Abstract
One of the pests of citrus is whitefly that, causes damage directly or/and indirectly to the citrus production. To control whitefly the farmer usually use chemical insecticide, however the utilization of chemical insecticide has been reported to haves many negative effect. To minimize the utilization of chemical insecticide, the environmentally friendly method is needed. One of the method is to utilize the natural enemies. Natural enemies are including, parasitiod, predator as well as insect pathogen (entomopathogen). In 2017 entomopathogenic fungi Aschersonia placenta was found to be associated with citrus whitefly in Bali Indonesia. However the species of whitefly has not been identified. In this research the identification of whitefly, the host insect of A. placenta was conducted based on morphological and molecular identification. Morphological identification of whitefly use puparial stage, started with sample preparation by Slide Mounting Protocol. The target of mitochondrial cytochrome c oxidase subunit I (mtCOI) gen was successfully amplified (700 bp) by PCR using forward primer LCO 5'GGTCAACAAATCATAAAGATATTGG3' and reverse primer HCO 5'TAAACTTCAGGGTGACCAAAAAATCA3'. The phylogenetic analysis using software ChromasPRO, Molecular Evolutionary Genetics Analysis (MEGA 5.05), PAUP, BioEdit, and TreeGraph2 was conducted. The result shows that the mtCOI sequence of P. minei from Bali (LC491421) has the highest percentage among others with MK421974 P. minei (score homology 96%). The morphological recognition and sequence analysis show that the species of citrus whitefly is Paraleyrodes minei.
Highlights
Is a polyphagous insect that has a very broad host distribution, these insects are widespread in the tropics and subtropics
In 2017 entomopathogenic fungi Aschersonia placenta was found to be associated with citrus whitefly in Bali Indonesia
The fungus is Aschersonia placenta, the species was found associated with whiteflies in citrus plant in Bali Indonesia (Sudiarta, et al, 2017; Suputra, et al, 2019)
Summary
Is a polyphagous insect that has a very broad host distribution, these insects are widespread in the tropics and subtropics. Whiteflies can cause damage directly or indirectly. Indirect damage is generally whiteflies is a vector of viruses that can cause disease in plants. The abundance of whiteflies infestation has been reported in citrus plant (Syafitri et al, 2017), reported causing a decrease in yield due to increased whitefly. One of the natural enemies of the whiteflies is the entomopathogenic fungus. The fungus is Aschersonia placenta, the species was found associated with whiteflies in citrus plant in Bali Indonesia (Sudiarta, et al, 2017; Suputra, et al, 2019). The species of whitefly as the host of A. placenta has not been identified, even though the information is very important for basic science and applied science. The whitefly on citrus plant in Bali was predicted as Dialeurodes citri from morphological recognise from field, the small body and the similarity morphological from one and other whitefly make difficult to accurate identification. On this study, the identification with morphological and molecular characteristic of whitefly was conducted
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
More From: International Journal of Biosciences and Biotechnology
Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.