Thermodynamics of the G-Quadruplex Formation of Modified Human Telomeric Sequences

Abstract

Oligodeoxyribonucleotides (ODNs) that are rich in guanine can form four stranded structures known as G-quadruplexes. These structures are stabilized by monovalent cations sodium (Na+) and potassium (K+). The structure of G-quadruplexes can be highly polymorphic. H-Tel, an ODN with four consecutive repeats of the human telomeric sequence, [d(TTAGGGTTAGGGTTAGGGTTAGGG)], can assume different monomolecular G-quadruplex topologies depending on the type of cation present in solution. The loop sequences between the guanine repeats can also affect the conformation of the G-quadruplex formed. The biological relevance of these investigations arises from the implication of G-rich sequences in diseases so that G-quadruplexes may be drug targets in cancer and other diseases. Our lab has shown that at high concentrations, folded H-Tel self-associates to form multi-molecular species. Using H-Tel and H-Tel derivatives, we are studying the characteristics of G-quadruplexes they form and the conditions under which the folded species self-associate. The structure and energetic properties are studied as functions of the type of cation, the concentration of the cation, and the sequence of the bases in the loops between the tetrad-forming guanines. Our studies use circular dichroism spectroscopy (CD), UV spectroscopy, differential scanning calorimetry (DSC), and gel electrophoresis.