Bovine Spleen Phosphodiesterase Research Articles

Optimized enzymatic hydrolysis of DNA for LC–MS/MS analyses of adducts of 1-methoxy-3-indolylmethyl glucosinolate and methyleugenol

Mass spectrometric analyses of DNA adducts usually require enzymatic digestion of the DNA to nucleosides. The digestive enzymes used in our laboratory included a calf spleen phosphodiesterase, whose marketing was stopped recently. Using DNA adducted with bioactivated methyleugenol and 1-methoxy-3-indolylmethyl glucosinolate—each forming dA and dG adducts—we demonstrate that replacement of calf spleen phosphodiesterase (Merck) with bovine spleen phosphodiesterase (Sigma–Aldrich) leads to unchanged results. Enzyme levels used for DNA digestion are extremely variable in different studies. Therefore, we sequentially varied the level of each of the three enzymes used. All dose (enzyme)–response (adduct level) curves involved a long plateau starting below the enzyme levels employed previously. Thus, we could reduce the amounts of micrococcal nuclease, phosphodiesterase, and alkaline phosphatase for quantitative DNA digestion by factors of 4, 2, and 333, respectively, compared to our previous protocols. Moreover, we observed significant phosphatase activity of both phosphodiesterase preparations used, which may affect the recovery of adducts with methods requiring digestion to 2′-deoxynucleoside-3′-monophosphates (e.g., 32P-postlabeling). In addition, the phosphodiesterase from Sigma–Aldrich, but not that from Merck, deaminated dA. This was irrelevant for the dA adducts studied, involving bonding at N6, but might complicate the analysis of other dA adducts.

The 4-(N-Dichloroacetyl-N-methylamino)benzyloxymethyl Group for 2‘-Hydroxyl Protection of Ribonucleosides in the Solid-Phase Synthesis of Oligoribonucleotides

Emerging RNA-based technologies for controlling gene expression have triggered a high demand for synthetic oligoribonucleotides and have motivated the development of ribonucleoside phosphoramidites that would exhibit coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites. To fulfill these needs, the novel 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleoside phosphoramidites 9a-d has been implemented (Schemes 1 and 2). The solid-phase synthesis of AUCCGUAGCUAACGUCAUGG was then carried out employing 9a-d as 0.2 M solutions in dry MeCN and 5-benzylthio-1H-tetrazole as an activator. The coupling efficiency of 9a-d averaged 99% within a coupling time of 180 s. Following removal of all base-sensitive protecting groups, cleavage of the remaining 2'-[4-(N-methylamino)benzyl] acetals from the RNA oligonucleotide was effected in buffered 0.1 M AcOH (pH 3.8) within 30 min at 90 degrees C. RP-HPLC and PAGE analyses of the fully deprotected AUCCGUAGCUAACGUCAUGG were comparable to those of a commercial RNA oligonucleotide sharing an identical sequence. Enzymatic digestion of the RNA oligomer catalyzed by bovine spleen phosphodiesterase and bacterial alkaline phosphatase revealed no significant amounts of RNA fragments containing (2'-->5')-internucleotidic phosphodiester linkages or noteworthy nucleobase modifications.

Synthesis, Biophysical, and Biochemical Properties of PNA-DNA Chimeras

Three PNA-DNA chimeric dimer synthons (tT, upT and uhT, see Sch. 1) have been synthesized in solution and used to make T20-analogue chimeras applying standard solid-phase DNA synthesis protocol. Duplex forming ability of chimeras with dA20 and their hydrolyses by 3′- and 5′-exonucleases (snake venom and bovine spleen phosphodiesterase, respectively) have been investigated.

Structural characterization of carcinogen-modified oligodeoxynucleotide adducts using matrix-assisted laser desorption/ionization mass spectrometry.

The aim of this study was to determine the chemical structure of in vitro 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP)-modified oligodeoxynucleotides (ODNs) by exonuclease digestion and matrix-assisted laser desorption/ionization mass spectrometry. A single-stranded 11-mer ODN, 5'-d(CCATCGCTACC), was reacted with N-acetoxy-PhIP, resulting in the formation of one major and eight minor PhIP-ODN adducts. A 10 min treatment of the major and one minor PhIP-ODN adduct with a 3'-exonuclease, bovine intestinal mucosa phosphodiesterase (BIMP), and a 5'-exonuclease, bovine spleen phosphodiesterase, results in inhibition of the primary exonuclease activity at deoxyguanosine (dG) producing 5'-d(CCATCG(PhIP)) and 5'-d(G(PhIP)CTACC) product ions, respectively. Post-source decay (PSD) of these enzymatic end products identifies dG as the sole modification site in two 11-mer ODN-PhIP adducts. PSD of the minor PhIP-ODN adduct digestion end product, 5'-d(CCATCG(PhIP)), also reveals that the PhIP adducted guanine moiety is in an oxidized form. Prolonged treatment of the PhIP-ODN adducts at 37 degrees C with BIMP induces a non-specific, or endonuclease, enzymatic activity culminating in the formation of deoxyguanosine 5'-monophosphate-PhIP (5'-dGMP-PhIP). The PSD fragmentation pattern of the 5'-dGMP-PhIP [M + H](+) ion of the major adduct confirms PhIP binds to the C-8 position of dG. For the minor adduct, PSD results suggest that PhIP binds to the C-8 position of an oxidized guanine, supporting the hypothesis that this adduct arises from oxidative degradation, resulting in a spirobisguanidino structure.

Matrix-assisted laser desorption/ionization mass spectrometry for locating abasic sites and determining the rates of enzymatic hydrolysis of model oligodeoxynucleotides.

A method using a combination of exonuclease enzymatic digestion and matrix-assisted laser desorption/ionization (MALDI) mass spectrometry was developed to locate model abasic sites in a series of model 21-base oligodeoxynucleotides in which a nucleobase was replaced by a hydrogen atom. The exonuclease digestion rate, with either snake venom phosphodiesterase (SVP) or bovine spleen phosphodiesterase (BSP), clearly slows as the digestion approaches the abasic sites and stops as it reaches it. An oligodeoxynucleotide containing an abasic site in which OH replaces the nucleobase shows similar results. MALDI mass spectra taken at appropriate times during the course of hydrolysis are the basis for rate measurements, and the kinetics also reveal the location of the abasic site. A mathematical treatment of the time-dependent MALDI data was implemented to obtain rate curves and rate constants for the enzymatic digestion of both modified and unmodified oligodeoxynucleotides.

SYNTHESIS OF A NOVEL NUCLEIC ACID MIMIC: P-BORANOMETHYLPHOSPHONATE

A new type of non-ionic nucleotide analogue with a doubly modified internucleotide linkage, P-boranomethylphosphonate, has been successfully synthesized and characterized. Dithymidine boranomethylphosphonate 5 is the first example of a P-boranomethylphosphonate compound; it is a highly lipophilic phosphodiester analog, which is almost totally resistant to both snake venom phosphodiesterase (SVPDE) and bovine spleen phosphodiesterase (BSPDE). P-boranomethylphosphonates are expected to be promising candidates for mechanistic, diagnostic and therapeutic applications.

Synthesis and Enzymatic Stability of Acyclic Thymidine Dimer Analogues having a Constrained Anti-Glycosidic Conformation

Our interest to design a novel class of antisense oligonucleotides has lead us to prepare acyclic thymidine dimer analogues having an unique constrained antiglycosidic conformation. These dimer analogues showed remarkable resistance to nuclease degradation, such as Nuclease S1, Bovine Spleen Phosphodiesterase, and Snake Venom Phosphodiesterase.

Bimolecular DNA triplexes: duplex extensions show implications for H-form DNA stability.

H-form DNA has recently been shown to be biologically relevant by its involvement in the process of homologous recombination [Kohwi, Y. , and Panchenko, Y. (1993) Genes Dev. 7, 1766-1778]. A bimolecular DNA triple-stranded structure (triplex) is central to the formation of H-form DNA. Understanding the formation and factors governing the stability of such bimolecular triplexes is necessary to fully elucidate the structure/function relationship of H-form DNA. In this study, we extend known information on bimolecular triplexes by examining the effect of a variable CNC base triad (where N = A, C, T, or G) on a 10 base triad triplex that mimics the triplex motif in H-form DNA. We also examine the effect that a duplex extension of four base pairs has on triplex stability and selectivity for the base N. Results from thermal denaturation experiments indicate that the fully complementary triplex is more stable than its duplex counterpart (DeltaTm = 13 degrees C) and is resistant to degradation by bovine spleen phosphodiesterase for at least 24 h at 10 degrees C. A single-base mismatch in the purine strand of the triplex structure is destabilizing (DeltaTm = approximately 20 degrees C), and all structures containing a mismatch were readily degraded by bovine spleen phosphodiesterase. An extension of four duplex base pairs onto the triplex structure affects the stability of the DNA complex and may have implications relevant to H-form DNA.

Evidence for the existence of cAMP in lily plant flower tissues

A specific radioimmunoassay (RIA) has been developed for the quantitative measurement of the cAMP content of floral organs of Lilium cv. Connecticut. Significant quantities of cAMP were detected in and around the stigma (highest specific activity), style, ovaries and anthers, but not in the tepals or filaments. The specificity of the method was established by treating the extract of the upper part of the style (including the stigma) with bovine spleen phosphodiesterase. This led to a 50% loss of the cAMP content of the extract. Variations in the cAMP content of this organ were also observed 30 min after flower self-pollination and 90 min after tepal wounding. The presence of cAMP in the lily flower was confirmed by measuring the adenylyl cyclase activity in the membrane fraction of an extract of the upper part of a style (including the stigma). This activity was stimulated by forskolin and aluminium fluoride salts.

Radiation chemistry of d(ApCpGpT).

The radiation chemistry of the DNA tetranucleoside triphosphate d(ApCpGpT) was investigated. Irradiations were carried out on aqueous solutions saturated with oxygen (with and without added Cu++), nitrogen or nitrous oxide. When oxygen was present, principal products were formed by hydroxylation at the 8-position of guanine and by degradation of thymine leaving a formamido remnant. Products were also formed containing both of the aforementioned lesions at adjacent deoxyguanosine and pyrimidine nucleosides. Other products resulted from rearrangement of the thymine ring generating two diastereoisomers of the 5-methyl-5-hydroxyhydantoin modification of d(ApCpGpT). Rearrangement of the cytosine ring occurred generating imidazolidine products and a hydantoin product. The product profiles are similar when either an N2O or N2 gaseous environment is maintained. However, in the latter case the dihydrothymine modifications of d(ApCpGpT) are markedly enhanced. Other products include an 8,5' cyclized product formed from the 2'-deoxyadenosine nucleoside and the 8-hydroxyguanine modification. 6-Hydroxy-5,6-dihydrothymine and 5,6-dihydroxy-5,6-dihydrothymine modifications of the thymidine nucleoside were also observed. A strand break product formed in oxygenated solution is also produced in nitrous oxide saturated solutions. Scission of the deoxyadenosine terminus was also observed. The effect of several of these lesions on d(ApCpGpT) as substrate for nuclease P1, bovine spleen phosphodiesterase and snake venom phosphodiesterase was studied.

Purification of DNA-derived deoxynucleotides from leukocytes involving nuclease elution of an ion-exchange column

A method has been developed in which the DNA of leukocytes (as the buffy coat from blood) is isolated in the form of its constituent deoxynucleotides. The steps in this method are as follows: (1) lyse the leukocytes with sodium dodecyl sulfate (SDS) and enzymatically digest the proteins and RNA, (2) remove the SDS on a non-polar adsorbent (Bio-Beads SM-4) and then trap the DNA on a quaternary amine silica cartridge, (3) wash the column with 1 M NaCl-buffer, (4) digest the DNA on the column with staphylococcal nuclease and (5) elute the digested DNA with 0.5 M NaCl-buffer and digest it further with bovine spleen phosphodiesterase II to deoxynucleotide-3′-monophosphates. From a 40-μl sample of butty coat was obtained 126 ± 14 μg (two experiments, eight sample total) of deoxynucleotides. Reversed-phase high-performance liquid chromatography, which removed the added enzymes, showed only peaks for deoxynucleotides. For comparison, the amount of deoxynucleotides obtained from the leukocytes by an automated phenol extraction procedure was 101 ± 5.4 μg (one experiment in triplicate).

Enzymatic Excision of Radiation-Induced Lesions from DNA Model Compounds

Dinucleoside monophosphates in which the 5' nucleoside contained a radiation-modified base were tested as substrates to bovine spleen phosphodiesterase (SPD) and snake venom phosphodiesterase. The radiation-modified bases included thymine glycols, 5-hydroxymethyluracil, 8-hydroxyguanine, and a formamido remnant of thymine. The lesions had widely different effects on diesterase action, varying from little inhibition, as in the case of digestion of dT*pA by SPD, where T* is the hydroxymethyluracil modification, to severe inhibition, as in the case of digestion of dG*pC by SPD, where G* is the 8-hydroxyguanine modification.

Purification and characterization of a 2′-phosphodiesterase from bovine spleen.

Interferon-induced 2',5'-oligoadenylates are transiently produced during viral infection and are believed to play a role in the interferon-mediated inhibition of replication of at least some viruses. 2',5'-Oligoadenylates must be catabolized but are resistant to degradation by most known ribonucleases. A 2'-phosphodiesterase that degrades 2',5'-oligoadenylates was purified 1500-fold from a low speed homogenate of bovine spleen by precipitation at pH 5.2, ammonium sulfate fractionation, differential ultrafiltration, and successive chromatography on DEAE-Sephacel, hydroxylapatite, and a fast protein liquid chromatography Mono P column. No other 2-5A-degrading activity was observed during the purification procedure. The molecular mass of the enzyme estimated by gel filtration and sodium dodecyl sulfate-polyacrylamide gel electrophoresis is 65,000. The enzyme is distinct from bovine spleen phosphodiesterase II. The 2'-phosphodiesterase cleaves 2',5'- and 3',5'-linked oligonucleotides, as well as branched oligoadenylate, A(2'pA)(3'pA), but appears to be most active on 3',5'-oligoribonucleotides. The enzyme cleaves 5'-AMP from the 2' terminus of 2',5'-oligoadenylates and appears to require a free 2' terminus and a 3'-oxygen on the penultimate nucleotide. Substrate length, 5'-phosphorylation, and base composition do not appear to be critical factors in determining enzyme activity. The effects of pH, Mg2+, Mn2+, EDTA, phosphate, 2-mercaptoethanol, and N-ethylmaleimide are also described. This enzyme may be involved in the catabolism of the interferon-induced 2',5'-oligoadenylates and other 2',5'-linked RNAs in the cell.

Lipid-like agent from human neoplastic cells suppresses cell-mediated immunity

A lipid-like factor (LLF) of a phospholipid nature was isolated from spent cell-free media of explants and cell cultures from lipids collected from human mammary carcinoma and malignant melanoma cells. LLF modulates macrophage properties and inhibits macrophage chemotactic activity, spreading, lipopolysaccharide-induced tumoricidal activities, and macrophage migration. LLF is unique to tumor cells and is not present in detectable quantities in normal mammary epithelial cells or skin fibroblasts. LLF also inhibits human normal lymphocytes' response to mitogenic stimulation. Partial purification of LLF from human mammary carcinoma is attained by a combination of chloroform extraction and filtration through Amicon molecular membranes. LLF activity is not sensitive to trypsin, pronase, bovine spleen phosphodiesterase II, alkaline phosphatase, or ribonuclease, but it is completely inactivated with phospholipase and lipoprotein lipase.

Characteristics of a low‐molecular‐weight factor extracted from mouse tumors that affects in vitro properties of macrophages

A dialysable low-molecular-weight factor capable of affecting in vitro properties of macrophages was extracted from four different mouse tumors. This factor not only modulates closely related properties of peritoneal macrophages such as spreading and migration but also inhibits lipopolysaccharde-induced tumoricidal activity of these cells. It can be extracted not only from tumor tissues but also from tumor cells grown in vitro. The appearance of this factor is unique to tumors and it is not present in detectable quantities in normal tissues. The factor from one of the tumors, Lewis lung carcinoma, was purified extensively and the partially purified factor retains all the above effects on macrophages. It is not sensitive to pronase or a mixture of bovine spleen phosphodiesterase II, E. coli alkaline phosphatase and pancreatic ribonuclease. The factor is lipid-like in character and it is soluble in both organic solvents and aqueous media. It has ionizable group(s) and is anionic at neutral pH but non-ionic under acidic conditions.

A DNA endonuclease isolated from yeast nuclear extract

We have isolated and partially purified a DNA endonuclease from nuclei of the yeast Saccharomyces cerevisiae. Although purified on the basis of its ability to degrade denatured DNA, the enzyme can also attack native DNA. Denatured oligonucleotide products of the enzyme are sensitive to venom phosphodiesterase (EC3.1.4.1.) but not to bovine spleen phosphodiesterase (EC3.1.4.18). The enzyme has an estimated molecular weight of 6.6--7.5 X 10(4), more than twice as large as the endonucleases involved in DNA repair in Escherichia coli. When analyzed on glycerol gradients, the endonuclease sedimented as a single activity against both denatured DNA and closed circular DNA duplexes. The enzyme showed a 10-fold preference for denatured over native T7 DNA substrate, and appears to produce random nicks in a supercoiled replicative form of phiX174 DNA (RFI) with no discernable preference for the unpaired bases in the supercoiled duplex. The endonuclease appears to be distinct from the yeast endonucleases previously described.

Xanthine oxidase and adenosine deaminase in commercial bovine spleen phosphodiesterase preparations

Commercial bovine spleen phosphodiesterase preparations contain xanthine oxidase activity; the xanthine oxidase in such preparations mediates the oxidation of a pteridine derivative as well as a standard purine substrate (hypoxanthine). The xanthine oxidase activity in the phosphodiesterase preparations is inhibited strongly by allopurinol (4-hydroxypyrazolo(3,4-d) pyrimidine). The reported ability of phosphodiesterase preparations to catalyze the deamination of adenosine derivatives appears to be due to contamination with a conventional adenosine deaminase in view of the observations that this activity is inhibited by an established inhibitor of adenosine deaminase and that the relative rates of deamination of N 1-methyladenosine and adenosine are similar with both the phosphodiesterase preparation and calf intestine adenosine deaminase.

Stepwise phosphorolysis with polynucleotide phosphorylase: A novel method for sequence analysis of oligoribonucleotides

Snake venom phosphodiesterase, bovine spleen phosphodiesterase and polynucleotide phosphorylase are currently used for sequence analysis of oligoribonucleotides. These exonucleases remove mononucleotide residues in a sequential order from either the 3’or 5’-end of an oligonucleotide. The nucleotide sequence of a given oligonucleotide is then derived by analyzing the partially degraded oligonucleotides which appear in the course of the reaction (cf. [l-3] ). These procedures, while very useful for analyzing labeled oligonucleotides, are inadequate when only trace amounts of non-labeled material are available. In the present report we describe a novel and sensitive method for sequence analysis of non-labeled oligoribonucleotides. The method is based on the property of polynucleotide phosphorylase to phosphorolyze short oligonucleotides from the 3’-end in a stepwise fashion by a nonprocessive mechanism [4-61. The final products of the reaction consist of a mixture of nucleoside diphosphates (NDP’s) and a limit oligonucleotide that is not further degraded by the enzyme. Depending on its base composition, this oligonucleotide is a dior trinucleotide. By following the order in which the released NDP’s appear during the phosphorolysis of a given oligonucleotide, it is possible to determine the nucleotide sequence from the 3’-end up to 2-3 residues from the 5’-terminus. The high sensitivity of this method is achieved by including 32Pi in the phosphorolysis medium. Upon digestion, the label is incorporated in the P-phosphate moieties of the generated NDP’s which can be easily

Reaction of diethyl pyrocarbonate with nucleic acid components: Adenosine-containing nucleotides and dinucleoside phosphates

Reactions of diethyl pyrocarbonate with adenine-containing nucleotides and dinucleoside phosphates have been explored in order to assess both chemical and biochemical effects of this reagent upon adenosine units in nucleic acids. 5′-AMP and 3′(2′)-AMP were converted, by imidazole ring opening, to corresponding 4,5- dicarbethoxyamino-6-N- ribofuranosylamino-pyrimidine phosphates, characterized as the disodium salts. Dinucleoside phosphate model compounds A-A, A-U and U-A were converted in high yields to N- carbethoxy derivatives VII, VIII and IX, respectively, in which the imidazole ring of each adenosine unit has been opened. Ultraviolet absorption spectra of the dinucleoside phosphate products were compared with those predicted by additive combination of the spectra of the “half” molecules in each case. Modified compounds VIII and IX from A-U and U-A were digested, if at all, more slowly than the unmodified counterparts by venom phosphodiesterase, ribonuclease T 2, bovine pancreatic ribonuclease A and bovine spleen phosphodiesterase; product VII from A-A was not hydrolyzed by any of the enzymes under the conditions employed. Potential hazards to structural integrity of nucleic acids in presence of excess diethyl pyrocarbonate are discussed, as well as possible applications to structure determination.

Methylation of Mammalian Deoxyribonucleic Acid: III. TERMINAL VERSUS INTERNAL LOCATION OF 5-METHYLCYTOSINE IN OLIGODEOXYRIBONUCLEOTIDES FROM NOVIKOFF HEPATOMA CELL DEOXYRIBONUCLEIC ACID

Abstract DNA-pyrimidine clusters isolated from Novikoff rat hepatoma cells labeled with [methyl-14C]methionine were previously subfractionated on DEAE columns at acid pH. Each subfraction of differing over-all base composition was sequentially treated with Escherichia coli alkaline phosphatase and venom or bovine spleen phosphodiesterase. The resulting digests were analyzed for the quantity of 14C in the deoxyribonucleoside and 5'- or 3'-deoxyribonucleotide fractions. With the sole exception of the dinucleotide 5-methyl-CpT, very little 5-methylcytosine is located at the 5' terminus of pyrimidine clusters in this DNA. Most DNA-5-methylcytosine occurs at the 3' end of pyrimidine clusters although substantial percentages of label can be found internally. Solitary cytosine residues (i.e. ...PupCpPu...) are also methylated in this DNA. This relatively detailed map of 5-methylcytosine distribution in Novikoff cell DNA will be useful in examining factor (or factors) that might contribute to the observed specificity of the DNA-cytosine methyl transferase reaction.