iM. Our results indicate that 5-hydroxymethylation of cytosine destabilized the iMs against thermal and pH-dependent melting, while 5-methylcytosine modification stabilized the iMs. Under molecular crowding conditions, the thermal stability of iMs increased and the pKa was raised to near 7.0. Taken together, our work has laid the foundation for examining folding and structural changes in more complex iMs.

DNA structures under molecular crowding conditions with a phosphorylcholine derivative (MPC)

DNA structures under molecular crowding conditions with a phosphorylcholine derivative (MPC)

Quaternary structure of human small heat shock protein HSPB6 (Hsp20) in crowded media modeled by trimethylamine N-oxide (TMAO): Effect of protein phosphorylation.

Effect of trimethylamine N-oxide (TMAO), well-known osmolyte, widely used to imitate crowded intracellular conditions, on the quaternary structure of recombinant human small heat shock protein HspB6 (Hsp20) was analyzed by means of size-exclusion chromatography, chemical crosslinking and analytical ultracentrifugation. Consistent with previous reports, in the absence of TMAO unphosphorylated, pseudophosphorylated (S16D mutant) and phosphorylated HspB6 form only small oligomers (presumably dimers). Addition of TMAO to unphosphorylated HspB6 leads to formation of different large oligomers being in equilibrium with dimers. Pseudophosphorylation (S16D mutation) or phosphorylation partially or completely prevent TMAO-induced oligomerization of HspB6. Pseudophosphorylation affects bis-ANS binding suggesting decreased hydrophobicity of HspB6. According to size-exclusion chromatography, TMAO-induced changes of HspB6 oligomerization result in its altered interaction with HspB1 and this effect can be reversed by HspB6 phosphorylation. It is concluded that under conditions of molecular crowding, characteristic for intracellular environment, HspB6 undergoes reversible changes of its oligomeric state which can affect its physiologically important properties and can be delicately regulated by phosphorylation.

Molecular Crowding Facilitates Double-duplex Invasion of Pseudo-complementary Peptide Nucleic Acid in High-salt Medium

Abstract It has been shown that molecular crowding conditions greatly promote the invasion of a pair of pseudo-complementary peptide nucleic acid (pcPNA) to double-stranded DNA. Under molecular crowding conditions, double-duplex invasion complexes are spontaneously formed at 37 °C even in high-salt media, where the invasion otherwise never occurs. Strong potential of the pcPNA invasion for various intracellular applications is indicated.

Enhancement of enantioselectivity in chiral capillary electrophoresis using hydroxypropyl-beta-cyclodextrin as chiral selector under molecular crowding conditions induced by dextran or dextrin.

Molecular crowding is a new approach to enhance the retention properties and selectivity of molecularly imprinted polymers. In this work, this concept was first applied to chiral CE to enhance its enantioselectivity. A model system, enantioseparation of salbutamol using hydroxypropyl-beta-cyclodextrin as chiral selector in the presence of dextran or dextrin as crowding-inducing agents, was chosen to demonstrate its potency. Some parameters, especially the concentration of crowding-inducing agents and cyclodextrins were investigated intensively. Moreover, based on fluorescence spectroscopy and affinity CE, it was found that the presence of crowding-inducing agents could promote the association of enantiomers with cyclodextrins and intensify the interacting differences of two enantiomers with cyclodextrins. As a result, the essential concentration of cyclodextrins to make the enantiomers reach baseline separation was significantly decreased with the aid of molecular crowding. This study shows that molecular crowding is an effective strategy to enhance the enantioselectivity of cyclodextrin in chiral CE.

Disordered Cold Regulated15 Proteins Protect Chloroplast Membranes during Freezing through Binding and Folding, But Do Not Stabilize Chloroplast Enzymes in Vivo

Freezing can severely damage plants, limiting geographical distribution of natural populations and leading to major agronomical losses. Plants native to cold climates acquire increased freezing tolerance during exposure to low nonfreezing temperatures in a process termed cold acclimation. This involves many adaptative responses, including global changes in metabolite content and gene expression, and the accumulation of cold-regulated (COR) proteins, whose functions are largely unknown. Here we report that the chloroplast proteins COR15A and COR15B are necessary for full cold acclimation in Arabidopsis (Arabidopsis thaliana). They protect cell membranes, as indicated by electrolyte leakage and chlorophyll fluorescence measurements. Recombinant COR15 proteins stabilize lactate dehydrogenase during freezing in vitro. However, a transgenic approach shows that they have no influence on the stability of selected plastidic enzymes in vivo, although cold acclimation results in increased enzyme stability. This indicates that enzymes are stabilized by other mechanisms. Recombinant COR15 proteins are disordered in water, but fold into amphipathic α-helices at high osmolyte concentrations in the presence of membranes, a condition mimicking molecular crowding induced by dehydration during freezing. X-ray scattering experiments indicate protein-membrane interactions specifically under such crowding conditions. The COR15-membrane interactions lead to liposome stabilization during freezing. Collectively, our data demonstrate the requirement for COR15 accumulation for full cold acclimation of Arabidopsis. The function of these intrinsically disordered proteins is the stabilization of chloroplast membranes during freezing through a folding and binding mechanism, but not the stabilization of chloroplastic enzymes. This indicates a high functional specificity of these disordered plant proteins.