First Report of Pseudomonas cichorii Causing Bacterial Leaf Spot on Sweet Basil (Ocimum basilicum) in New Jersey

Abstract

An estimated 500 acres of basil varieties are grown annually for fresh and wholesale markets in New Jersey. In July 2018, leaf spot disease symptoms were observed on several sweet basil cultivars and breeding lines grown in university field trials at the Rutgers Agricultural Research and Extension Center near Bridgeton, NJ. Disease incidence was less than 10%; no differences in susceptibility were observed between varieties or breeding lines of sweet basil within the field. Symptoms were observed as irregularly shaped blackened necrotic spots on leaf margins ranging from 2 to 7 mm in diameter, which coalesced as lesions expanded over time. Margins of diseased tissue were excised, macerated in sterile water, and then quadrant streaked for single-colony isolations onto nutrient agar and King’s medium B agar (KMB) (Schaad et al. 2001). Cream-colored circular bacterial colonies with undulated margins predominated growth on both agar media. Colonies on KMB fluoresced blue under 365-nm UV light. Two representative isolates recovered from separate diseased plants, Pc112 and Pc521, were selected for further characterization. Both isolates tested positive for oxidase, negative for levan production, and induced a strong hypersensitive response on tobacco, consistent with descriptions for Pseudomonas cichorii (Lelliott et al. 1966). Taxonomic positioning was confirmed genetically by PCR analysis using two primer sets: 16S rRNA gene universal primers 27F/1492R and Hcr1 (TTCTCCTGTTCGTGCTGGTC)/Hcr2 (CGAATACTCGGCATCGGGAA) primers constructed to amplify a 520-bp region of the pathogenicity gene cluster hrcRST in P. cichorii (Cottyn et al. 2011). Comparisons of 16S rRNA gene sequences (GenBank accessions: Pc112, MK501752; and Pc521, MK501753) indicated both shared 100% identity (1,412 bp) with each other and 99.93% (1,411/1,412 bp) identity with several P. cichorii strains within the GenBank database, including strain Pc-Gd-5 causing pith necrosis of tomato in China (KU923374) and strain MAFF 302698 causing fruit rot on okra from Japan (AB724286). Similarly, comparison of the hrcRST locus (GenBank accessions: Pc112, MK507763; and Pc521, MK507764) shared 100% (397 bp) identity to each other and 98.99% (395/397 bp) with P. cichorii strain P16-51 (MG518230) isolated from Plumeria pudica in Hawaii. Koch’s postulates were performed on 10-week-old sweet basil cultivar Rutgers Devotion DMR (VDF Specialty Seeds, Momence, IL) plants grown in 12-cm pots (n = 3 seedlings/isolate) to confirm pathogenicity. Bacterial suspensions (1 × 10⁷ CFU/ml) were injected (0.1 ml) into the internodal region of the stem between the second and third leaves and also pressure infiltrated into the two lowermost leaves on both sides of the petiole. Sterile water was used to inoculate negative control plants. Blackened necrosis developed within 72 h around bacteria-inoculated regions of stems and leaves, which expanded beyond original inoculation points within 1 week. In contrast, control plants remained healthy and symptomless. Although similar symptoms on basil have been observed by New Jersey growers in previous years, the cause was never confirmed. To our knowledge, this is the first report of bacterial leaf spot caused by P. cichorii on Ocimum basilicum in the state. Because bacterial leaf spot caused by P. cichorii poses a significant threat to sweet basil production in the United States, further research on selecting and breeding natural sources of resistance and chemical control is needed.