Determinants of Self Aggregation of H-Tel

Abstract

Guanine rich oligodeoxyribonucleotides (ODNs) can form non-canonical DNA structures known as G-quadruplexes. These are four stranded structures stabilized by monovalent sodium and potassium cations. The topologies of folded G-quadruplexes are highly polymorphic. H-Tel, an ODN with four consecutive repeats of the human telomeric sequence, [d(AGGGTTAGGGTTAGGGTTAGGG)], can assume different monomolecular G-quadruplex topologies depending on the type of cation present in solution. In vivo a large portion of cellular volume is occupied by macromolecules; which can also affect the topology adopted by folded H-Tel. At high concentrations the DNA itself can also contribute to the crowding conditions, which may be relevant to the behaviour of DNA in the cell. Our previous work demonstrated that at high concentrations of the guanine rich sequences, the monomolecular G-quadruplexes formed by H-Tel self-associate to form higher order structures. Such aggregates display a circular dichroism spectrum similar to that of an all-parallel structure. We are investigating the energetics and mechanism of the interaction between the individual folded H-Tel monomers. Using H-Tel and H-Tel derivative ODNs with modified loop sequences, we are studying the contributions of the loops interactions to the self-association of monomolecular G-quadru-plexes folded by H-Tel. The structural change from a G-quadruplex monomer to an aggregate is studied as a function of time and ODN concentrations. Specifically, we used circular dichroism spectroscopy (CD), UV spectroscopy, and gel electrophoresis to study the thermodynamics and kinetics of the folding and self-aggregation of these ODNs. We are also studying the energetics of the folding of the cytosine-rich complementary strand with the same methods. The thermodynamics of the concomitant folding of the G-rich and C-rich strands may play a role in the behaviour of these sequences in the cell.