Characterization Of Lactic Acid Bacteria Research Articles

Characterization of Lactic Acid Bacteria in Pecorino di Farindola Cheese and Manufacturing with a Lacticaseibacillus paracasei Autochthonous Culture

This study focused on the characterization of lactic acid bacteria (LAB) in a renowned traditional Italian cheese, Pecorino di Farindola, in order to select an autochthonous culture and investigate its potential for the improvement of safety and functional properties. Two hundred and six LAB isolated throughout production and maturation from nine cheese lots of three farms were identified by 16S rRNA gene sequencing and tested for the presence of genes encoding virulence factors, vancomycin resistance (for enterococci), biogenic amines (BAs) and bacteriocin production for antimicrobial activity; and for the capacity to survive in the gastrointestinal tract (GIT) based on tolerance to low pH and bile salts and adhesion to CaCo-2 cells. A Lacticaseibacillus paracasei isolate was used in cheese making and determined a decline of spiked Listeria monocytogenes and Escherichia coli O157 faster than in the control cheese. The autochthonous bacterial groups were numerically unaffected, apart from lactobacilli that were recovered in higher numbers in cheese with the addition of the L. paracasei strain. Based on repetitive extragenic palyndrome (Rep) polymerase chain reaction (PCR) profiles, the added strain possibly dominated until day 88 in the cheese. Results encourage further trials with autochthonous cultures in order to efficiently inhibit hazardous bacteria and to enrich a functional microbiota in Pecorino di Farindola and similar cheeses.

Isolation and Characterization of Lactic Acid Bacteria Isolated from Fermented Food of North-West Himalayas

Lactic acid bacteria (LAB) are ubiquitous and are one of the major microbial groups involved in the fermentation of various types of food. They are the most dominant microbes present in milk or milk products and fermented foods where they play vital roles in both the manufacturing and ripening processes. Kaladhi is one of the traditional fermented products of the North-West Himalaya region. It is a hard and dry cheese. In our research, a total of 9 isolates was isolated and was evaluated on the basis of preliminary characterization viz. morphological as well as biochemical characterization and was examined for their antagonistic activity against following pathogens. On the basis of their maximum antagonistic potential against food-borne pathogenic bacteria, isolate K1 is characterized by 16S rRNA sequencing. The isolate was identified as Lactobacillus paracasei subsp. Tolerans strain NBRC 15906 K1|MN814072|.This research was aimed to study the unexplored microflora of Kaladhi and to determine its probiotic potential.

Isolation and characterization of lactic acid bacteria from sugarcane waste

Isolation and characterization of lactic acid bacteria from sugarcane waste

Lactic acid bacteria: little helpers for many human tasks

Lactic acid bacteria (LAB) are a group of highly specialised bacteria specifically adapted to a diverse range of habitats. They are found in the gut of humans and other animals, in many food fermentations, and on plants. Their natural specialisation in close relation to human activities make them particularly interesting from an industrial point of view. They are relevant not only for traditional food fermentations, but also as probiotics, potential therapeutics and cell factories for the production of many different products. Many new tools and methods are being developed to analyse and modify these microorganisms. This review shall give an overview highlighting some of the most striking characteristics of lactic acid bacteria and our approaches to harness their potential in many respects - from home made food to industrial chemical production, from probiotic activities to the most modern cancer treatments and vaccines.

The characteristics of lactic acid bacteria isolated from fermented food as potential probiotics.

This study aims to determine the characteristics of Lactobacillus acidophilus and Lactobacillus reuteri from fermented soursop fruit juice and cow's milk, respectively as probiotic candidate based on exposure to pH, bile salts, pathogenic bacteria, and antibiotics. In vitro studies were conducted to examine the resistance of Lactobacillus acidophilus and Lactobacillus reuteri in pH 2, 2.5, 3.2, and 7.2, resistance to bile salts, resistance to pathogenic bacteria (Escherichia coli, Staphylococcus aureus and Enterococcus faecalis) and antituberculosis antibiotics. Viability of Lactobacillus acidophilus and Lactobacillus reuteri isolates remained unchanged (6.3×107CFU/mL and 5.03×107CFU/mL) at various acidic pH, and had a low survival rate in Ox gall 0.3% (bile salts). These isolates also showed antibacterial properties against pathogens in the gastrointestinal tract. Both of these bacteria are quite safe to be used together with ofloxacin, linezolid, moxifloxacin, and levofloxacin, antibiotic for tuberculosis therapy. The results showed that Lactobacillus acidophilus and Lactobacillus reuteri from fermented soursop fruit juice and cow's milk respectively fulfilled the characteristics of probiotic and could potentially beused as adjunct therapy in tuberculosis drug-resistance.

Isolation and Characterization of Lactic Acid Bacteria and Yeasts from Typical Bulgarian Sourdoughs

Traditional sourdoughs in Bulgaria were almost extinct during the centralized food production system. However, a rapidly developing trend of sourdough revival in the country is setting the demand for increased production and use of commercial starter cultures. The selection of strains for such cultures is based on geographical specificity and beneficial technological properties. In this connection, the aim of this study was to isolate, identify and characterize lactic acid bacteria (LAB) and yeasts from typical Bulgarian sourdoughs for the selection of strains for commercial sourdough starter cultures. Twelve samples of typical Bulgarian sourdoughs were collected from different geographical locations. All samples were analyzed for pH, total titratable acidity and dry matter content. Enumeration of LAB and yeast was also carried out. Molecular identification by 16S rDNA sequence analysis was performed for 167 LAB isolates, and 106 yeast strains were identified by ITS1-5.8S-ITS2 rRNA gene partial sequence analysis. The LAB strains were characterized according to their amylolytic and proteolytic activity and acidification capacity, and 11 strains were selected for further testing of their antimicrobial properties. The strains with the most pronounced antibacterial and antifungal activity are listed as recommended candidates for the development of starter cultures for sourdoughs or other food products.

Metabolism Characteristics of Lactic Acid Bacteria and the Expanding Applications in Food Industry.

Lactic acid bacteria are a kind of microorganisms that can ferment carbohydrates to produce lactic acid, and are currently widely used in the fermented food industry. In recent years, with the excellent role of lactic acid bacteria in the food industry and probiotic functions, their microbial metabolic characteristics have also attracted more attention. Lactic acid bacteria can decompose macromolecular substances in food, including degradation of indigestible polysaccharides and transformation of undesirable flavor substances. Meanwhile, they can also produce a variety of products including short-chain fatty acids, amines, bacteriocins, vitamins and exopolysaccharides during metabolism. Based on the above-mentioned metabolic characteristics, lactic acid bacteria have shown a variety of expanded applications in the food industry. On the one hand, they are used to improve the flavor of fermented foods, increase the nutrition of foods, reduce harmful substances, increase shelf life, and so on. On the other hand, they can be used as probiotics to promote health in the body. This article reviews and prospects the important metabolites in the expanded application of lactic acid bacteria from the perspective of bioengineering and biotechnology.

Isolation and characterization of lactic acid bacteria from traditional fermented fish product Shidal of India with reference to their probiotic potential

The study aimed to isolate LAB from a traditional fermented fish product, Shidal of India to evaluate their probiotic characteristics. Forty strains of LAB comprising L. plantarum, P. pentosaceus, P. acidilactici, P. lolii, E. hirae, E. lactis, E. faecium and E. faecalis was recognized using molecular tools. 28 strains excluding E. faecium and E. faecalis was tested for probiotic potential. All the strains survived in the simulated conditions of the GI tract. Auto-aggregation and hydrophobicity ranged from 21 to 49% and 35.31–78.21% respectively, whereas, minimum to moderate co-aggregation ability with S. enterica and S. aureus was exhibited by all the strains. Although, all the strains of Lactobacilli, Pediococci and Enterococci showed variable susceptibility and resistance towards clinical antibiotics, but only resistance against vancomycin was exhibited by Lactobacilli and Pediococci. Non-neutralized cell free supernatant showed antimicrobial activity against enteric pathogens, namely, S. enterica, E. coli, B. subtilis and S. aureus. The results of the study may primarily contribute to the understanding of the probiotic potential of LAB in Shidal, however, in order to access their safety aspects, behaviour in food matrix, sensorial attributes and their survival/colonization in the GI tract using in vivo model is still demanded.

CHARACTERISATION OF LACTIC ACID BACTERIA ISOLATED FROM KEFIR MILK MADE FROM DAIRY AND NON-DAIRY SOURCES AND THEIR SENSORY ACCEPTANCE

Kefir is a fermented milk obtained by fermenting milk with kefir grains. The chemical composition of dairy and non-dairy sources may affect the growth and characterisation of lactic acid bacteria (LAB). In this study, different sources of milk (cow milk) and non-dairy milk (soymilk and coconut milk) were used as the fermentation media for kefir products. The objectives of the study were to isolate and characterise LAB from kefir drink produced from dairy and non-dairy milk. LAB was isolated using different cultural methods, such as MRS Agar, MRS with 0.8% CaCO3, and M17 Agar. The characteristics of the LAB isolates were determined using morphological, biochemical tests and the API 50 CHL kit. The physicochemical composition of the samples was determined using titratable acidity and pH level. Sensory evaluation of the kefir drink samples was also carried out. Results confirmed that the isolates were identified as Lactobacillus buchneri, Lactobacillus brevis 1, Leuconostoc mesenteroides, Lactobacillus acidophilus 3 and Lactobacillus plantarum 1. The L. buchneri, L. brevis, Leu. mesenteroides and L. acidophilus are heterofermentative bacteria, whereas L. plantarum is a homofermentative bacterium. Four LAB isolates have the potential to be used as probiotic strains due to their high resistant to low pH and bile salt. The sensory scores of these products range between 5.00 and 8.00 in the 9-point hedonic scale. Most of the sensory panelists preferred cow milk kefir (p < 0.05) compared with coconut milk kefir and soy milk kefir during the sensory evaluation of all attributes. Meanwhile, the preference between coconut milk kefir and soy milk kefir was similar (p>0.05) in all attributes. Therefore, this study will be useful for probiotic manufacturers in the production of alternative probiotic drinks using dairy and non-dairy milk.

Characteristics of lactic acid bacteria isolated from palm sugar from West Sumatra, Indonesia and their potential as a probiotic

Abstract. Ramadhanti N, Melia S, Hellyward J, Purwati E. 2021. Characteristics of lactic acid bacteria isolated from palm sugar from West Sumatra, Indonesia and their potential as a probiotic. Biodiversitas 22: 2610-2616. Palm sugar is one of the sugar products from palm sap processing. It is made by reducing the water content in the sap to certain water content and is used as a natural sweetener. This study used palm sugar from 3 producers, i.e. Marapalam Gula Semut (MGS), Tetesan Gula Semut (TGS) and Sungayang Gula Semut (SGS) in Sungayang, West Sumatra, Indonesia. This study aimed to isolate and identify lactic acid bacteria (LAB) from palm sugar, potentially as a probiotic, using the 16S rRNA method. The probiotic potential of bacteria was selected based on morphology, biochemical properties, resistance to acidic pH 3 and 0.3% bile salts, antimicrobial activity against pathogenic bacteria. The results showed that lactic acid bacteria isolated from palm sugar are Gram-positive rod-shaped (Bassil), negative catalase, and homofermentative. The total colonies of lactic acid bacteria ranged from 50 x 107 cfu/g - 117 x 107 cfu/g. The MGS lactic acid bacteria had 74.71% viability resistance in acidic pH 3, 65.52% viability against bile salts (0.3% ox gall). The diameter of inhibition against Escherichia coli O157 was 18.20 mm, Propionibacterium acnes (18.00 mm), Acinetobacter baumannii (14.19 mm), and Listeria monocytogenes (16.35 mm). The phylogenetic tree based on 16S rRNA showed that the MGS isolate has a similarity of 99.92% to Lactobacillus fermentum strain 1743. It can be concluded that Lactobacillus fermentum strain 1743 isolated from palm sugar has potential as a probiotic.

Isolation and biochemical characterization of lactic acid bacteria from <em>idli</em> batter

Isolation and biochemical characterization of lactic acid bacteria from <em>idli</em> batter

Technological Characterization of Lactic Acid Bacteria Isolated from Different Sheep’s Milk

Background: Technological characterization of lactic acid bacteria isolated from sheep’s milk collected in 3 regions in northwestern Algeria.Methods: During the period from 2018 to 2019, fifty strains of Lactic acid bacteria isolated from samples sheep’s milk were evaluated for several technologically-relevant properties: diacetyl and exopolysaccharides production, acidification, proteolytic and lipolytic activity and their antagonist activity against Escherichia coli and Pseudomonas aeruginosa. Result: The results indicate that among all the isolates only 20% were distinguished by their production of EPS mainly the genus Leuconostoc. Diacetyl production was observed in 71% of Lactobacillus, 60% of Enterococcus and 25% in Leuconostoc. 94% isolates showed moderate proteolytic activity. 56% and 60% of the strains degraded tween 80 and olive oil respectively for lipolytic activity. Inhibition activity by the cultures LAB was about 82% and 78% against E. coli and P. aeruginosa respectively. No culture supernatants inhibit P. aeruginosa, however 18% of the Enterococcus trains inhibit E. coli. BME1.A2 and BME2.D4 showed their highest acidification capacity developing a very large quantity of lactic acid after 24 h of incubation, i.e., 7.6 and 8.4 g lactic acid/L respectively.

Review of the Characterization of Lactic Acid Bacteria in Tuna Fish

Bekasam is a type of fermented freshwater fish product with sour taste. Bekasam is made from fish that have been cleaned gills and entrails, washed, mixed with salt. After 2 days of fermentation, rice is added to this mixture and fermentation is continued for 5 to 7 days. Bekasam is thought to have antihypertensive activity due to the formation of bioactive peptides resulting from fish protein degradation during the fermentation process of the scars. This study aims to isolate indigenous lactic acid bacteria with high power. Lactic acid bacteria were isolated from tuna. Isolation was carried out using MRS agar + CaCO3 medium and screening of proteolytic lactic acid bacterial isolates was carried out using skim agar. Colonies that provide a clear zone on the skim to be identified as lactic acid bacteria. Of the 180 isolates of acid-producing bacteria that provide clear zones in the MRS to find 150 strains of lactic acid bacteria. The results of further morphological and biochemical tests indicate that these isolates are genera Lactobacillus, Pediococccus and Leuconostoc. The results of further selection were carried out on homofermentative lactic acid bacteria and had high proteolytic activity. The results of identification of isolate species using API CH50 showed that selected lactic acid bacteria were Lactobacillus plantarum, Lactobacillus pentosus, and Pediococcus pentosaceus

Characterization of Lactic Acid Bacteria and Determination of Antimicrobial Activity in Dadih from Air Dingin Alahan Panjang District, Solok Regency-West Sumatera

Traditional Indonesian fermented foods have been studied as potential probiotics, for example dadiah from West Sumatera are made by fermenting buffalo milk in bamboo tubes. But the potential of halal probiotics isolated from Air Dingin District, West Sumatra (Indonesia) has not been studied. The purpose of this study was to determine the potential of halal probiotic lactic acid bacteria (LAB) Lactobacillus plantarum strain 8m-21 isolation from dadiah in Air Dingin Alahan Panjang District, Solok Regency West Sumatera (Indonesia) against to pathogenic bacteria and antimicrobial activity. Previously lactic acid bacteria Lactobacillus plantarum had been isolationand molecular identification used I6S rRNA with Forward (27F AGAGTTTGATCCTGGCTGAG) and Reverse primer (1492R; GTTTACCTTACGACTT). In this study we analyzed the probiotics have antimicrobial activity against pathogenic bacteria Escherichia coli O157. The results showed that Lactobacillus plantarum strain 8m-21 from Air Dingin dadiah isolates have probiotic properties because they have antimicrobial properties which able to inhibit Escherichia coli, aerob (pathogenic) bacteria and have highest antimicrobial with 20.25 mm inhibition than other sintetic antibiotics.

Characterization of Apis mellifera Gastrointestinal Microbiota and Lactic Acid Bacteria for Honeybee Protection-A Review.

Numerous honeybee (Apis mellifera) products, such as honey, propolis, and bee venom, are used in traditional medicine to prevent illness and promote healing. Therefore, this insect has a huge impact on humans’ way of life and the environment. While the population of A. mellifera is large, there is concern that widespread commercialization of beekeeping, combined with environmental pollution and the action of bee pathogens, has caused significant problems for the health of honeybee populations. One of the strategies to preserve the welfare of honeybees is to better understand and protect their natural microbiota. This paper provides a unique overview of the latest research on the features and functioning of A. mellifera. Honeybee microbiome analysis focuses on both the function and numerous factors affecting it. In addition, we present the characteristics of lactic acid bacteria (LAB) as an important part of the gut community and their special beneficial activities for honeybee health. The idea of probiotics for honeybees as a promising tool to improve their health is widely discussed. Knowledge of the natural gut microbiota provides an opportunity to create a broad strategy for honeybee vitality, including the development of modern probiotic preparations to use instead of conventional antibiotics, environmentally friendly biocides, and biological control agents.

Characteristics of lactic acid bacteria and acetic acid bacteria isolated before and after fermentation of cacao beans from Pidie, Indonesia and detection of the flavour compounds

The objectives of this research were to characterise lactic acid bacteria (LAB) and acetic acid bacteria (AAB) which were isolated before and after fermentation of cacao beans, and to detect the flavor compounds in each of these steps. Samples were collected from a farmer in the Pidie District, Aceh Province, Indonesia who supplies the fermented cacao beans for a local chocolate factory located in Pidie Jaya District. The samples were collected before fermentation (F0) and after 5 days fermentation (F5) steps in duplicate. Five LAB and nine AAB were characterised for colony and cell morphology, catalase and oxidase tests, and growth resistance at low pH. The qualitative analysis of flavor compounds of the cacao beans were identified by Gas Chromatography Mass Spectrometry Solid Phase Microextraction (SPME-GCMS). The results showed that all isolates have a negative result on oxidase tests and only one AAB isolate could grow at pH 3. The reduction of phenethylamine during fermentation is desired because it gives off a fishy odor as a result of decarboxylation of amino acids by lactic acid bacteria. The detection of 3-octanyl acetate by its sweet floral fruity odor is expected. It is also interesting to note that a nutty taste and earthy aroma were detected indicating that trimethyl pyrazine and dimethyl pyrazine were present after fermentation even though they were not a major compound.

Phenotypic and genotypic characterisation of lactic acid bacteria isolated from exotic naturally fermented milk (cow and yak) products of Arunachal Pradesh, India

Exotic naturally fermented milk of cow and yak products of Arunachal Pradesh in India such as mar, chhurpi and churkam were analysed for identification of lactic acid bacteria (LAB). The pH of samples was 5.32 ± 0.01 to 6.62 ± 0.01 with viable LAB count of 6.27 ± 0.01 to 6.49 ± 0.02 log cfu g−1. A total of 307 LAB isolates were isolated from 30 samples, and out of which 76 isolates were randomly grouped on the basis phenotypic characteristics, and were identified using 16S rRNA gene sequence analysis into 9 species of LAB from cow-milk products, and 5 LAB species from yak-milk products, respectively. Enterococcus durans was the predominant species along with Leuconostoc mesenteroides subsp. mesenteroides, Lactococcus lactis subsp. lactis, Lc. lactis subsp. cremoris, Lc. lactis subsp. hordniae, Lacticaseibacillus paracasei subsp. tolerans, Levilactobacillus brevis, Loigolactobacillus coryniformis subsp. torquens and Lentilactobacillus parabuchneri. Chhurpi (cow-milk) showed the higher species richness and diversity among the products.

A Single Plasmid of Nisin-Controlled Bovine and Human Lactoferrin Expressing Elevated Antibacterial Activity of Lactoferrin-Resistant Probiotic Strains

Lactoferrin (LF) is a multifunctional protein found in mammals, and it shows broad-spectrum antimicrobial activity. To improve the functional properties of specific probiotics in order to provide both the beneficial characteristics of lactic acid bacteria and the biological activity of LF, cDNAs of bovine LF (BLF), human LF (HLF), or porcine LF (PLF) were cloned into a nisin-inducible plasmid. These were then transformed into the selected eight probiotics, which are LF-resistant hosts. Expression of recombinant LFs (rLFs) was analyzed via SDS-PAGE and Western blot analysis. Although the selected host strains may not contain the nisRK genes (NisK, the sensor kinase; NisR, the regulator protein), the components of autoregulation, a low level of LFs expression can be successfully induced by using nisin within bacterial cells in a time-dependent manner in three engineered clones, including Lactobacillus delbrueckii/HLF, L. delbrueckii/BLF, and L. gasseri/BLF. Lactobacillus delbrueckii and Lactobacillus gasseri originate from yogurt and human milk, respectively, and both strains are functional probiotic strains. Therefore, we further compared the antibacterial activities of disrupted recombinant probiotic clones, conventional strains (host control), and vector control ones by using agar diffusion and broth inhibition analysis, and the expression of rLFs in the above three clones considerately improved their antibacterial efficacies against four important food-borne pathogens, namely, Escherichia coli, Staphylococcus aureus, Enterococcus faecalis, and Salmonella enterica. In conclusion, this study provides a simple strategy for the production of functional LFs (BLF and HLF) in both functional and LF-resistant hosts for applications in the field.

Screening of lactic acid bacteria for their capacity to bind cypermethrin in vitro and the binding characteristics and its application

In this study, the cypermethrin binding characteristics of lactic acid bacteria were investigated for the first time. Two strains, Lactobacillus plantarum RS60 and Pediococcus acidilactici D15, possessed the highest cypermethrin removal capacity and good tolerance to simulated digestive juices. They were employed for further studies on cypermethrin binding characteristics. 55.06% and 56.46% of cypermethrin were removed within 0.25 h by strains RS60 and D15, respectively. The effect of pH on binding capacity was negligible. Heat treatment enhanced cypermethrin binding rate. Moreover, inactive cells were capable of removing cypermethrin from fruit and vegetable juices, with over 60% cypermethrin reduction within 2 h. No adverse effect was found on the quality of juice during the biosorption process. Besides, these two strains also could bind other several pyrethroids and 3-phenoxybenzoic acid. These findings indicated that L. plantarum RS60 and P. acidilactici D15 may be useful to reduce cypermethrin in contaminated foods.

Screening of Probiotic Characteristics of Lactic Acid Bacteria Isolated from Some Fermented Nigerian Food Products

a peer-reviewed, open access online international journal which publishes original research papers. The journal welcomes submission from scholars and experts for possible publication from all over the world. The scope of the journal includes: Pharmaceutical research, chemistry and biochemistry of naturally occurring compounds, biological evaluation of crude extracts, ethnomedicine, traditional and complementary medicine, ethnopharmacology, biomedical research, Biotechnology, Evaluation of natural substances of land and sea and of plants, microbes and animals, pharmacognosy, bioavailability, clinical, pharmacological, toxicological studies and pharmacokinetics of phytochemicals, Isolation and characterization of compounds, structure elucidation, synthesis and experimental biosynthesis of natural Product as well as developments of methods in these areas are welcomed in the journal.