Urinary Calcium Excretion Research Articles

OR21-2 Encaleret (CLTX-305) Restored Mineral Homeostasis in a Phase 2 Study in Autosomal Dominant Hypocalcemia Type 1 (ADH1)

Abstract Autosomal dominant hypocalcemia type 1 (ADH1), caused by gain-of-function variants in the gene encoding the calcium-sensing receptor (CaSR), is characterized by hypocalcemia, hyperphosphatemia, hypomagnesemia, low parathyroid hormone (PTH), and hypercalciuria. Conventional therapy (calcium and activated Vitamin D) worsens hypercalciuria and can lead to renal morbidity. Calcilytics (negative allosteric modulators of the CaSR) decrease the sensitivity of hyperactive receptors to extracellular calcium and normalize blood and urine abnormalities in ADH1 rodent models. Encaleret is an oral calcilytic under investigation as a potential treatment for ADH1. Thirteen adults (22-60y) with ADH1 due to 9 unique CASR variants participated in a 3-period, Phase 2b, open-label, dose-ranging study. Conventional therapy was discontinued prior to encaleret initiation. Period 1 (P1) was a 5-day inpatient dose-escalation course (n=6). Period 2 (P2) was a 5-day inpatient course (n=13) in which doses were individually titrated to normalize albumin-corrected blood calcium (cCa) and minimize hypercalciuria and hypophosphatemia. All 13 participants continued into Period 3 (P3), a 24-week outpatient maintenance period. Patients underwent serial 24hr blood and urine sampling in P1, P2, and in P3 at Weeks 8, 16, and 24, with additional outpatient laboratory timepoints. The mean±SD encaleret dose at the end of P2, Day 5 (P2D5) was 94±64mg BID (range: 10-180 BID); by P3, Week 24 (P3W24), the mean was 78±67mg BID (5-190 BID). Encaleret was well-tolerated with no serious adverse events reported; there were no treatment discontinuations or study withdrawals. Twenty-four hour mean±SD values from P2D5 (n=13) and P3W24 (n=12) compared to baseline are presented. Baseline PTH was low at 6.3±7.8 pg/mL (nl 10-65) and had normalized by P2D5 (40.5±37.5, p<0.01); this was sustained through P3W24 (31.3±20.8, p<0.01). Likewise, baseline hypocalcemia (cCa=7.1±0.4 mg/dL [nl 8.4-10.2]) corrected to 8.6±0.7 by P2D5 (p<0.01) and remained normal through P3W24 (9.0±0.6, p<0.01). Baseline urinary calcium was 395±216 mg/d (nl <250-300) and decreased to 179±108 by P2D5 (p<0.01) and 189±72 at P3W24 (p<0.05); urinary calcium excretion was normal in 10/12 patients at P3W24. Baseline phosphate decreased from 4.5±1.1 mg/dL (nl 2.3-4.7) to 3.2±0.7 on P2D5 (p<0.01) and was maintained through P3W24 (3.5±0.6, p<0.05). Magnesium increased from low- to mid-normal (baseline 1.7±0.2 mg/dL [nl 1.6-2.6]; P2D5 1.9±0.2 [p<0.01]; P3W24 2.0±0.2, [p<0.01]). 1,25-dihydroxy-Vitamin D increased from 19.5±4.4 pg/mL (nl 20-70) to 32.0±16.7 on P2D5 (p<0.05) and 30.2±14.0 on P3W24 (p<0.05). Bone turnover markers were not different between baseline (n=7, CTX=253±111 pg/mL; P1NP=34±10 mcg/L) and P2D5 (CTX=241±181, p=NS; P1NP=26±12, p=NS) but had increased by P3W24 (CTX=784±686, p<0.01; P1NP=102±87, p<0.01). In conclusion, this study represents a molecularly targeted, precision medicine approach to the treatment of ADH1. The consistent and sustained results from all periods of this Phase 2 study establish a clinically meaningful efficacy, tolerability, and safety profile for encaleret as a potential treatment of adults with ADH1. Presentation: Monday, June 13, 2022 11:15 a.m. - 11:30 a.m.

ODP118 PTH (1-34) Replacement Therapy for Hypoparathyroidism due to Sporadic Calcium Sensing Receptor Gain-of-Function Point Mutation

Abstract Background The calcium sensing receptor (CASR) regulates parathyroid hormone secretion in response to extracellular calcium concentration. A gain-of-function mutation of the CASR lowers the set point for extracellular calcium sensing, resulting in both reduced parathyroid hormone secretion and increased urinary calcium excretion compared to other causes of hypoparathyroidism. Clinical Case After presenting with hypocalcemia-associated seizures at the age of two years, our patient had an undetectable serum parathyroid hormone level. He was started on calcitriol and calcium supplementation, however continued to have recurrent seizures throughout childhood. On ultrasound at age four, he exhibited nephrocalcinosis. DNA sequence analysis revealed a heterozygous T383G mutation nucleotide substitution on exon 3, resulting in the replacement of phenylalanine with cysteine at amino acid position 128. Our patient's base substitution likely represents a de novo mutation as we have confirmed that he has no family history of hypocalcemia. Notably, a different missense mutation at the same codon (F128L) co-segregated with autosomal dominant hypocalcemia in a large family, and functional studies confirm that mutation of this phenylalanine provides gain-of-function to the CASR. After enrolling in a clinical trial for continuous recombinant parathyroid hormone infusion at age seven, his symptoms of hypocalcemia abated. His seizures stopped, and anti-epileptic drugs were discontinued at age eight. After the clinical trial concluded, he was switched to teriparatide 10 micrograms three times daily, and serum calcium was maintained between 7.5 and 8.5 mg/dL. With the goal to minimize hypercalciuria and reduce the frequency of injections, teriparatide was discontinued, and recombinant parathyroid hormone (Natpara) 50 micrograms daily was started. This led to symptomatic hypocalcemia with muscle cramping and cognitive changes, and he was thus restarted on teriparatide with calcium carbonate supplementation. Despite maintenance of 24-hour urine calcium excretion ranging 325-388 mg, he developed bilateral flank pain. Computed tomography images revealed worsening nephrocalcinosis and bilateral nephrolithiasis. To reduce hypercalciuria and risk of stone formation, he was started on chlorthalidone, switched to calcium citrate, and encouraged to reduce dietary sodium intake. Conclusion This patient has a novel T383G activating mutation in CASR gene resulting in hypoparathyroidism and type 5 Bartter syndrome that has not been previously published in the literature. His hypocalcemia has remained stable on teriparatide for over 18 years, which to our knowledge, is the longest treatment duration using recombinant human parathyroid hormone for this purpose. We demonstrate a unique clinical challenge to balance treatment of hypoparathyroidism and hypocalcemia with teriparatide and supplemental calcium, while minimizing hypercalciuria and associated nephrocalcinosis. Presentation: No date and time listed

OR29-5 Phase 3 PaTHway Trial: Participants Treated With TransCon PTH Achieved Independence From Conventional Therapy While Maintaining Normal Serum Calcium

Abstract Background Adults with chronic hypoparathyroidism managed with conventional therapy (calcitriol, alfacalcidol, and oral calcium) generally report a reduced quality of life (QoL) and remain at risk for long-term complications from abnormal calcium and phosphate metabolism. The PaTHway trial assessed the efficacy and safety of TransCon PTH at Week 26. Methods PaTHway was a double-blind, placebo-controlled 26-week trial with 3: 1 randomization to TransCon PTH 18 mcg/d or placebo, co-administered with conventional therapy. The composite primary efficacy endpoint was the proportion of participants at Week 26 who achieved: serum calcium levels in the normal range (8.3–10.6 mg/dL), independence from conventional therapy defined as requiring no active vitamin D and ≤600 mg/day of calcium supplementation, and no increase in prescribed study drug over 4 weeks prior to Week 26. Key secondary endpoints included Hypoparathyroidism Patient Experience Scale (HPES) domain scores and 36-Item Short Form Survey (SF-36) subscale scores. Results 82 participants were dosed (78% female, mean age 49 years). 79 completed treatment through Week 26. 79% (48/61) of participants randomized to TransCon PTH met the composite primary efficacy endpoint, compared to 5% (1/21) in the placebo group (p <0.0001). 93% (57/61) participants treated with TransCon PTH achieved independence from conventional therapy. At baseline, mean serum calcium was 8.8 and 8.7 mg/dL for TransCon PTH and placebo respectively; 8.9 mg/dL and 8.2 mg/dL at Week 26, respectively. For TransCon PTH, mean urine calcium decreased significantly from 390 mg/24-hour at baseline to 220 mg/24-hour (normal range <250 mg/24-hour) at Week 26 compared to 329 mg/24-hour at baseline to 292 mg/24-hour at Week 26 for placebo. TransCon PTH therapy demonstrated a significant improvement in HPES-Symptom domain scores − Physical (p = 0.0038) and Cognitive (p = 0.0055), HPES-Impact domain scores − Physical Functioning (p = 0.0046) and Daily Life (p = 0.0061), and SF-36 Physical Functioning subscale score (p = 0.0347) compared to placebo. Overall, TransCon PTH was well-tolerated. The majority of adverse events (AE) were mild or moderate in severity. The most commonly reported study drug-related AEs were injection site reactions, hypercalcemia, and headaches. No study drug-related AEs led to withdrawal from the study. Conclusions In the PaTHway phase 3 trial, 79% of participants on TransCon PTH therapy (versus 5% on placebo) were able to achieve independence from conventional therapy while maintaining normocalcemia at Week 26. Uniquely, TransCon PTH therapy decreased and normalized 24-hour urine calcium excretion and significantly improved QoL (symptom burden and impact) from baseline compared to placebo. These data suggest the potential for TransCon PTH to improve clinical outcomes and QoL compared to current conventional therapy. Presentation: Tuesday, June 14, 2022 10:45 a.m. - 11:00 a.m.

LBODP073 Non-functioning Pituitary Macroadenoma Presenting As Osteopenia In A Male

Abstract Non-functioning pituitary macroadenomas (NFPAs) account for 14-54% of all pituitary adenomas. NFPAs are benign, but mass effects may lead to significant symptoms, including visual impairment and pituitary insufficiency, of which secondary hypogonadism is present in 75% of reported cases. Patients with hypogonadism may experience decreased bone density, libido, muscle mass/strength, and fatigue. We describe a patient who presented with osteopenia, in addition to atypical symptoms of secondary hypogonadism, associated with low testosterone levels. Further workup disclosed a large pituitary macroadenoma. A 56-year-old male presented to the clinic for a two-year history of diffuse joint pain. X-rays were significant for bone loss. This led to a bone density scan that showed osteopenia with a T score of -2.3 in the lumbar spine and left femoral neck. He had no prior history of fractures or loss in height. Risk factors for bone disease were only pertinent for history of osteoporosis in his mother. He was referred to endocrinology for further evaluation. Work up included normal vitamin D levels, 24-hour urine calcium excretion, morning cortisol, and TSH. Given the patient's osteopenia and additional complaints of decreased appetite, weight loss, fatigue, and muscle weakness, testosterone levels were checked and found to be low. Free testosterone level was 14.3 pg/ml with inappropriately low FSH and LH. Prolactin was normal at 12.5 ng/ml. He subsequently had an MRI brain which revealed a pituitary macroadenoma measuring 2. 0×2.4×2.4 cm with mass effect on the optic chiasm. However, the patient did not complain of headaches or visual disturbances and visual field testing was normal. He underwent transsphenoidal resection of the pituitary tumor which led to normalization of testosterone levels and resolution of all his symptoms. This case exemplifies how non-specific symptoms of hypogonadism and absence of mass effect symptoms can lead to a delay in diagnosis of NFPA. Typically, NFPAs are detected when they are large enough to cause symptoms of mass effect which, interestingly, were absent in this patient despite compression of the optic chiasm. Male hypogonadism increases the risk for bone disease. Thus, it is important to pursue work up for secondary hypogonadism in males presenting with osteopenia/osteoporosis despite lack of overt symptoms. A thorough history and workup are essential in diagnosing NFPA. Prompt detection of NFPA can facilitate timely management leading to clinical improvement. The first line of treatment for NFPAs causing neurological symptoms is transsphenoidal surgical resection. Surgery is also recommended for NFPAs that are at high risk for causing visual deficits due to involvement of optic chiasm, as was seen in this patient. Post-surgical follow up includes long-term routine monitoring of hormone levels and neuroimaging. Presentation: No date and time listed

ODP075 A Rare Case of Intrathymic Parathyroid Adenoma

Abstract BACKGROUND: Parathyroid adenomas are the main cause of primary hyperparathyroidism (PHPT). PHPT most often affects adults between ages 50-60 and is considered rare in children and adolescents, representing less than 5% of cases1. It is more common among females than among males in the proportion 3 to 1. During embryogenesis, both the superior and inferior parathyroid glands detach from their pharyngeal origin and migrate towards their final location, posteriorly to the thyroid gland. Migration can be faulty and ectopic glands can appear along the path of embryologic descent2. We present a case of an adolescent male who presented with symptomatic PHPT in the setting of an intrathymic parathyroid adenoma. CASE PRESENTATION: 17-year-old male with no significant past medical history developed symptoms of anxiety, nausea and fatigue. Laboratory values revealed calcium 14.3 mg/dL (8.6-10.3), PTH 227 pg/mL (15-65), 25-dihydroxyvitamin D (vit-D) 8.31 ng/mL (30-100), and phosphorus 1.5 mg/dL (2.5-5. 0). He denied any personal history of bone fractures or nephrolithiasis. CT parathyroid scan showed an enhancing oblong 1.7×0.6 cm lesion in the left upper mediastinal space suggestive of a parathyroid adenoma. Focal sestamibi uptake confirmed a 1.7×0.6 cm enhancing nodule in the left upper anterior mediastinum within the thymus. He was instructed to take 2,000 IU of vit-D daily. Repeat blood work one month later showed that his serum calcium decreased to 13.4 mg/dL and PTH decreased to 122 pg/mL. Additional labs revealed vit-D 16.81 ng/mL, 1,25-dihydroxyvitamin D (calcitriol) 160 pg/mL (19.9-79.3) and 24-hour urine calcium excretion of 409 mg (0-320). Patient underwent successful excision of an intrathymic hyperplastic parathyroid gland adenoma with a >50% drop in peak PTH levels intraoperatively at 10 minutes post excision, later confirmed by pathology. CONCLUSION: This case highlights an adolescent with symptomatic primary hyperparathyroidism due to an intrathymic parathyroid adenoma. Ectopic adenomas have been reported in approximately 4 to 16% of patients with hyperparathyroidism2. When embryological development of the parathyroid glands is defective, it can predispose to the formation of ectopic glands, which is an important cause of failed parathyroid exploration. Unfortunately, PHPT has greater morbidity in the younger age group since most of these patients develop complications from the hypercalcemia, such as kidney stones, hypercalciuria, bone disease and symptoms of abdominal pain/vomiting. This case emphasizes the importance for clinicians to be aware of ectopic parathyroid adenoma in adolescents who present with symptoms and labs consistent with primary hyperparathyroidism.

Сomprehensive restorative treatment of posture disorders in children with connective tissue dysplasia

Aim is to develop a comprehensive program of restorative treatment of posture disorders in children against the background of connective tissue dysplasia. Materials and methods. Ninety children aged from 4 to 17 years were under observation. Of these, 60 patients with connective tissue dysplasia (CTD) were divided into an experimental group (30 children) and a comparison group (30 children). These CTD children were under medical supervision from 2010 to 2020. The reference group consisted of 30 conditionally healthy children of the same age. All children were comprehensively examined. All СTD patients during the entire period of dispensary observation underwent comprehensive restorative treatment using methods of physical therapy, swimming and teaching patients at the educational school “Posture Correction” for children. The data obtained were processed statistically. Results. Characteristic signs of hereditary disorders of connective tissue development were revealed in all CTD children. An increase in the concentration of oxyproline in the blood serum and an increase in urinary excretion of oxyproline and calcium were found. After 5 years from the start of rehabilitation measures, there was an increase in endurance of the back muscles, a minimum number of pathological manifestations, including arthritis, arthralgic syndromes, coccygodynia. Ten years later, at the age of 14 years, the children of the experimental group formed a good posture, a well-off muscular corset and a minimal number of complications. Patients of the comparison group during the observation process more often complained of a feeling of fatigue, prolonged, incurable pain in the thoracic and lumbar spine, weak muscle corset. Conclusion. If CTD signs are detected in children, long-term dispensary observation should be carried out in outpatient conditions with the inclusion of a set of exercises of physical therapy and other rehabilitation measures. With the initial CTD manifestations on the part of the spine, children should be recommended to use a back support or a semi-rigid corset for the duration of increased loads, lessons, and long training sessions.

Evaluation of Urinary Calcium–Creatinine Ratio for Early Prediction of Preeclampsia

Background: Preeclampsia (PE) is one of the most important hypertensive disorders in pregnancy. It is one of the fatal complications with significant mortality and morbidity. Incidence of preeclampsia is around 5-10% of all pregnancies, and in developing countries like Bangladesh it is around 4-18%. Objective: The objective of this study was to determine the efficacy of urinary calcium-creatinine ratio in a spot urine sample for early prediction of preeclampsia in pregnant women. Methods: It's a cross sectional type of analytical study, done in the department of Obstetrics & Gynaecology, Sir Salimuilah Medical College Mitford Hospital, Dhaka. After fulfilling inclusion and exclusion criteria total 100 pregnant women with risk factors of preeclampsia were enrolled as the study population. Results: Among different parameters serum calcium concentration of normal pregnancy and preeclampsia group varied significantly (p<0.05). Women with preeclampsia showed reduced excretion of calcium in comparison to normal pregnant women when spot urinary calcium concentration was evaluated. In this study comparison of spot urinary calcium-creatinine ratio in normal pregnant woman and in preeclamptic women was done and the result was highly significant (p <0.001). Conclusion: This study is intended to identify at risk patients and put selection criteria for primary prevention to reduce morbidity and mortality in patients of preeclampsia. It showed lower urinary calcium excretion and calcium-creatinine ratio in preeclamptic women than normotensive pregnant women. Therefore, a single random urinary calcium-creatinine may be an effective tool for the early diagnosis of preeclampsia.

High-salt diet accelerates bone loss accompanied by activation of ion channels related to kidney and bone tissue in ovariectomized rats.

Excessive salt intake can induce a variety of diseases, such as hypertension, cardiovascular disease, kidney disease and so on，it is also one of the factors promoting bone resorption. The mechanism of osteoporosis-induced exacerbations of high salt diet is not well-defined. In this study, we used ovariectomized 6-month-old Sprague Dawley rats to construct a high bone turnover model, and then administrated with high sodium chloride diet (2.0% w/w NaCl, 8.0% w/w NaCl) for 12 weeks to observe the effect of high salt diet on bone metabolism. The results showed that high salt diet could lead to the destruction of bone microstructure, promote the excretion of urinary calcium and phosphorus and accelerate the bone turnover, as well as cause the pathologic structural abnormalities in renal tubular. At the same time, it was accompanied by the up-regulated expression of the epithelial sodium channel (ENaCα), voltage-gated chloride channels (ClC)-3 and the down-regulated expression of Na-Cl cotransporter (NCC), sodium calcium exchanger (NCX1) in femoral tissue and renal tubules. These findings confirm that high salt diet can destroy the microstructure of bone by increasing bone resorption and affect some ion channels of bone tissue and renal tubule in ovariectomized rats.

Lentiviral vector mediated gene therapy for type I Dent disease ameliorates Dent disease-like phenotypes for three months in ClC-5 null mice

Type 1 Dent disease is caused by changes in chloride voltage-gated channel 5 (CLCN5) gene on chromosome X, which causes the lack or dysfunction of chloride channel ClC-5. Affected subjects show proteinuria and hypercalciuria, and eventually develop end-stage kidney disease. Currently there is no cure for this disease. Here, we used CRISPR-Cas9 technology to develop a Clcn5 mouse model with 95% of the ClC-5 coding region deleted. These mutant mice showed obvious Dent disease-like phenotypes. We used lentiviral vectors to deliver human CLCN5 cDNA into the kidneys of mutant mice by retrograde ureter injection and observed increased megalin expression, improved diuresis, and decreased urinary calcium and protein excretion, which persisted for 3 months. The therapeutic effects diminished 4 months after gene therapy. Our data suggest that immune responses to the transgene products most likely explain the loss of gene therapy effects. This study suggests that gene therapy could be a promising approach to treat Dent disease, but more work is needed to achieve sustained therapeutic effects.

Relationship of urinary excretion of calcium and phosphates and spirometric parameters in children with bronchial asthma

Relationship of urinary excretion of calcium and phosphates and spirometric parameters in children with bronchial asthma

Association of hypercalciuria with vitamin D supplementation in patients undergoing ketogenic dietary therapy.

BackgroundKetogenic dietary therapy (KDT) is used as an effective treatment for epilepsy. However, KDT carries the risk of bone health deterioration; therefore, vitamin D supplementation is required. Vitamin D replacement therapy in KDT has not been established because it may be related to hypercalciuria/urolithiasis, which are common adverse effects of KDT. Hence, this study aimed to evaluate the dose-dependent association between vitamin D3 and hypercalciuria/urolithiasis in patients undergoing KDT and dose optimization for renal complications.Materials and methodsOverall, 140 patients with intractable childhood epilepsy started 3:1 KDT (lipid to non-lipid ratio) at the Severance Children’s Hospital from January 2016 to December 2019. Regular visits were recommended after KDT initiation. Participants were assessed for height, weight, serum 25-hydroxyvitamin D (25-OH-D3) level, parathyroid hormone level, and ratio of urinary excretion of calcium and creatinine (Uca/Ucr). Kidney sonography was conducted annually. Patients who already had urolithiasis and were taking hydrochlorothiazide before KDT, failed to maintain KDT for 3 months, did not visit the pediatric endocrine department regularly, did not take prescribed calcium and vitamin D3 properly, or needed hospitalization for > 1°month because of serious medical illness were excluded. Data from patients who started diuretic agents, e.g., hydrochlorothiazide, were excluded from that point because the excretion of calcium in the urine may be altered in these patients.ResultIn total, 49 patients were included in this study. Uca/Ucr ratio significantly decreased with increasing levels of 25-OH-D3 (p = 0.027). The odds ratio for hypercalciuria was 0.945 (95% confidence interval, 0.912–0.979; p = 0.002) per 1.0 ng/mL increment in 25-OH-D3 level. Based on findings of receiver operating characteristic curve analysis and Youden’s J statistic, the cut-off 25-OH-D3 level for preventing hypercalciuria was > 39.1 ng/mL at 6 months. Furthermore, the vitamin D3 supplementation dose cut-off was > 49.5 IU/kg for hypercalciuria prevention.ConclusionAn inverse relationship between Uca/Ucr ratio and 25-OH-D3 level was noted, which means that vitamin D supplementation is helpful for preventing hypercalciuria related to KDT. We suggest that the recommended 25-OH-D3 level is > 40 ng/mL for hypercalciuria prevention and that KDT for children with epilepsy can be optimized by vitamin D3 supplementation at 50 IU/kg.

Parathyroid Hormone Predicts Radial Bone Loss in Healthy Nigerian Adults

Objective: The correlation between bone mineral density (BMD) and bone markers is well studied in postmenopausal women and elderly men. However, related literature on healthy adults is scarce. This study determined the correlation between parathyroid hormone (PTH), BMD of the left distal radius, and other biochemical markers in apparently healthy Nigerian adults. Methods: This research included 80 (28 males/52 females) healthy participants between 22 and 50 years of age (32.10 ± 5.8 years) who met the inclusion criteria. All the participants were recruited by a systematic random sampling. Interview questionnaires were used to supplement clinical data and anthropometric measures. Fasting samples were analyzed for calcium, inorganic phosphorus, 25-hydroxyvitamin D (25[OH]D), PTH, osteocalcin (OC), alkaline phosphatase, and 24-h calcium excretion. The left distal radius BMD was examined using dual-energy X-ray absorptiometry. The data were statistically analyzed, and the significance level was set at <0.05. Results: It was found that PTH was inversely correlated with left distal radius BMD/z-score (P = 0.004). It showed positive and negative trends with serum-adjusted calcium and inorganic phosphorus (P = 0.09 and P = 0.07, respectively). Neither the OC nor 24-h calcium excretion correlated with PTH (P > 0.05). The OC was inversely correlated with BMD (P = 0.003), but not with 24-h urinary calcium excretion (P > 0.05). None of the participants had osteoporosis. Regression analysis showed that PTH and OC predict radial bone density in participants (P < 0.05). Conclusion: Higher PTH levels correlate with lower left distal radius BMD in apparently healthy participants.

Sulfasalazine related nephrolithiasis in patients with rheumatoid arthritis and ankylosing spondylitis

Background Sulfasalazine (SSZ) is an anti-inflammatory and immunomodulatory drug used to treat many inflammatory diseases. Bacteria in the gut metabolize SSZ to active 5-aminosalicylic acid and inactive sulfapyridine. Sulfapyridine can crystallize in the kidney. We aimed to investigate the frequency of nephrolithiasis in patients who were diagnosed with rheumatoid arthritis (RA), ankylosing spondylitis (AS) and who received SSZ treatment retrospectively.
 Material and Methods We retrospectively analyzed the files of AS and RA patients in the rheumatology outpatient clinic between 2009 and 2018. We identified patients who underwent kidney ultrasonography at least six months after initiation of SSZ. One hundred six patients and 50 healthy adults were included in the study.
 Results Only eight patients (6 AS, 2 RA) had nephrolithiasis on ultrasonography, but none in the control group (p=0.046). In logistic regression analysis, no correlation was found between gender, age, vitamin D, parathyroid hormone, and urinary calcium excretion with SSZ use (p>0.05). 
 Conclusion Although, it is noteworthy that these patients are prone to stone formation for various reasons. Therefore, paying attention to the patient’s hydration while using these drugs may prevent such side effects.

UK national chronic hypoparathyroidism audit.

Individuals with chronic hypoparathyroidism may experience suboptimal medical care with high frequency of unplanned hospitalisation and iatrogenic harm. In 2015 the European Society for Endocrinology published consensus guidelines on the management of chronic hypoparathyroidism. We set out to audit compliance with these guidelines. Using these recommendations as audit standards we worked with the Society for Endocrinology and Parathyroid UK to conduct a national audit of management of chronic hypoparathyroidism in the United Kingdom. Endocrine leads in 117 endocrine departments were invited to participate in the survey by completing a data collection tool on up to 5 sequential cases of chronic hypoparathyroidism seen in their outpatient clinics in the preceding 12 months. Data were collected on 4 treatment standards and 9 monitoring standards. Data on hospitalisations and Quality of Life monitoring were also collected. Responses were received from 22 departments giving a response rate of 19%, concerning 80 individual cases. The mean age of subjects was 48.4 years. The main findings were that the commonest cause of hypoparathyroidism was post surgical (66.3%). Treatments taken by the group included activated vitamin D analogues (96.3%), oral calcium salts (66.3%), vitamin D supplements (17.5%), thiazide diuretics (5%) and rhPTH1-34 (1.3%). Compliance with the audit standards varied between 98.8% and 60% for the treatment standards and between 91.3% and 20% for the monitoring standards. Some of the areas of weakness revealed include low rates of 24 h urinary calcium excretion monitoring, serum magnesium monitoring and low rates of renal imaging where indicated. In addition and importantly, 16.3% of subjects had experienced at least one hospital admission in the preceding 12 months. We conclude that further improvements in the UK national standard of management of chronic hypoparathyroidism should be made and that this will benefit both quality of life, morbidity and potentially mortality in this group of patients.

First Void Urinary Calcium for Tracking Bone Loss and Kidney Stone Risk in Space.

INTRODUCTION: Microgravity exposure unloads the skeleton. This increases urinary calcium excretion, which reflects both increased bone loss and kidney stone formation risk. We studied the probability that first morning void (FMV) urinary calcium (Uca) measurements would capture the highest Uca concentration in a day.METHODS: For 8 wk, three men and three women collected void-by-void 24-h urine samples weekly. Uca concentration was analyzed using a calcein-based system. Uca concentrations were ranked among all samples from each person. FMV and non-FMV (nFMV) Uca concentrations were compared with a Mann Whitney U-test. The probability that an FMV would capture the highest Uca concentration in a day was assessed.RESULTS: Among 377 voids collected, 46 were FMV and 331 were nFMV. Among all samples, the Uca concentration for FMV was significantly higher than nFMV (P < 0.0001). Out of the 46 FMVs, 24 were highest in Uca concentration for the corresponding 24-h period, giving a 52.2% probability that any given FMV would capture the highest Uca concentration in a day. The probability of measuring the highest Uca concentration from at least 1 d increased to 77.1%, and 89.1% when two or three FMVs were collected respectively.DISCUSSION: Acquiring 2-3 repeated FMVs provides a high likelihood of capturing the highest Uca from a day. This suggests repeated first morning void Uca concentrations could assess the risk of bone loss and kidney stone formation, which may provide ability for real-time implementation of countermeasure programs to prevent bone and renal complications in prolonged spaceflight.Thamer S, Buckey JC. First void urinary calcium for tracking bone loss and kidney stone risk in space. Aerosp Med Hum Perform. 2022; 93(7):546-550.

Semptomatik veya asemptomatik primer hiperparatiroidisi olan hastaların biyokimyasal parametreleri ile CDKN1B mutasyon analizi tayini

Amaç: Bu çalışmada semptomatik ve asemptomatik primer hiperparatiroidi (PHPT) olgularını karşılaştırmayı amaçladık, beraberinde sporadik saptanan paratiroid adenomlarında etyopatogenezde CDKN1B mutasyonu varlılığını saptamaya çalıştık. &#x0D; Gereç ve Yöntem: Çalışmamıza kliniğimize başvuran 80 PHPT (66 K ve 14 E, ortalama yaş 50.8 ± 12.01 yıl) tanısı almış hasta dahil edilmiştir. Hastaların yaş, cinsiyet, biyokimyasal parametreleri, görüntüleme yöntemleri (nükleer sintigrafi, ultrasonografi, kemik dansitometre ölçümü) kayıt edilmiştir. CDKN1B gen sekanslaması için GeneMATRIX Quick Blood DNA Purification kiti kullanılarak DNA izole edilmiştir. CDKN1BF (rs786201010, c.-456_-453delCCTT) (CAGGTTTGTTGGCAGCAGTA) ve CDKN1BR (rs786201010, c.-456_-453delCCTT) (GGAGCCAAAAGACACAGACC) primerleri seçilerek mutasyon analizi yapılmıştır.&#x0D; Bulgular: Çalışma sonucunda 22 hasta asemptomatik PHPT olarak tanımlanmış olup semptomatik PHPT (n=68) serum kalsiyum parametreleri ve 24 saatlik idrar Ca+ atılımı daha yüksek olarak saptanmıştır. Serum Parathormon (PTH) değerleri her iki grupta da benzerdi. Her iki grupta da CDKN1B mutasyonu açısından patolojik bir bulgu saptanmamıştır.&#x0D; Sonuç: Parathormon seviyeleri semptomatik veya asemptomatik PHPT olgularında belirleyici bir parametre olmamakla birlikte semptomatik PHPT da serum kalsiyum değerleri ve 24 saatlik idrar Ca+ atılımı daha belirgindir.

A case of familial hypocalciuric hypercalcemia type 1 due to CASR p.Pro55Leu mutation

BackgroundFamilial hypocalciuric hypercalcemia (FHH) is a rare autosomal dominant disease, which requires differential diagnosis from relatively common primary hyperparathyroidism (PHPT) in order to avoid unnecessary surgery.Case presentationA 16-year-old female had been followed by the department of psychosomatic medicine at our institution. Throughout the follow-up period, her plasma calcium levels were high, plasma Pi levels were relatively low, and plasma intact PTH was relatively high. She was referred to our department to determine the cause of her hypercalcemia. Her 24 h urinary calcium excretion was as low as 100 mg/day, and calcium creatinine clearance ratio was below 0.01. Moreover, she had a family history of hypercalcemia (proband, her brother, and her father). The genetic testing for her family revealed that she, her brother, and her father were definitively diagnosed with FHH type 1 due to the heterozygous calcium-sensing receptor mutation (NM_00388:4:c.164C > T:p.Pro55Leu).ConclusionWe experienced a 16-year-old female with FHH, in whom genetic testing identified the heterozygous calcium-sensing receptor mutation (NM_00388:4:c.164C > T:p.Pro55Leu) as pathogenic, permitting a definitive diagnosis of FHH type 1. The genetic testing for calcium sensing receptor is beneficial to distinguish asymptomatic primary hyperparathyroidism from FHH.

Risk Factors Associated With Lower Bone Mineral Density in Primary Aldosteronism Patients.

PurposeThe association between primary aldosteronism (PA) and lower bone mineral density (BMD) has raised a concern, but the contributing factors remain unclear. We aim to explore the risk factors for lower BMD in PA patients.MethodsWe analyzed and compared the data of 60 PA patients with 60 matched essential hypertension (EH) patients. BMD, bone metabolites, and several oxidative stress and inflammation indicators—including C-reactive protein (CRP), superoxide dismutase (SOD), total bilirubin (TBIL), mean platelet volume (MPV), etc.—were assessed and compared in PA and EH patients. Bivariate correlation analysis and multivariate linear regression analysis were performed to explore the factors associated with BMD in PA patients.ResultsThe BMD measured by quantitative computed tomography in PA patients was lower than that in EH patients (141.9 ± 34.0 vs. 158.9 ± 55.9 g/cm3, p = 0.047), especially in patients less than 50 years old. BMD was independently negatively associated with age (standardized β = -0.581, p < 0.001), serum phosphorus (standardized β = -0.203, p = 0.008), urinary calcium excretion (standardized β = -0.185, p = 0.031), and MPV (standardized β = -0.172, p = 0.043) and positively associated with SOD (standardized β = 0.205, p = 0.011) and TBIL (standardized β = 0.212, p = 0.015).ConclusionsThe PA patients showed a lower BMD than the EH patients, which was associated with age, serum phosphorus, urinary calcium excretion, MPV, SOD, and TBIL. These variables might be potential markers for the assessment of bone loss and efficacy of treatments in PA patients.

Enteral nutrition and the risk of nephrolithiasis in complex pediatric patients

Medically complex, non-ambulatory children can often suffer from nephrolithiasis. The purpose of this study is to determine risk factors which are predictive for recurrent stone formation in this patient population. A retrospective cohort study was performed on non-ambulatory patients with cerebral palsy and/or severe developmental delay presenting to a high-volume Pediatric Stone Center from 2015 to 2019. Two 24-hour urine collections were performed as a baseline prior to pharmacotherapeutic and/or dietary intervention. Healthy stone-forming children served as a control group. 28 non-ambulatory subjects and 38 healthy controls were evaluated. The study group had a higher rate of bilateral nephrolithiasis but a similar history of previous surgical procedures. 89% of the non-ambulatory children were fed via a gastrostomy. The median calcium excretion was the same in both groups (3.0mg/kg/day). The median 24-hour excretion of oxalate was significantly increased in the study group (54 vs 31mg/1.73m2/day, p=0.0001). Urinary citrate and phosphorus excretions, and the supersaturations of calcium oxalate and calcium phosphate were similar between study subjects and controls. Calcium oxalate stones were noted in 57% of those with known stone composition in the study group. Enteral feeding formulas were primarily based on soy protein, a known high oxalate food. Urinary oxalate excretion is significantly increased in a cohort of medically complex, non-ambulatory stone-forming children. Urinary calcium excretion was not elevated between study subjects and healthy controls. Further analysis is needed to assess if dietary intervention to limit oxalate excretion results in decreased stone formation.

Title: Jealous protons sour another happy marriage; the story of how TRPV5 and PI(4,5)P2 split up.

TRPV5 is a highly selective calcium channel that finetunes urinary calcium excretion by reabsorbing calcium from the pro-urine. New structural findings show how PTH and pH control TRPV5 activity by altering the binding of endogenous ligands calmodulin and phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2).