Cichorii Strains Research Articles

First report of Pseudomonas cichorii causing bacterial leaf blight of pocketbook plant (Calceolaria hybrida) in Taiwan.

Pocketbook plants (Calceolaria spp.) are flowering ornamentals often grown as potted plants (Poesch 1937). In December 2022, leaf blight symptoms were observed on 2-mo-old plants of C. hybrida F1 'Dainty'. The disease was found in a nursery in Ren'ai Township, Nantou, and about 20% of the plants exhibited symptoms. Symptomatic plants had brown or gray necrotic lesions of different sizes and shapes, mostly around leaf margins. Lower leaf wilting was also observed (Fig. S1, A and B). Three plants were sampled. Leaf lesions were surface-disinfected with 75% ethanol and cut into smaller pieces in 10 mM MgCl2. After observing bacterial streaming under a microscope, the bacteria were streaked onto nutrient agar (NA). Following 2 days at 28°C, a type of round, creamy white colony predominated on all the plates. Three strains (Calc-A, Calc-B, and Calc-C) were obtained, one from each plant. The strains produced fluorescent pigments on King's B medium and were tested Gram-negative. The strains were characterized with the LOPAT scheme (Schaad et al. 2001). They did not exhibit activities of pectic enzymes, arginine dihydrolase and levan sucrase, but produced oxidase and induced the hypersensitive response in tobacco. DNA was extracted from the strains for PCR amplification of the 16S rDNA with primer pair 27f/1492r as described by Lane (1991). The 16S rDNA sequences were compared with entries in the GenBank database. The sequences obtained (GenBank accession no. OR824302) matched that of Pseudomonas cichorii MAFF 301158 (accession no. AB724288; 1,403/1,403 bp) and were 99% identical to that of DSM 50259T (accession no. CP074349; 1,391/1,405 bp). The strains were also tested with the species-specific primers hrp1a and hrp2a (Cottyn et al. 2011). The amplicons were sequenced and a BLASTn search showed that the sequences (accession no. OR827305) shared the highest identity (99.3%) with that of P. cichorii strain 83-1 (accession no. DQ168848; 848/854 bp) and were 97.3% identical to the sequence of DSM 50259T (accession no. CP074349; 831/854 bp). Calc-A was selected as a representative strain and deposited in the Bioresource Collection and Research Center, Taiwan (reference no. BCRC 81432). Koch's postulates were fulfilled by spray-inoculating a suspension of Calc-A on three 2-mo-old C. hybrida F1 'Dainty' plants. The inoculum was prepared by suspending NA-grown cells in 10 mM MgCl2 including 0.02% Silwet L-77 (OD600 = 0.3; 1.5 x 108 CFU/ml). For the controls, three plants were sprayed with bacteria-free solution. The plants were bagged throughout the experiment and kept in a growth chamber (14/10 h light/dark; 26/24°C day/night). Leaf blight and wilting symptoms developed on all leaves of the inoculated plants after 30 h, but not the controls (Fig. S1, C and D). The pathogen was reisolated from the treatment group, and colony PCR with hrp1a/hrp2a showed that the reisolated strain shared the same sequence with Calc-A to Calc-C. Repeating the inoculation assay produced consistent results. This is the first report of P. cichorii affecting Calceolaria in Taiwan. The bacterium has been reported infecting diverse crops in Taiwan, such as tomato and lettuce (Tsai et al. 2014). Expanding the understanding of the pathogen's potential hosts could help prevent its spread across important crops.

First Report of Pseudomonas cichorii Causing Bacterial vein necrosis on Perilla plants [Perilla frutescens (L.) Britton.] in South Korea.

Perilla (Perilla frutescens L.) is the second most important upland crop and the third largest edible oil crop in Korea (Shin and Kim 1994). During a disease survey in Busan, Korea in September 2021, symptoms of vein necrosis were observed in perilla plants, with incidences of approximately 30% and 50% in two fields. Symptoms of spots on the perilla appeared as leaf dryness and spots with water-soaked blotches largely concentrated on the mid-veins of leaves. The lesions were initiated with water-soaked spots on the leaf or stem and gradually turned black or brown. Necrosis was also observed in the stems. A bacterium was isolated on Luria-Bertani (LB) agar from diseased leaf tissues that were surface-disinfected with 70% ethyl alcohol for 3-5 min and then washed with sterile water three times. Three pieces of sterilized leaf tissue (size: 0.5 × 0.5 cm) were mixed with 500 µL sterile water for 30 min, and then the suspension was serially diluted and spread on LB agar. Subsequently, isolates were cultivated on LB agar and King's Medium B agar (KMB) (Schaad et al. 2001), and they were predominantly cream-colored and circular bacterial colonies with undulated margins. The bacterial colonies on KMB displayed fluorescence under 365 nm UV light. The isolates were analyzed with the GEN III MicroPlate (Biolog, Hayward, CA, USA), and all isolates were identified as Pseudomonas cichorii, a devastating plant bacterium that damages a wide range of host plants worldwide, including in South Korea (Hikichi et al. 2013; Ramkumar et al. 2015). To identify the species of the bacterial pathogen, genomic DNA of four isolates (BS4922, BS4167, BS4345, and BS4560) was extracted, and the 16S rRNA gene and hrcRST gene were amplified with universal primers, 27F/1492R and Hcr1/Hcr2, and sequencing was then done (Patel et al. 2019). In the BLAST analysis, the 16S rRNA sequences (GenBank OM060656, OM275434, OM275435, OM275436) showed a 100% and 99% similarity to P. cichorii strains MAFF 302698 (AB724286) and P. cichorii strain Pc-Gd-4 (KU923373), respectively. Further, hrcRST gene sequences (GenBank OM143596, OM268864, OM268865, and OM268866) showed high similarity (>99%) with P. cichorii strain P16-51 (MG518230). A pathogenicity test of the four isolates was performed on 3 - 4 weeks old perilla plants by creating wounds with a needle on the lower leaves and stems, and then the plants were inoculated by spraying inoculum (108 CFU/ml). The plants that served as the negative control were wounded and sprayed with unsterilized water. The inoculated perilla plants were placed in a greenhouse at 28 ± 2oC , 80-85% relative humidity, and a natural photoperiod. The inoculation site began to show symptoms of water-soaked brown lesions. Disease symptoms such as leaf dryness, water-soaked blotches on the mid-vein of leaves, and necrosis on plant stems were observed in the inoculated plants 7-10 days after inoculation, whereas the plants of the negative control group did not show any symptoms. The bacteria were re-isolated from the diseased tissues of the plants, and DNA sequence analysis identified them as P. cichorii. Additionally, all isolates induced hypersensitivity reactions in tobacco and tomato leaves within 24 h after inoculation. To our knowledge, this is the first report of P. cichorii infecting perilla in South Korea. The findings in this study will provide the basic information for the development of diagnostic tools and management measures against P. cichorii in perilla.

Pseudomonas cichorii causing leaf spot disease on Banxia (Pinellia ternata) in China.

Banxia (Pinellia ternata) is an important Chinese medicinal material in the family Araceae and is a widely grown herb in China. In September 2021, a leaf spot disease was observed on Banxia field, with an incidence rate of 35 to 40 % in a 4-ha field, in Zhongxiang City, Hubei Province of China. Symptoms were observed as yellow-white centers, water-soaked edges, irregular lesions, and gradually developed into a yellowish-brown center and a dark-brown edge. Necrotic spots gradually increased, leading to leaf chlorosis and plant death. Margins of leaf lesions were excised form diseased tissue and were plated on nutrient agar (NA) using serial dilution. Growth on NA was predominantly cream-colored circular bacterial colonies with undulated margins. Characterization of three randomly chosen bacterial isolates (JYB1, JYB7 and JYB8) suggests they are Gram-negative, levan negative, arginine dihydrolase negative, oxidase positive, potato soft rot positive, and tobacco hypersensitive positive. Isolates were identified as Pseudomonas cichorii based on the LOPAT scheme (Cottyn et al. 2009). Taxonomic positioning was confirmed genetically by PCR analysis using primers set: 16S rRNA gene universal primers 27F/1492R (Weisburg et al. 1991) and hrcRST gene specific primers Hcr1/Hcr2 (Cottyn et al. 2011). Homology search of 16S rRNA gene sequences (GenBank accessions: JYB1, MZ749668; JYB7, MZ823822; and JYB8, MZ823823) indicated 99.93 % (1396 bp) identity with P. cichorii strains (GenBank accessions: MK356431, JX913785, MZ723344). Similarly, comparison of the hrcRST locus (GenBank accessions: JYB1, MZ977010; JYB7, MZ977011; and JYB8, MZ977012) shared 99.38% (812 bp) with P. cichorii strains (GenBank accessions: CP007039, CP074349, GU324131). Koch's postulate was performed on healthy 30-day-old Banxia plants to confirm pathogenicity of the isolated strains. Leaves were injected with 50 μL bacterial suspensions (1x108 cfu/ml) by sterile syringe. The negative control was inoculated with sterile water. The inoculated Banxia plants were incubated at 28 °C, 70 to 80 % relative humidity, and exhibited water-soaked lesions on the leaf surface within two days around the inoculation sites. Within seven days, all leaves withered and plants died. In contrast, control plants remained healthy and symptomless. The pathogen was consistently reisolated from diseased plants and morphologically and molecularly identified as P. cichorii, while no bacterial colonies were isolated from the control plants, fulfilling Koch's postulates. To our knowledge, this is the first report of bacterial leaf spot caused by P. cichorii on Banxia in China. As one of the main producing areas of Banxia in China, Jianghan Plain of Hubei Province has a planting area of nearly 20 square kilometers. The occurrence of this bacterial disease has the potential threat to the Banxia industry, more research is needed for breeding disease resistance and for developing chemical control.

First Report of a Leaf Spot Disease of Tobacco Caused by Pseudomonas cichorii in China.

Tobacco (Nicotiana tabacum L.), one of the chief commercial crops, is wildly cultivated worldwide. In June 2020 and 2021, an unknown bacterial leaf spot on tobacco was found in Hezhou and Hechi City, Guangxi, China. 30% of the tobacco were affected and the rate of diseased leaves reached about 10% in the field under high temperature and rainstorm. The disease mainly damaged the middle and top leaves of tobacco plants at vigorous growing stage. The initial symptoms were water-soaked spots on the frontal half of a leaf, and then expanded into circular to irregular spots with a yellow halo at the edge. The spots mostly appeared dark brown at high air humidity, while yellow brown at low humidity and exhibited a concentric pattern. In severe cases, the lesions coalesced and the whole leaf was densely covered with lesions, resulting in the loss of baking value. A bacterium was consistently isolated from diseased leaf tissues on nutrient agar (NA). Growth on NA was predominantly grayish white circular bacterial colonies with smooth margins, and the bacterium is rod-shaped, gram-negative and fluorescent on King's B medium. Seven isolates (ND04A-ND04C and ZSXF02-ZSXF05) were selected for molecular identification and pathogenicity tests. Genomic DNA of the bacterium was extracted and the housekeeping gene of cts (encoding citrate synthase) was amplified with the primers cts-Fs/cts-Rs (forward primer cts-Fs: 5'-CCCGTCGAGCTGCCAATWCTGA-3'; reverse primer cts-Rs: 5'-ATCTCGCACGGSGTRTTGAACATC-3') (Berge et al. 2014; Sarkar et al. 2004). 409-bp cts gene sequences were deposited in the GenBank database for seven isolates (accession no. OK105110-OK105116). Sequence of seven isolates shared 100% identity with several Pseudomonas cichorii strains within the GenBank database (accession no. KY940268 and KY940271), and the phylogenetic tree of cts genes of the seven isolates clustered with the phylogroup 11 of Pseudomonas syringae (accession no. KJ877799 and KJ878111), which was classified as P.cichorii. To satisfy Koch's postulates, a pathogenicity test was tested by using a needle to dip a suspension of the bacterium (108 CFU/ml) and pricking three holes in the tobacco leaf. The control plants leaves were needled with sterile water. Each tobacco plant was inoculated with three leaves, and the test was repeated three times. All plants were placed in transparent plastic boxes and incubated in a greenhouse at 25 ± 3°C. The water-soaked spots appeared 24h after inoculation and quickly expanded through leaf veins. Three days after inoculation, all the inoculated leaves showed symptoms similar to those observed in the field. Control plants remained healthy. Only P. cichorii was successfully re-isolated from the lesions, confirming Koch's postulates. Pseudomonas cichorii can infect eggplant, lettuce, tomatoand other crops, and has a wide range of hosts (Timilsina et al. 2017; Ullah et al. 2015). To our knowledge, this is the first report of P. cichorii causing leaf spot on tobacco in China.

First Report of Pseudomonas cichorii Causing Bacterial Leaf Spot on Romaine Lettuce (Lactuca sativa var. longifolia) and Escarole (Cichorium endivia) in New Jersey.

We previously reported an outbreak of bacterial leaf spot (BLS) caused by Pseudomonas cichorii occurring on sweet basil in New Jersey during the summer of 2018 (Patel et al. 2019), a growing season characterized by increased leaf wetness due to high humidity and unusually high levels of summer rains. Leaf spot was also observed, as a one-time event, on older mature leaves on romaine and escarole lettuce during that same year. Symptoms on escarole were observed as grayish brown-to-black concentric lesions on leaf parenchyma tissue, ranging from 1 mm to 1-2 cm in diameter. In more severely diseased samples, lesions coalesced to form larger necrotic areas giving a blight appearance. On occasion, infection was observed in leaf midveins as brownish gray necrosis. Symptoms on romaine lettuce were observed mostly as coalesced blackened lesions on leaf parenchyma tissue near margins with a rotted consistency that spread to the midvein in severe cases. Margins of leaf lesions were excised and macerated in sterile water before streaking onto Nutrient Agar (NA) and King's medium B agar (KMB) (Schaad et al. 2001). Growth on both NA and KMB were predominantly cream-colored circular bacterial colonies with undulated margins. Colonies on KMB fluoresced blue under 365nm UV light. Two representative colonies isolated from each host were selected for further characterization. All isolated tested negative for levan production, positive for oxidase, negative for potato rot, negative for arginine dihydrolase, and induced a strong hypersensitive response on tobacco within 24 h, consistent with LOPAT descriptions for P. cichorii (Lelliott et al. 1966). A single strain from each host (ESC6F2 and Rom1-1) was further characterized genetically to confirm species. PCR analysis using two primers sets: 16S rRNA gene universal primers 27F/1492R and Hcr1 primers used to amplify a 520 bp region of the pathogenicity gene cluster hrcRST in P. cichorii (Patel et al. 2019; Cottyn et al. 2011). Partial 16S rDNA gene sequences were deposited in the GenBank database for each isolate (ESC6F2: MT974180; and Rom1-1: MT982172). Sequence comparisons of ESC6F2 and Rom1-1 shared 99% identity with each other and several P. cichorii strains within the GenBank database, including strain B5-2-1 isolated from sweet basil in NJ the same year (MK501753). The partial hrcRST locus (strain ESC6F2: MW048775 and Rom1-1: MW048774) shared 100% identity to each other and strain B5-2-1 (MK507764), and 99% identity with P. cichorii strain P18-1 (MH396007) isolated from Ocimum basilicum in Hawaii. Koch's postulate was performed on escarole var. Full Heart and Romaine lettuce var. Ideal Cos to confirm pathogenicity of the isolated strains. Bacterial suspensions (1x107 cfu/ml) were syringe-injected (0.1 ml) into the leaf midribs, and pressure infiltrated into leaf parenchyma tissue of 3 plants. Control plants were inoculated with sterile water. Blackened necrosis developed within 72 h around bacteria-inoculation points, which expanded beyond inoculation points within a week. In contrast, control plants remained healthy and symptomless. Although significant crop loss occurred due to BLS on escarole and romaine lettuce, P. cichorii has not been isolated from diseased plant material since 2018. This suggests inoculum sources did not persist beyond 2018, or favorable environmental conditions for disease are inconsistent to cause noticeable damage to New Jersey crops.

D-Tartrate utilization correlates with phylogenetic subclade in Pseudomonas cichorii.

Pseudomonas cichorii is divided into two subclades based on the 16S ribosomal RNA gene sequence and core genome multilocus sequence typing. It was shown that subclade 2 strains utilize d-tartrate as a sole carbon source, whereas subclade 1 strains do not. Draft genome sequencing was performed with P. cichorii strains to identify d-tartrate utilization genes. By genome comparative and homology search studies, an ∼7.1-kb region was identified to be involved in d-tartrate utilization. The region is subclade 2 specific, and contains tarD and dctA genes, which encode a putative enzyme and transporter of d-tartrate, respectively. When the region was introduced into subclade 1 strains, the transformants were able to utilize d-tartrate. Partial fragments of tarD and dctA were amplified from all subclade 2 strains tested in this study by PCR using gene-specific primers, but not from subclade 1 strains. This is the first report on the genetic analysis of biochemical characteristics corresponding to a specific phylogenetic group in P. cichorii.

First Report of Pseudomonas cichorii Causing Bacterial Leaf Spot on Sweet Basil (Ocimum basilicum) in New Jersey

An estimated 500 acres of basil varieties are grown annually for fresh and wholesale markets in New Jersey. In July 2018, leaf spot disease symptoms were observed on several sweet basil cultivars and breeding lines grown in university field trials at the Rutgers Agricultural Research and Extension Center near Bridgeton, NJ. Disease incidence was less than 10%; no differences in susceptibility were observed between varieties or breeding lines of sweet basil within the field. Symptoms were observed as irregularly shaped blackened necrotic spots on leaf margins ranging from 2 to 7 mm in diameter, which coalesced as lesions expanded over time. Margins of diseased tissue were excised, macerated in sterile water, and then quadrant streaked for single-colony isolations onto nutrient agar and King’s medium B agar (KMB) (Schaad et al. 2001). Cream-colored circular bacterial colonies with undulated margins predominated growth on both agar media. Colonies on KMB fluoresced blue under 365-nm UV light. Two representative isolates recovered from separate diseased plants, Pc112 and Pc521, were selected for further characterization. Both isolates tested positive for oxidase, negative for levan production, and induced a strong hypersensitive response on tobacco, consistent with descriptions for Pseudomonas cichorii (Lelliott et al. 1966). Taxonomic positioning was confirmed genetically by PCR analysis using two primer sets: 16S rRNA gene universal primers 27F/1492R and Hcr1 (TTCTCCTGTTCGTGCTGGTC)/Hcr2 (CGAATACTCGGCATCGGGAA) primers constructed to amplify a 520-bp region of the pathogenicity gene cluster hrcRST in P. cichorii (Cottyn et al. 2011). Comparisons of 16S rRNA gene sequences (GenBank accessions: Pc112, MK501752; and Pc521, MK501753) indicated both shared 100% identity (1,412 bp) with each other and 99.93% (1,411/1,412 bp) identity with several P. cichorii strains within the GenBank database, including strain Pc-Gd-5 causing pith necrosis of tomato in China (KU923374) and strain MAFF 302698 causing fruit rot on okra from Japan (AB724286). Similarly, comparison of the hrcRST locus (GenBank accessions: Pc112, MK507763; and Pc521, MK507764) shared 100% (397 bp) identity to each other and 98.99% (395/397 bp) with P. cichorii strain P16-51 (MG518230) isolated from Plumeria pudica in Hawaii. Koch’s postulates were performed on 10-week-old sweet basil cultivar Rutgers Devotion DMR (VDF Specialty Seeds, Momence, IL) plants grown in 12-cm pots (n = 3 seedlings/isolate) to confirm pathogenicity. Bacterial suspensions (1 × 10⁷ CFU/ml) were injected (0.1 ml) into the internodal region of the stem between the second and third leaves and also pressure infiltrated into the two lowermost leaves on both sides of the petiole. Sterile water was used to inoculate negative control plants. Blackened necrosis developed within 72 h around bacteria-inoculated regions of stems and leaves, which expanded beyond original inoculation points within 1 week. In contrast, control plants remained healthy and symptomless. Although similar symptoms on basil have been observed by New Jersey growers in previous years, the cause was never confirmed. To our knowledge, this is the first report of bacterial leaf spot caused by P. cichorii on Ocimum basilicum in the state. Because bacterial leaf spot caused by P. cichorii poses a significant threat to sweet basil production in the United States, further research on selecting and breeding natural sources of resistance and chemical control is needed.

A Novel Phylogroup of Pseudomonas cichorii Identified Following an Unusual Disease Outbreak on Tomato.

Recently, in Central Florida tomato production fields, tomato foliage and fruit were observed with symptoms similar to bacterial speck. Fluorescent pseudomonads were consistently isolated and the strains were characterized by standard LOPAT tests, pathogenicity tests, and genetic characterization using 16S ribosomal RNA (rRNA) sequences and multilocus sequence analysis (MLSA) of conserved housekeeping genes. LOPAT test results indicated that the strains were likely Pseudomonas cichorii. These strains were pathogenic on tomato and were also pathogenic on lettuce, the host for the type strain of P. cichorii. Likewise, strains of P. cichorii isolated in Florida since the early 1980s from hosts other than tomato, along with the type strain, were also pathogenic on tomato. Genetic characterization using 16S rRNA and MLSA confirmed that the strains were most closely related to P. cichorii but varied significantly from the type strain. The Florida P. cichorii strains formed a separate phylogenetic group along with P. cichorii strains isolated from tomato in Tanzania. These strains were different from the previously described morphotypes and genomovars of P. cichorii. Our results indicate the presence of a genetically distinct group of multihost pathogenic P. cichorii strains that have been present in Florida since at least the early 1980s.

The N-acetyltransferase gene-implicated iron acquisition contributes to host specificity of Pseudomonas cichorii strain SPC9018 and its virulence

A pathogenicity island within the genome of a multi-host plant bacterium, Pseudomonas cichorii strain SPC9018, comprises the hrp genes encoding a type III secretion system and the pat gene encoding an N-acetyltransferase proposed to play a role in virulence. However, the function of the N-acetyltransferase remains poorly characterized. Interestingly, limiting the iron condition using a phytosiderophore, mugineic acid, resulted in reduced virulence of strain SPC9018 on respective host plants, including eggplant, similar to the reduced virulence observed with a pat gene-deletion mutant. Spectroscopic analyses showed that the pat deletion reduced the concentration of pyoverdine, which is the main siderophore produced by strain SPC9018, leading to a reduction in pyoverdine-mediated iron acquisition. Furthermore, the pat gene deletion mutant showed enhanced expression of the fecA, pvdL, and pvdR genes, whose expression is induced under deficient siderophore-mediated iron uptake. The pat-deletion mutant showed a hyper-swarming phenotype, and the addition of iron decreased this swarming motility. The pat deletion also reduced the adhesion ability of the bacteria, similar to the effect of iron-limited conditions. Furthermore, deletion of the pat gene enhanced expression of the hrp genes. These findings suggested that the pat gene encoding the N-acetyltransferase may be implicated in iron acquisition, contributing to host specificity of P. cichorii strain SPC9018 and its virulence.

Implication of limited iron acquisition by Pseudomonas cichorii strain SPC9018 in its reduced virulence on eggplant

Pseudomonas cichorii s train SPC9018 was found to produce the siderophore pyoverdine. Application of the phytosiderophore mugineic acid (MA) led to a decrease in the in vitro growth of SPC9018. MA application resulted in increased expression of fecA, which is involved in citrate-mediated iron uptake and in pyoverdine production-related pvdL and pvdR, suggesting that the MA addition may lead to iron-limited conditions in SPC9018. MA application also reduced SPC9018 growth in eggplant leaves, leading to loss of its virulence on eggplant. MA also reduced adhesion of SPC9018. Considering these results together, iron acquisition may play a specific role in SPC9018 virulence on eggplant.

First report on the whole genome sequence of Pseudomonas cichorii strain JBC1 and comparison with other Pseudomonas species

Pseudomonas cichorii, a plant pathogen that infects a wide range of host plants worldwide, causes several diseases in economically important vegetable crops. Availability of the genome sequences of pathogens can greatly enhance research necessary for the advancement of disease management programmes. Despite the significance of P. cichorii, its whole genome sequence has not been reported previously. The genome sequence of P. cichorii JBC1, described for the first time in this study, is 5 986 012 bp with an average GC content of 58·1% and has 5174 coding sequences (CDS). The genes related to virulence, transport mechanisms, phytotoxic compounds, and secondary metabolite products were analysed and the genome was compared to eight other Pseudomonas species to understand the diversity at species level. Despite the high similarity (up to 80·85%), significant diversity was found among the different Pseudomonas species at the genome level. A comparison of JBC1 pathogenicity island (PAI) regions indicated that the P. viridiflava UASWS0038 PAI has more similarity than the P. syringae PAI region, and the analysis revealed significant divergence at PAI regions among the Pseudomonas species, providing an insight into the differences in host specificity and degree of virulence. In addition, JBC1 encodes antibiotic resistance and tolerance to heavy metals, and two different prophage segments were inserted at three different regions. The genome sequence of JBC1, which was deposited into the NCBI GenBank (accession no. CP007039), will be a reference sequence for other P. cichorii strains and a useful resource for further research.

First Report of Bacterial Leaf Spot of Witloof, Caused by Pseudomonas cichorii in Korea

In August 2011, bacterial leaf spot was observed on witloof (Cichorium intybus L. var. foliosum) grown in a commercial field with 15% incidence in Injae, Korea. Symptoms on leaves included irregular brown to reddish brown spots in the center. Bacterial streaming from the lesions was observed microscopically. Bacterial isolates (BC3286, BC3287, and BC3308-BC3310) were recovered on Trypticase soy agar from lesions surface-sterilized in 70% ethyl alcohol for 30 s. The isolates were gram negative, urease negative, fluorescent on King's B agar, and had aerobic rods with 2 to 6 polar flagella. Pathogenicity tests were separately performed in different greenhouses located in Suwon (National Academy of Agricultural Science) and Chuncheon (Gangwondo Agricultural Research and Extension Services) in Korea. Pathogenicity was confirmed by spray inoculation of healthy, 10-day-old leaves of witloof plants (two plants/isolate) with a suspension of original field isolate (106 CFU/ml). Sterile distilled water was used as negative control. The inoculated plants were incubated in a growth chamber (25°C and 95% relative humidity [RH]) overnight, then transferred to a greenhouse at 23 to 27°C and 60 to 70% RH. Characteristic leaf spot symptoms were observed on inoculated witloof plants 8 days after inoculation. No symptoms were observed on control plants. The bacterium reisolated from the inoculated leaves was confirmed by analyzing sequence of the gyrB gene with direct sequencing method of PCR products using primers gyr-F and gyr-R (2). The sequence of reisolated bacteria shared 100% similarity with inoculated ones. In LOPAT (1) tests, all isolates and the reference strain of Pseudomonas cichorii CFBP2101T (=BC2595) were levan negative, oxidase positive, potato rot negative, arginine dihydrolase negative, and tobacco hypersensitivity positive, indicative of group III (-, +, -, -, +) of fluorescent pseudomonads. The 16S rRNA (1,408 bp), and gyrB (676 bp) regions were sequenced to aid in identification of the original field isolates as well as P. cichorii CFBP 2101T (=BC2595) using reported sets of PCR primers, fD1/rP2 and gyr-F/gyr-R, respectively (2,4). Phylogenetic analyses based on partial sequences of the gyrB and the 16S rRNA of Psudomonas spp. available in GenBank, the reference strain of P. cichorii CFBP2101T (=BC2595), and the witloof field isolates were conducted using the neighbor-joining method with Juke-Cantor model of distance calculation in MEGA version 5.1 (3). The isolates and the reference strain of P. cichorii CFBP2101T (=BC2595) was clustered in one group with P. cichorii strains in both phylogenetic trees based on the two sequences. Sequences of the 16S rRNA region had a distance index value ranging from 0.000 to 0.001 between the reference strain of P. cichori CFBP2101T (GenBank JX913784) and the field isolates (JX913785 to JX913789), and ranged from 0.000 to 0.001 within the field isolates. Sequences of the gyrB region had a distance index value ranging 0.029 to 0.033 between the reference strain (JX913790) and the field isolates (JX913791 to JX913795), and ranged from 0.000 to 0.041 within the field isolates. To our knowledge, this is the first report of bacterial leaf spot of witloof caused by P. cihorii in Korea. P. cichorii has a wide host range, and an important economic impact on vegetables. The disease is expected to result in a significant economic impact on root production of witloof in Korea.

A new genomovar of Pseudomonas cichorii, a causal agent of tomato pith necrosis

Recent taxonomic advances, based on biochemical and genotypic processes demonstrate that the plant pathogenic species Pseudomonas cichorii consists of a cluster of closely related genomic groups. Prior to this study, three morphotype groups had been described (C1-C3), all sharing various phenotypic and biochemical characters but partially differing in their DNA content. All entities of the complex could cause disease among a variety of hosts, including lettuce, celery, chrysanthemum and others. In this study, we present the biochemical and molecular characterization of P. cichorii isolates as the causal agent of pith necrosis of tomato plants. A detailed characterization of the genetic variability among strains belonging to P. cichorii was achieved using BOX-PCR and Multi Locus Sequence Analysis utilizing three housekeeping genes (gyrB, rpoD, rpoB). In addition, a number of biochemical and physiological tests were also used for the identification of the tomato P. cichorii isolates. To our knowledge, this is the first complete biochemical, molecular and phylogenetic study of P. cichorii strains isolated from tomato plants affected by pith necrosis disease. Our findings demonstrate the emergence of a new genomovar of P. cichorii, yet another indication for the genetic heterogeneity of the species.

First Report of a Leaf Spot Disease of Golden Dewdrop (Duranta erecta) Caused by Pseudomonas cichorii and a Xanthomonas Species in Florida.

Duranta erecta (Verbenaceae) is used extensively in southern states as an ornamental shrub and has replaced boxwood as the most common short hedge accenting flower beds. Over the past 2 years, during warm wet periods, dark necrotic leaf spots have been observed on golden dewdrop plants in Florida. Isolations from these spots on Difco nutrient agar (NA) consistently yielded two types of bacterial colonies that were not always simultaneously present: 1) round butyrous, bright yellow and 2) flat cream-colored. Both were 2 mm in size after 48 h, gram-negative, and produced a hypersensitivity reaction (HR) on tobacco cv Hicks. Yellow colony bacteria were oxidase negative and non-fluorescent on King's medium B (KMB) (1). Cream-colored colony bacteria were oxidase positive and fluorescent on KMB. Three isolates of both types were selected for further study. Partial 16S rDNA sequencing and fatty acid analysis (FAME) MIDI Microbial Identification System (Microbial ID, Inc., Newark, DE) were used for identification of strains. The 16S rDNA primers used were; forward primer AMB14 5'-TCCAGCAATGCCGCGTGTGT-3' and reverse primer AMB13 5'-CATCCACCGCTTGTGCGGGT-3'. The PCR program consisted of an initial denaturing cycle of 95°C for 2 min followed by 30 cycles of denaturing at 95°C for 30 s, annealing at 60°C for 40 s and extension at 72°C for 1 min and one final extension at 72°C for 10 min. Using FAME analysis, the three strains of the cream-colored colony type were identified as Pseudomonas cichorii with high similarity values (0.907, 0.961, 0.819) and this corresponded well with the 16S rDNA sequences where 99% sequence identity was observed with P. cichorii strain JBC1 16S ribosomal RNA gene, partial sequence GenBank Accession No. JF951725. Two of the three yellow colony strains were identified by MIDI FAME profiles as Xanthomonas axonopodis pv. manihotis with similarity coefficients of 0.767 and 0.826. The third strain had a low similarity match to X. a. pv. carotae (0.541). The 16S rDNA sequencing of these strains showed 98% sequence identity to X. citri subsp. citri strain SA1 16S ribosomal RNA gene only, partial sequence identity JQ890091.1, thus indicating a possible undescribed X. axonopodis pathovar. To satisfy Koch's postulates, three golden dewdrop 'Golden Mound' plants were sprayed with a suspension of 108 CFU/ml of a 2-day NA culture of each strain, bagged for 24 h to raise humidity, and placed in a greenhouse. A strain of P. cichorii (P409) isolated from chrysanthemum was used as a positive control when comparing cream-colored strains. A saline buffered control was used as a negative control. Within 3 weeks, leaf spots developed on plants sprayed with each of the six strains, including positive control strain of P. cichorii. Reisolations yielded the same type of colony as the originally inoculated strain. Inoculation experiments were repeated three times with a minimum of three plants per isolate with similar results. To our knowledge, this is the first report in the United States of bacterial leaf spot caused by P. cichorii and X. axonopodis on golden dewdrop. An earlier morphological and physiological description of a Xanthomonas sp. was done on Duranta in India in 1962 (2). Due to the difficulty in controlling bacterial diseases and the popularity of Duranta spp. in the landscape, these diseases may present a problem in ornamental trade.

Implication of an Aldehyde Dehydrogenase Gene and a Phosphinothricin N-Acetyltransferase Gene in the Diversity of Pseudomonas cichorii Virulence

Pseudomonas cichorii harbors the hrp genes. hrp-mutants lose their virulence on eggplant but not on lettuce. A phosphinothricin N-acetyltransferase gene (pat) is located between hrpL and an aldehyde dehydrogenase gene (aldH) in the genome of P. cichorii. Comparison of nucleotide sequences and composition of the genes among pseudomonads suggests a common ancestor of hrp and pat between P. cichorii strains and P. viridiflava strains harboring the single hrp pathogenicity island. In contrast, phylogenetic diversification of aldH corresponded to species diversification amongst pseudomonads. In this study, the involvement of aldH and pat in P. cichorii virulence was analyzed. An aldH-deleted mutant (ΔaldH) and a pat-deleted mutant (Δpat) lost their virulence on eggplant but not on lettuce. P. cichorii expressed both genes in eggplant leaves, independent of HrpL, the transcriptional activator for the hrp. Inoculation into Asteraceae species susceptible to P. cichorii showed that the involvement of hrp, pat and aldH in P. cichorii virulence is independent of each other and has no relationship with the phylogeny of Asteraceae species based on the nucleotide sequences of ndhF and rbcL. It is thus thought that not only the hrp genes but also pat and aldH are implicated in the diversity of P. cichorii virulence on susceptible host plant species.

Development of a real‐time PCR assay for Pseudomonas cichorii, the causal agent of midrib rot in greenhouse‐grown lettuce, and its detection in irrigating water

Midrib rot is an emerging disease in greenhouse production of lettuce caused by Pseudomonas cichorii, and probably introduced through contaminated irrigation water. Concentrations of 100 CFU mL−1 are enough to induce the typical midrib rot symptoms. A sensitive real‐time PCR assay was developed, based on a 90‐bp amplicon from the pathogenicity gene cluster hrcRST and a Taqman Minor Groove Binding probe. Specificity of the assay was tested with 39 P. cichorii strains, including the type strain, and 89 strains from 83 other Pseudomonas species. The relationship between detection signals and P. cichorii DNA concentrations was linear over 6‐logs. Detection threshold with excellent reproducibility was 500 fg of DNA or about 70 genome copies. Sample preparation and DNA isolation were optimized to allow detection in 1 L water samples. The assay was first evaluated with greenhouse irrigation water spiked with serial dilutions of P. cichorii. The calculated cell numbers obtained with real‐time PCR were 10‐fold lower than plate counts of actual spiked cells. However, the assay consistently detected 100 CFU per reaction, corresponding to the detection of 1 CFU mL−1 of irrigation water, which is well below the concentration needed for midrib rot infection. Finally, the assay proved to be valuable for detecting infective P. cichorii concentrations in the irrigation water of a commercial lettuce production greenhouse.

The hrp genes of Pseudomonas cichorii are essential for pathogenicity on eggplant but not on lettuce.

Pseudomonas cichorii causes necrotic lesions in eggplant and rot in lettuce. Through transposon insertion into P. cichorii strain SPC9018 we produced two mutants, 4-57 and 2-99, that lost virulence on eggplant but not lettuce. Analyses showed that a transposon was inserted into the hrpG gene in 4-57 and the hrcT gene in 2-99. Nucleotide sequences of the hrp genes of SPC9018 are homologous to those of Pseudomonas viridiflava BS group strains. The pathogenicity of 4-57 on eggplant was restored by transformation with an hrpF operon, originating from either SPC9018 or the BS group member P. viridiflava strain 9504 (Pv9504). These data suggested the involvement of hrp genes in the pathogenicity of SPC9018 on eggplant, and functional conservation of hrpF operons between SPC9018 and Pv9504. Both the hrpS mutant and the hrpL mutant were unable to cause necrotic lesions on eggplant leaves but retained their pathogenicity against lettuce. These results suggest that the pathogenicity of P. cichorii is hrp-dependent in eggplant, but not in lettuce.

First Report of a Wilt and Stem Rot of Muskmelon and Watermelon Transplants Incited by Pseudomonas cichorii in Serbia.

In 1989, a wilt and stem rot of muskmelon (Cucumis melo L.) was reported on seedlings grown under plastic in northern Serbia (1). In 1998, a similar disease of watermelon (Citrullus vulgaris L.) transplants occurred in central Serbia, resulting in losses estimated at 20% of plants grown in the nursery. Initial symptoms appeared as water-soaked lesions on the stem and lower surfaces of cotyledons and first true leaves. Necrosis started from leaf water-soaked areas and spread over the entire plant. Many stems softened and toppled. Wilting was also associated with the latter stages of the disease. Six representative strains isolated from water-soaked stem lesions on muskmelon in 1989 (three strains) and on watermelon in 1998 (three strains) were characterized. All strains were gram negative, strictly aerobic, motile, rod-shaped, and fluorescent on King's B medium, but negative for levan production, soft rot of potato, and arginine dihydrolase activity. Furthermore, strains were oxidase positive and induced a strong hypersensitive reaction in tobacco leaves. All of these reactions are characteristic of Pseudomonas cichorii (2). All six strains were confirmed to be P. cichorii based on analysis of cell-wall fatty acid profiles using the Microbial Identification System (MIDI, Newark, DE). Similarity indices ranged from 0.87 to 0.97. Pathogenicity of the P. cichorii strains was confirmed by prick inoculation of the hypocotyl of 2-week-old plants of domestic muskmelon cv. Sezam and watermelon cv. Rosa. Six plants of each cultivar were pricked with a dissecting needle dipped into a bacterial suspension (108 CFU/ml) prepared from each of the six strains and placed in a humidity chamber at 26°C for 48 h. Water-soaking occurred on all plants around the inoculation site after 24 h. The upper part of the plants lost turgor and wilted. Eventually, the hypocotyl and leaf veins became water-soaked, and the stem tissue softened, resulting in toppling of plants. The symptoms were identical to those described on muskmelon in 1989 and observed on watermelon in 1998. No symptoms developed on control plants. The bacterium was reisolated from the inoculated plants and shown to be identical to the original strains, confirming that P. cichorii was responsible for the disease of muskmelon and watermelon seedlings in 1989 and 1998, respectively.

Occurrence of Bacterial Leaf Spot of Escarole Caused by Pseudomonas cichorii in the Everglades Agricultural Area of Southern Florida.

In the fall of 1997, 1998, and 2000, a leaf spot disease of escarole (Cichorium endivia L.) was widespread among commercial plantings in the Everglades Agricultural Area (EAA), south and east of Lake Okeechobee, FL. Symptoms consisted of dry, dark gray-to-black lesions that expanded to ≈4 cm in diameter. Concentric rings were often observed in mature lesions. Growers and scouts in the area consistently identified this disease as Alternaria leaf spot, because the symptoms closely resembled Alternaria leaf spots seen on a number of other vegetables. Prolific bacterial streaming occurred when cut portions of lesions were observed microscopically. A fluorescent bacterium was consistently isolated when a sterile inoculation needle was pushed through lesions. Eight bacterial strains were isolated, restreaked to obtain pure cultures, and characterized. All strains were aerobic, gram-negative rods that were oxidase positive and arginine dihydrolase negative. Negative reactions were recorded for levan formation and rotting of potato slices. All strains utilized glucose, mannitol, and m-tartrate and were negative for sucrose, sorbitol, benzoate, d-arabinose, l-rhamnose, and cellobiose. Results for utilization of D-aspartate were variable. Based on these results, the causal agent of bacterial leaf spot of escarole was identified as Pseudomonas cichorii. Greenhouse-grown plants of escarole, cv. Full Heart, and Cos lettuce, cv. Tall Guzmaine, were mistinoculated with a suspension (107 CFU/ml) of each test strain from escarole and P. cichorii strain Pc28, originally isolated from celery (1). Plants were bagged for 3 days after inoculation. Symptoms characteristic of this disease were evident on escarole inoculated with all test strains and Pc28 6 days after inoculation. Pure cultures of P. cichorii were recovered from lesions on King's B medium. Three test strains produced mild leaf spot symptoms in Cos lettuce, but the symptoms were distinctly different from those associated with the common bacterial leaf spot of lettuce in Florida caused by Xanthomonas campestris pv. vitians (2). To our knowledge, this is the first report of P. cichorii causing this unusual target spot symptom on escarole in the EAA.