Pest Of Citrus Research Articles

IDENTIFICATION OF CITRUS WHITEFLY, HOST OF ENTOMOPATHOGENIC FUNGI (ASCHERSONIA PLACENTA) IN BALI INDONESIA

One of the pests of citrus is whitefly that, causes damage directly or/and indirectly to the citrus production. To control whitefly the farmer usually use chemical insecticide, however the utilization of chemical insecticide has been reported to haves many negative effect. To minimize the utilization of chemical insecticide, the environmentally friendly method is needed. One of the method is to utilize the natural enemies. Natural enemies are including, parasitiod, predator as well as insect pathogen (entomopathogen). In 2017 entomopathogenic fungi Aschersonia placenta was found to be associated with citrus whitefly in Bali Indonesia. However the species of whitefly has not been identified. In this research the identification of whitefly, the host insect of A. placenta was conducted based on morphological and molecular identification. Morphological identification of whitefly use puparial stage, started with sample preparation by Slide Mounting Protocol. The target of mitochondrial cytochrome c oxidase subunit I (mtCOI) gen was successfully amplified (700 bp) by PCR using forward primer LCO 5'GGTCAACAAATCATAAAGATATTGG3' and reverse primer HCO 5'TAAACTTCAGGGTGACCAAAAAATCA3'. The phylogenetic analysis using software ChromasPRO, Molecular Evolutionary Genetics Analysis (MEGA 5.05), PAUP, BioEdit, and TreeGraph2 was conducted. The result shows that the mtCOI sequence of P. minei from Bali (LC491421) has the highest percentage among others with MK421974 P. minei (score homology 96%). The morphological recognition and sequence analysis show that the species of citrus whitefly is Paraleyrodes minei.

Detection of Asian Citrus Psyllid (Hemiptera: Psyllidae) in Ethiopia: A New Haplotype and its Implication to the Proliferation of Huanglongbing.

Diaphorina citri Kuwayama, also known as the Asian citrus psyllid, is a pest of citrus known for its transmission of Candidatus Liberibacter asiaticus (Ca. L. asiaticus), the causal bacterium of Huanglongbing. The African citrus triozid Trioza erytreae (Del Guercio) (Hemiptera: Triozidae) has been the putative vector of Candidatus Liberibacter africanus (Ca. L. africanus) which causes the African citrus greening disease, until the recent detection of D. citri on the continent. Following reports of D. citri in Kenya and Tanzania, we surveyed citrus plants to establish the presence/absence of D. citri in Ethiopia in citrus-growing regions ranging from 900 to 2,460 m above sea level (masl). Diaphorina citri adults were detected in five of the surveyed sites in Ethiopia. Adult insects encountered were collected using an aspirator and stored in 97% ethanol. The mitochondrial cytochrome oxidase 1 (mt COI) gene of the collected insects was amplified using LepF1/LepR1 primers, and sequences obtained showed low variation, which fell within the acceptable range of species. BLAST was used to query the sequences obtained, and all the sequences linked to D. citri accessions that are available in GenBank. The analysis of the sequences revealed a new haplotype of the species that differs from haplotypes previously reported. Phylogenetic relationships of our samples and other D. citri reference sequences was inferred using the Maximum-likelihood method. Monophyly was observed between the samples and the publicly available sequences from global accessions. This is the first report of the presence of D. citri in Ethiopia.

Molecular characterization of Cardinium, Rickettsia, Spiroplasma and Wolbachia in mite species from citrus orchards.

Tetranychidae spider mites are considered key citrus pests in some production areas, especially Tetranychus urticae Koch. Over the past decades, pesticide overuse seems to have promoted T. urticae population selection in citrus orchards. However, the microbiota has also been pointed out as a plausible explanation for population structure or plant host specialisation observed in several arthropod species. In this work, we have determined the incidence of Cardinium, Rickettsia, Spiroplasma and Wolbachia as representatives of major distorter bacteria genera in Aplonobia histricina (Berlese), Eutetranychus banksi (McGregor), Eutetranychus orientalis (Klein), Panonychus citri (McGregor), Tetranychus evansi Baker and Pritchard, Tetranychus turkestani Ugarov and Nikolskii, and T. urticae populations from Spanish citrus orchards. Only Wolbachia was detected by PCR. The multilocus alignment approach and phylogenetic inference indicated that all detected Wolbachia belong to supergroup B. The deep analysis of each 16S rDNA, ftsZ and wsp gene sequences allowed identifying several phylogenetically different Wolbachia sequences. It probably indicates the presence of several different races or strains, all of them belonging to supergroup B. The wsp sequence typing analysis unveiled the presence of the two already identified alleles (61 and 370) and allowed to contribute with five new alleles, supporting the presence of different but related B-races in the studied mite populations. The results are discussed and related to T. urticae population structure, previously observed in Spanish citrus orchards.

Morphological characterization of antennae and antennal sensilla of Diaphorina citri Kuwayama (Hemiptera: Liviidae) nymphs.

Diaphorina citri Kuwayama is the most economically important citrus pest which is the primary vector of Candidatus Liberibacter spp. causing citrus greening (huanglongbing, HLB) disease. To better understand the developmental and structural changes of antennae and antennal sensilla in D. citri nymphs, we investigated the antennal morphology, structure and sensilla distribution of the five nymphal stages of D. citri using scanning electron microscopy. The antennae of the five different nymphal stages of D. citri were filiform in shape, which consisted of two segments in the first-, second- and third-instar nymphs; three segments in the fourth- and fifth-instar nymphs. The length of their antennae was significantly increased with the increase of the nymphal instar, as well as the total number of antennal sensilla. Ten morphological sensilla types were recorded altogether. They were the long terminal hair (TH1), short terminal hair (TH2), sensilla trichoidea (ST), cavity sensillum 1 (CvS1), cavity sensillum 2 (CvS2), sensilla basiconica 1-3 (SB1-3), sensilla campaniform (SCA) and partitioned sensory organ (PSO). Also, the distribution of antennal sensilla in each nymphal stage of D. citri was asymmetrical. The SBs only occurred on the antennae of the third-, fourth- and fifth-instar nymphs. Only one CvS2 was found in the third- and fifth-instar nymphs, and one SCA in the fourth- and fifth-instar nymphs, respectively. The possible roles of the nymphal antennal sensilla in D. citri were discussed. The results could contribute to a better understanding of the development of the sensory system, and facilitate future studies on the antennal functions in D. citri nymphs.

Citrus Rust Mite Phyllocoptruta oleivora (Ashmead) (Arachnida: Acari: Eriophyidae)

The citrus rust mite, Phyllocoptruta oleivora (Ashmead), also called silver mite, is an important pest of citrus in most humid regions of the world (McCoy and Albrigo 1975, Vacante 2010) (Figure 1). It was first described in 1879 from Florida (Burditt et al. 1963). Phyllocoptruta oleivora is the most important mite pest of Florida citrus due to the cost of control and damage caused to fruits, particularly those for the fresh market (Knapp 1994, Hoy 2011). It coexists with another rust mite called the pink citrus rust mite, Aculops pelekassi (Keifer) (Childers and Achor 1999); however, Phyllocoptruta oleivora is usually the prevalent species.https://edis.ifas.ufl.edu/in1278

Molecular and phenotypic variations in Eutetranychus orientalis (Klein) populations from Saudi Arabia.

The oriental red spider mite, Eutetranychus orientalis (Klein) is a major pest of citrus in many countries including Saudi Arabia (SA). The morphological variations among the different populations of E. orientalis were reported. In the present study, phenotypic variations based on 40 different morphological characteristics were evaluated in 10 E. orientalis populations collected from different hosts and regions of SA. Further, ITS2-rDNA sequences were used to confirm the identity of these phenotypically varying populations. Phenotypic variations in all populations were found in the shape and length of dorsal setae, striation pattern between setae d1 and e1, and leg chaetotaxy. The rDNA sequence analysis of these morphologically varying populations resulted in 10 different ITS2 Saudi haplotypes. The phenotypic and genetic variations were more related to the host plants rather than their geographic distribution. The E. orientalis population collected from Phoenix dactylifera was phenotypically distinct and genetically divergent. The populations collected from citrus species were also more phenotypically and genetically related to each other than to populations collected from non-citrus host plants. The haplotypes recovered from Ziziphus sp., Morus sp., and Azadirecta indica from different regions were grouped in the same sub-clade. Further, the ITS2 haplotypes of Saudi E. orientalis recovered from Citrus reticulata from Riyadh and Al Ula were 100% identical to the ITS2 haplotypes recovered from Citrus sp. from Israel. It is concluded that phenotypic variations exist among different populations of E. orientalis inhabiting different host plants. This species should be identified carefully by considering phenotypic intraspecific variations.

Beneficial insect community of Moroccan citrus groves: assessment of their potential to enhance biocontrol services

In citrus groves, beneficial insects that reduce abundance of pests are considered a key component of integrated pest management strategies. The aim of this article was to assess the biodiversity of parasitoids and predators in citrus orchards in Moroccoto facilitate future investigations on their potential as biocontrol agents. Data of 105 citrus beneficial insects were gathered and summarized in a data matrix. Variables such nature, target pests, type, establishment, and efficacy were assessed. More than two-thirds of parasitoids and predators species identified in citrus groves of Morocco (105 species) are native (> 70%). Both groups represent only a small fraction of the introduced species. The mostly attack armored scale insects (Diaspididae) and aphids (Aphididae). The ladybeetle Rodolia cardinalis (Mulsant) (Coleoptera: Coccinellidae) is the first beneficial species introduced in 1921 to the Moroccan citrus orchards to control the cottony cushion scale Icerya purchasi (Maskell) (Hemiptera: Monophlebidae). Major introductions of these parasitoids and predators were carried out during the ninetieth to control the main citrus pests whereas they were accidentally introduced. These purposely introduced species are mainly Aphelinidae, Encyrtidae, Eulophidae, Coccinellidae, and Phytoseiidae. Whereas a high proportion of the introduced beneficial insects was established and no species have been reported to be harmful to this date. Considering only the introduced species used in classical biological control context, about 20 and 40% of them are considered as effective or partially effective, respectively.

Beneficial arthropods as potential biocontrol candidates of thrips (Thysanoptera: Thripidae) occurring in Tunisian citrus orchards

Thrips are major economic insect pests of citrus worldwide. During the few last years these insects have become serious pests of citrus in Tunisia. The objective of this study was to determine the species of thrips’ natural enemies occurring in citrus orchards and assess the effects of manure application on the abundance of soil predatory mites. Sampling of thrips and their natural enemies was performed in citrus orchards in northern Tunisia from 2015 to 2017. Results revealed that (i) the most abundant predatory species found on plant leaves was Chrysoperla carnea representing 40.38% of the total number of natural enemies collected, followed by Coccinella septempunctata (13.57%) and that (ii) the most abundant soil predatory mite was Parasitus americanus representing 43.44% of the total number of predatory mites collected, followed by Stratiolaelaps scimitus, Pachylaelaps imitans and Odontoscirus sp. (9.43%, 6.45% and 5.41%, respectively). Higher population densities of P. americanus and S. scimitus in the soil were directly correlated with decreased thrips’ abundance and reduced plant damage. Our findings suggest that manure application significantly affects the abundance of both predatory mites and thrips in the soil. Here we provide first knowledge on natural enemies’ action against thrips and their potential use as biocontrol agents in Tunisian citrus orchards. The implications of the obtained results for developing and implementing the most eco-friendly and sustainable pest management options for citrus pest thrips are stated and discussed herein.

Distribution pattern of developmental stages of Phyllocnistis citrella Stainton (Lepidoptera: Gracillariidae) on the surface of citrus leaves

The leafminer Phyllocnistis citrella (Stainton, 1856) (Lepidoptera: Gracillariidae), is considered a potential serious pest of citrus in Algeria. The aim of this work was to investigate the relationship between the ecophases of the citrus leafminer and the leaf surface of the Washington navel citrus variety. Practically all the examined leaves of the young shoots were occupied by at least a developmental stage of this insect. More than 80% of the leafminer ecophases were distributed on the lower surfaces of the leaves. A relationship is highlighted between the leaf surfaces and the stages evolution of citrus leafminer. The choice of area laying by females is decisive for the survival and evolution of stages of development of the insect in relationship with leaf age. The analysis of the eggs distribution revealed that young leaves, with leaf surface smaller than 2 cm², were significantly preferred by females for oviposition. However, the larvae were abundant on leaf surfaces smaller than 6 cm² which provide a favorable environment for the development of larvae in order to realize their respective gallery. The pupal stage was observed almost uniformly on all the analyzed area classes. These results could contribute to the guidelines for pest risk assessment highlighting the intervention for the protection of citrus orchards against heavy infestations of Phyllocnistis citrella.

Evaluation of δ 15N analysis to trace the origin of Diaphorina citri (Hemiptera: Liviidae) to citrus orchard fertilization management.

We investigated the variability of nitrogen stable isotope ratios 15N/14N (expressed as δ15N) on citrus orchards with different fertilization management practices (organic versus conventional) and its correlation with the δ15N values of the key citrus pest Diaphorina citri Kuwayama (Hemiptera: Liviidae) feeding on such plant material. Tracing the origin of this pest in open field is crucial since the insect is a vector of the incurable and devastating citrus disease known as Huanglongbing. We hypothesized that the origin (natal tree) of the pest may be deduced by correlating the δ15N values obtained from the young citrus leaves and from adults of D. citri raised on them. First, laboratory experiments were performed to understand the acquisition and incorportation of the δ15N values by D. citri. Second, we confirmed the positive correlation between the δ15N values of the young citrus leaves and D. citri. Finally, field sampling was carried out in 21 citrus orchards from Southern California to study the variability on the δ15N values on organic and conventional commercial citrus orchards. Laboratory results suggest that the analyses of the δ15N values can be regarded as a useful method to trace the origin of the pest. However, the high variability in nitrogen resource used in both fertilization management practices (especially in organic orchards) by growers makes the application of this technique unfeasible to pinpoint the origin of D. citri in the citrus agroecosystem.

Variability and genetic structure of Anastrepha ludens Loew (Diptera: Tephritidae) populations from Mexico

The Mexican fruit fly, Anastrepha ludens (Loew) (Diptera: Tephritidae), is the most devastating pest of citrus in Mexico. Knowledge of the genetic relationships and structure of Mexican A. ludens populations is limited. The aim of this research was to characterize the genetic variability and structure of the Mexican fruit fly by using AFLP markers (three EcoRI/MseI primer combinations). The specimens were collected from three hosts, namely, Casimiroa edulis La Llave & Lex [white sapote], Casimiroa greggii (S. Watson) F. Chiang [yellow chapote], and Citrus X paradisi (Macfad.) [grapefruit], at four locations in the states of Veracruz (Teocelo and Jalapa), Nuevo Leon (El Jarro), and Tamaulipas (Troncones) in Mexico. A high polymorphism percentage (80.4%) allowed the differentiation of individuals from different A. ludens populations, and high intraspecies genetic variability (DI = 78.4%) was detected. The A. ludens populations clustered into two groups: group one included flies from Veracruz [grapefruit, Jalapa] and Nuevo Leon [yellow chapote, El Jarro], and group two included populations from Tamaulipas [yellow chapote, Troncones] and Veracruz [white sapote, Teocelo]. The populations from group one were from locations at lower altitudes (750 m above sea level), which had warmer (22 °C average temperature) and more humid (1470 mm of annual precipitation) climatic conditions than those of group two (1600 m, 18 °C and 965 mm). Both population structure and very high genetic differentiation (FST > 0.38) associated with geographical and/or host origin were found in A. ludens from Mexico. The genetic differentiation in Mexican A. ludens populations suggests reduced gene flow and reproductive isolation resulting either from habitat fragmentation and genetic drift or from natural selection for specific environmental (climate, geography, pest management strategies) or host (chemistry, phenology) condition. Genetic analysis could increase the success of Anastrepha control programs by improving knowledge of host-parasitoid population genetics, allowing matching of parasitoid species to their preferred pest populations.

Little Leaf Notcher (suggested common name) Artipus floridanus Horn (Insecta: Coleoptera: Curculionidae)

Artipus floridanus Horn, also known as the little leaf notcher, is a secondary pest of citrus and several ornamental plants in Florida and the Caribbean. This species is in the order Coleoptera, the beetles, and the family Curculionidae, the weevils and snout beetles. It was first described by Horn in 1876 (Poole 1996). https://edis.ifas.ufl.edu/in1264
 Also available at: http://entnemdept.ufl.edu/creatures/CITRUS/Artipus_floridanus.html

Expert system application: the smart tools for citrus pest and disease management

Expert system technology of the citrus pest and diseases was created by Indonesian Citrus and Subtropical Fruits Research Institute (ICSFRI). This technology was developed to overcome problem with delayed disease monitoring. If the pest attack was not immediately resolved, it would cause more serious damages to the plant and would cause decreasing in the quantity and quality of the citrus yield. In order to anticipate the delay in control, an observation or monitoring carried out during the critical period of the plant was necessary to be done. This technology was in the form of a web-based or android-based program or software application system that was used to monitor citrus pest and disease. The use of this expert system application had been validated in several citrus center areas in Indonesia, i.e. Jember and Banyuwangi, East Java; Sambas - West Kalimantan; Barito Kuala - South Kalimantan and Bangli - Bali. Observation using this application, the data of pest and diseases status at a certain time and location were automatically be recorded in the system and immediately would be known whether or not the control was needed. Thus, the use of this technology as a tool for monitoring citrus pests and disease can be used as a reference for Early Warning System on citrus pest and disease control.

A field study investigating the insecticidal efficacy against Diaphorina citri Kuwayama on Kinnow mandarin, Citrus reticulata Blanco trees.

Asian citrus psyllid is a most damaging insect pest of citrus. In this field study, the efficacy of seven insecticides (emamectin benzoate, bifenthrin, chlorfenapyr, fipronil, imidacloprid, pyriproxyfen and thiamethoxam) was evaluated against Diaphorina citri Kuwayama in the citrus orchard of Kinnow mandarin, Citrus reticulata Blanco. The insecticides revealed a differential and substantial relative efficacy against D. citri compared to the untreated plants. The insecticidal effect attributed as percent reduction in insect population was more prominent after three days of spray: highest reduction values were recorded with thiamethoxam (50.89%), imidacloprid (44.27%) and bifenthrin (42.94%) after first spray, and thiamethoxam (83.36%), imidacloprid (73.20%) and bifenthrin (72.66%) after second spray. Thus, neonicotinoids (thiamethoxam and imidacloprid) and pyrethroid (bifenthrin) resulted as highly effective against D. citri at three days after both sprays. At seven days, imidacloprid (63.53%) and fipronil (62.47%) presented relatively higher population reduction after first spray, and thiamethoxam (92.66%) and chlorfenapyr (89.59%) after second spray. At 12 days, the insecticidal effect on insect population became significantly at par after each spray except chlorfenapyr that reflected high population reduction (93.17%) only after second spray. It is also obvious from the data that there is need of regular monitoring to suppress the psyllids population below threshold level by timely application of the second insecticidal spray.

Fitness costs associated with thiamethoxam and imidacloprid resistance in three field populations of Diaphorina citri (Hemiptera: Liviidae) from Florida.

Insecticide resistance is an increasing problem in citrus production. The Asian citrus psyllid, Diaphornia citri Kuwayama, is recognized as one of the most important citrus pests worldwide and it has developed resistance in areas where insecticides have been overused. The development of insecticide resistance is often associated with fitness costs that only become apparent in the absence of selection pressure. Here, the fitness costs associated with resistance to thiamethoxam and imidacloprid were investigated in three agricultural populations of D. citri as compared with susceptible laboratory colonies. Results showed that all field populations had greater resistance than laboratory susceptible colonies. For both thiamethoxam and imidacloprid, a Candidatus Liberibacter asiaticus-positive (CLas+) colony was more susceptible than the CLas- colony. Resistance ratios ranged from 7.65-16.11 for imidacloprid and 26.79-49.09 for thiamethoxam in field populations as compared with a susceptible, CLas- laboratory strain. Among three resistant field populations, a significantly reduced net reproductive rate and finite rate of population increase were observed in a population from Lake Wales, FL as compared to both susceptible strains. The fecundity of field populations from Lake Wales, FL was statistically lower than both laboratory susceptible populations. Certain changes in morphological characteristics were observed among resistant, as compared, with susceptible strains. Our data suggest fitness disadvantages associated with insecticide resistance in D. citri are related to both development and reproduction. The lower fitness of D. citri populations that exhibit resistance to neonicotinoid insecticides should promote recovery of sensitivity when those populations are no longer exposed to thiamethoxam and/or imidacloprid in the field. The results are congruent with a strategy of insecticide rotation for resistance management.

RNA virome screening in diverse but ecologically related citrus pests reveals potential virus-host interactions

As an evergreen ecosystem, citrus orchards have specialized pest species and stable ecological homeostasis; thus, they provide an ideal model for investigating RNA viromes in diverse but ecologically related species. For this purpose, we collected specialized citrus pests from three classes of invertebrates, Insecta, Arachnida, and Gastropoda and we constructed two kinds of libraries (RNA and small RNA) for the pests by deep sequencing. In total, six virus-derived sequences were identified, including four Picornavirales, one Jingchuvirales and one Nidovirales. The picornavirus-derived small RNAs showed significant small RNA peaks and symmetric distribution patterns along the genome, which suggests these viruses infected the hosts and triggered host antiviral immunity RNA interference. Screening of virus-derived sequences in multiple species of citrus pests (n = 10 per species) showed that Eotetranychus kankitus picorna-like virus and Tetranychus urticae mivirus may be present in multiple pests. Our investigation in citrus pests confirmed that RNA viruses revealed by metagenomics could impact host immunity (e.g. RNAi). An approach with parallel deep sequencing of RNAs and small RNAs is useful not only for viral discoveries but also for understanding virus-host interactions of ecologically related but divergent pest species.

Effect of pollen of different plant species on the oviposition of two phytoseiid mites (Acari: Phytoseiidae) commonly found in citrus orchards in the Brazilian Amazonia

The suitability of the use of pollen to foster the control of citrus pests by facilitating the maintenance of predatory mites in the area has been extensively studied. The aim of this study was to evaluate the effect of pollen of 13 plant species commonly found in Manaus region (Brazilian Amazonia) on the oviposition of Amblyseius aerialis and Iphiseiodes zuluagai, phytoseiid species abundant in citrus orchards in that region. The study was conducted under laboratory conditions, using mostly pollen grains recently collected in the field. For comparison, a commercially available pollen (ECOPolen) and pollen obtained from two bee species were also included in the study. For about 65% of the evaluated pollen types, the average oviposition was low (less than 0.4 egg/female/day). These differed from other pollen types by the speculate wall (sunflower) or high hygroscopic property (Agave sp., Amaryllis sp., Citrus sinensis, Helianthus annuus and Turnera ulmifolia), or were collected by Apis mellifera. Highest oviposition levels of A. aerialis were obtained on pollen of Typha dominguensis, Elaeis guineensis, Cocos nucifera and the commercial pollen (1.9, 1.5, 0.9 and 0.9 eggs/female/day, respectively). For I. zuluagai, highest levels of oviposition were obtained on E. guineensis, C. nucifera, T. dominguensis, and Elaeis oleifera (1.6, 1.5, 1.2 and 0.9 egg/female/day, respectively). These results suggest that C. nucifera, E. guineensis and E. oleifera, found in the vicinity of citrus orchards in Manaus region, may play a role in maintaining predatory mite populations in such orchards. Complementary studies are needed to investigate the feasibility of maintaining those plants near orchards to increase the abundance of the predators.

Action Plan for Asian Citrus Psyllid and Huanglongbing (Citrus Greening) in California

This document sets forth the California Department of Food and Agriculture (CDFA), Citrus Pest and Disease Prevention Division (CPDPD) statewide Action Plan for Asian citrus psyllid (ACP) and Huanglongbing (HLB). This document details the program implemented by CPDPD to sustain and protect California’s commercial citrus production, residential citrus plantings, and natural resources.

Effects of Pre-Diapause Temperature and Body Weight on the Diapause Intensity of the Overwintering Generation of Bactrocera minax (Diptera: Tephritidae).

The Chinese citrus fruit fly, Bactrocera minax (Enderlein), is an economically important pest of citrus. The fly has an obligatory pupal diapause in soil from November to March. However, techniques for predicting or determining the emergence of the adult have, thus far, not been well documented. In this study, we investigated the effects of different pre-diapause temperatures (8, 12, 16, and 20°C) and pupal body weight (five groups according to pupal weight: G-58, 55.0–61.0 mg; G-68, 65–71 mg; G-78, 75–81 mg; G-88, 85–91 mg; G-95, 92–98 mg) on pupal period (the indicator of diapause intensity). The pupal period of B. minax larvae pupated at 8°C was 193.41 d, which was significantly shorter than that of larvae incubated at higher temperatures, suggesting that there was a lower diapause intensity for larvae pupated at lower pre-diapause temperatures. There were also significant differences in the pupal periods at different pupal body weights. The pupal period of G-58 was significantly shorter than that of the heavier groups (G-88 and G-95), and the pupal period increased with increasing pupal body weight in the five groups. Moreover, the pupal period of B. minax significantly and positively correlated to pupal body weight. These findings demonstrate that the pre-diapause temperature and pupal body weight are suitable indicators for predicting the pupal period of overwintering individuals, and the results of this study will contribute to the development of new and effective strategies for predicting the occurrence and population dynamics of B. minax adult.

Colletotrichum nymphaeae var. entomophilum var. nov. a natural enemy of the citrus scale insect, Praelongorthezia praelonga (Hemiptera: Ortheziidae)

ABSTRACT: The citrus scale insect Praelongorthezia praelonga (Douglas), a major pest of citrus and other economically important crops, has only two commonly documented natural enemies: an entomopathogenic strain of the fungus Colletotrichum nymphaeae (Pass.) Aa and several parasitoids. The entomopathogenic strain of C. nymphaeae, formerly recognized under the synonym C. gloeosporioides f. sp. ortheziidae, is under development for commercial application as a biological control agent in citrus in Brazil-the top exporter of citrus globally. The synonomy of C. gloeosporioides f. sp. ortheziidae with C. nymphaeae remains based on limited DNA sequence data and without morphological study. To qualify for future approval as a biological control agent by federal agencies in Brazil and the European Union, the circumscription of a microorganism must be explicit and without ambiguities. Herein, through morphological study and phylogenetic analysis of five DNA regions we clarify the circumscription and affinity of entomopathogenic C. nymphaeae and describe it as a new variety.