Binet Test Research Articles

The reliability and validity of the Chinese version of dynamic occupational therapy cognitive assessment for children

Objective To study the reliability and validity of the Chinese version of the dynamic occupational therapy cognitive assessment for children (DOTCA-Ch).Methods The English version of the DOTCA-Ch was translated into Chinese. One hundred and nine students from the city of Jiamusi were assessed with the Chinese Binet intelligence test and the DOTCA-Ch. Intra-class correlation coefficients (ICCs) were used in inter-rater and intra-rater reliability assessments. Cronbach's alpha coefficient was used to assess internal consistency. Factor analysis was used to assess construct validity. Pearson correlation coefficients were used in assessing criterion-related validity. Results The total ICC of the DOTCA-Ch was 0. 892. Cronbach's alpha coefficients for the subtests were orientation 0. 713 ; spatial perception 0. 793 ; praxis 0. 850 ; visuomotor construction 0. 844 and thinking operations 0. 630. The ICC for intra-rater reliability was 0. 991 and for inter-rater reliability it was 0. 989. Using the Binet intelligence test as a benchmark, the Pearson correlation coefficient between the IQ values and the total DOTCA-Ch scores was 0. 872 for 6 year-olds, but 0. 870 for 11 and 12 yearolds. Factor analysis revealed an acceptable set of 5 common factors. Their cumulative contribution was 67％.Conclusions The Chinese version of the DOTCA-Ch is reliable and valid. It can be used as an effective measuring tool to evaluate children's cognitive functioning. Key words: Dynamic occupational therapy cognitive assessment for children ; Binet test of intelligence; Validity; Reliability; China

Associations of Ethnicity and SES with IQ and Achievement in Spina Bifida Meningomyelocele

We evaluated whether the phenotypic pattern of higher verbal than nonverbal IQ in children with spina bifida meningomyelocele (SBM) is consistent across subgroups differing in ethnicity and SES. We also explored the relation of cognitive and academic performance. Non-Hispanic White (n = 153) and Hispanic (n = 80) children with SBM received the Stanford Binet Test of Intelligence-IV and achievement subtests of the Woodcock-Johnson. Parents completed questionnaires assessing the family environment [socioeconomic status (SES), resources, and educational opportunities]. Multivariate analysis revealed that Hispanic children with lower SES had lower verbal than nonverbal scores. Hispanic children with higher SES and non-Hispanic White children demonstrated the reverse pattern. Verbal and nonverbal IQ interacted to predict reading and math performance. Lower SES is associated with lower verbal IQ in economically disadvantaged Hispanic children with SBM. Academic achievement is largely correlated with verbal IQ, but children with lower verbal IQ may partially compensate with higher nonverbal ability.

Cognitive Function and Event-Related Potentials in Children With Type 1 Diabetes Mellitus

Type 1 diabetes mellitus is associated with cognitive changes, but the extent of cognition decline depends on age at onset, duration of diabetes, and occurrence of attacks of hypoglycemia or ketoacidosis. This study was designed to assess cognitive function in a group of children with type 1 diabetes mellitus. A total of 40 diabetic children were recruited from the pediatric department of Assiut University Hospital, Egypt. Forty healthy children matched for age, sex, and socioeconomic status were chosen as controls for comparison. Cognition was assessed using Stanford-Binet and event-related potentials tests. Compared to the control group, patients reported a significant reduction in intelligent quotient, comprehension, abstract visual reasoning, quantitative reasoning, bead memory, and total short memory testing for cognitive functions. Prolonged N1, P200, N2, and P300 latencies and reduced P300-N2 amplitude were reported. Significant negative correlations were identified in most studied cognitive functions and ketoacidosis or family history of diabetes mellitus.

The Stability of IQ in People With Low Intellectual Ability: An Analysis of the Literature

A meta-analysis of the stability of low IQ (IQ < 80) was performed on IQ tests that have been commonly used--tests that were derived by D. Wechsler (1949, 1955, 1974, 1981, 1991, 1997) and those based on the Binet scales (L. M. Terman, 1960; L. M. Terman & Merrill, 1972). Weighted-mean stability coefficients of .77 and .78 were found for Verbal IQ (V IQ) and Performance IQ (P IQ) on the Wechsler tests and .82 for Full-Scale IQ (FS IQ) on both Wechsler and Binet tests, for a mean test-retest interval of 2.8 years. Although the majority of FS IQs changed by less than 6 points, 14% changed by 10 points or more. The author suggests that the results of IQ assessment should be treated with more caution than previously thought.

Hubungan berat badan lahir, pemberian ASI eksklusif, status gizi dan stimulasi kognitif dengan kecerdasan anak usia 5–6 Tahun

Background: Intellegence is affected by 2 factors, internal (genetics) and external (nutrition intake, infection, toxin, stimu- lation, environmental) factors. Sufficient nutrition is very important during pregnancy. Birth weight and exclusive breastfeeding affect brain growth and development. Malnutrition during infancy results in stunting and impaired cognitive function in children. Lack of stimulation may affect intelligence.Objective: The objective of the study was to find out the relationship among birth weight, exclusive breastfeeding, nutrition status and cognitive stimulation and intelligence.Method: An analytic observational study was conducted with cross sectional design, at kindergarten in Prambanan Subdistrict. Subjects were recruited based on a cluster random sampling technique. There were 50 children and mothers met the inclusion criteria of mothers who knew the child’s background (birth weight, breastfeeding practices) and were willing to be included in this study. Intelligence was assessed using Stanford Binet test. Data were analyzed with chi square and logistic regression tests.Results: The study showed that 76% of children had normal intelligence and 24% of children had abnormal intelligence. Based on multivariable analysis, low cognitive stimulation was a risk factor of getting low IQ score (OR=15.6; CI 95%=1.725– 141.272), whereas birth weight (OR=1.1; CI 95%=0.126– 9.751), exclusive breastfeeding (OR=4.9; CI 95%=0.494– 49.054) and nutrition status did not relate to intelligence.Conclusion: There was significant relationship between cognitive stimulation and intelligence, whereas birth weight, exclusive breastfeeding and nutrition status did not significantly relate with intelligence.

Lead and IQ in Children: Lanphear et al. Respond

As described in our original article (Lanphear et al. 2005), we decided a priori to focus our analyses on the blood lead (BPb) variable that had the strongest association with IQ (intelligence quotient) scores. This decision was made to limit the number of analyses and to minimize problems with multiple comparisons. There was a clear consensus among the co-investigators—which originally included Ernhart—to use this strategy. Because concurrent BPb concentration was the strongest predictor of intellectual functioning, we focused most of our analyses on this variable. There are now several studies indicating that concurrent or lifetime average BPb concentration are better predictors of children’s IQ scores than measures taken in early childhood (Baghurst et al. 1992; Canfield et al. 2003; Chen et al. 2005; Dietrich et al. 1993; Tong et al. 1996; Wasserman et al. 2003). Thus, existing evidence indicates that interpretation of this literature should rely on concurrent or lifetime measures of BPb concentration. Ernhart is concerned that we found no significant association of IQ and three of the four indices of lead exposure at peak BPb levels < 10 μg/dL or < 7.5 μg/dL (Lanphear et al. 2005). In addition to a significant inverse association of concurrent BPb concentration and IQ score for children with maximal BPb levels < 7.5 μg/dL, we found a consistent inverse association for lifetime average BPb concentration (β = −3.13, p = 0.054). As we reported, the relationship of peak BPb concentration and early childhood BPb concentration was not as predictive of children’s IQ scores. Ernhart is particularly concerned about our analyses for children with “very low” lead exposure (Lanphear et al. 2005). The results of our parsimonious analysis for children who had maximal BPb concentrations < 10 μg/dL and < 7.5 μg/dL were entirely consistent with the fully adjusted model. When we included all of the additional covariates, concurrent BPb concentration changed by < 5%, and it remained statistically significant (β = −2.99, p = 0.019) for the children with maximal BPb levels < 7.5 μg/dL. When we further restricted the analysis to U.S. cohorts and introduced race as a covariate, race was clearly not a significant factor, and the pattern remained similar. These secondary analyses support our original conclusion that there is an inverse relationship of lead exposure and intellectual function, with greater decrements at lower BPb concentrations (Lanphear et al. 2005). We agree that using an early measure of the HOME (Home Observation for Measurement of the Environment) inventory (Caldwell and Bradley 1984) in the Rochester cohort was a potential limitation. Still, when we excluded the Rochester cohort from the pooled analysis, the coefficient changed by < 3% and remained statistically significant (Lanphear et al. 2005). Thus, this limitation did not alter the conclusions of the study. Ernhart is critical about the “peculiar” increase in sample size and shifts in demographic variables in the Rochester study. Although some families became “too busy” to participate when their children were toddlers, we routinely invited them to participate in subsequent visits. A larger number of families were willing to return for an evaluation as their children aged. We conducted a secondary analysis of studies that included prenatal BPb concentration. Contrary to Ernhart’s comment, prenatal lead exposure was not significantly associated with children’s IQ scores in adjusted analyses (Lanphear et al. 2005). We concluded that “prevention of lead exposure must occur before pregnancy or a child’s birth” (Lanphear et al. 2005) because children are particularly vulnerable to lead intake and absorption during the first 2–3 years of life (Clark et al. 1985; Lanphear et al. 2002; Ziegler et al. 1978). Ernhart argues that her request for further information about the 6-year data from the Rochester study “was denied.” The earlier measures of intellectual function in the Rochester children (i.e., at 3 and 5 years of age) were measured using the Stanford Binet test (Canfield et al. 2003). The IQ test at 6 years of age, which was measured using the Wechsler Preschool and Primary Scales of Intelligence, was done specifically for the pooled analysis. We believed that it was in the best interest of public health to confirm the findings of the original Rochester study with the larger pooled analysis rather than await publication of the follow-up 6-year IQ tests. Numerous studies have found evidence for adverse consequences of childhood lead exposure at BPb levels < 10 μg/dL (Bellinger and Needleman 2003; Chiodo et al. 2004; Fulton et al. 1987; Lanphear 2000; Sood et al. 2001; Walkowiak et al. 1998; Wasserman et al. 2000). These studies provide sufficient evidence that childhood lead exposure should be reduced even more by banning all nonessential uses of lead and further reducing the allowable levels of lead in air emissions, house dust, soil, water, and consumer products.

The Disappearing Bell Curve

The way in which we determine the population distribution of intellectual ability is an important issue for the field of gifted education because it greatly influences decisions we make about identification, justifications for provision of (limited availability) services, numbers to be served, and ultimately assumptions about the distinctive needs of one group in contrast to others. We are a field based on the notion of attending to individual differences; hence, our beliefs about the distribution and nature of these differences are fundamental to our practice. The Construction of the Bell Curve The bell curve is so frequently used to describe the distribution of intelligence that we seem to have forgotten that it is a construction, rather than an empirical fact. In 1733, Abraham DeMoivre developed the concept of the normal curve through his work with Stirling's formula. Pierre Simon de Laplace and Karl Friedrich Gauss, both active in the early 19th century, used the normal curve in different domains, ranging from calculating hospital mortality rates to evolution (Boyer, 1999; O'Connor & Robertson, 1999). Their work provided empirical support for the appropriateness of the normal curve as the expected distribution of data for the various domains they studied. Sir Francis Galton, in the latter half of the 19th century, used statistics to explore the distribution of mental and physical characteristics and also found the normal curve to approximate the distribution of characteristics. Through Galton's work, the application of the bell curve to human intelligence became inextricably connected, despite t he fact that he measured simple reaction times and physical features, rather than higher psychological processes. Working in France, Binet read of Galton's theories of a general intelligence and decided that testing an array of intellectual abilities would best capture general intellectual functioning. Binet's initial goal in developing an intelligence test was to have a means of identifying children who were in need of remediation or alternative schooling. Through his extensive research, Binet had come to realize that complex mental activities, rather than simple measures of intelligence such as reaction times, provided the best opportunity for distinguishing intellectual ability levels. Building on the work of Dr. Blin and his student Demaye (Binet & Simon, 1905b), who had come to realize the value of a test that included items too difficult for all students to master, Binet's test methodically sorted students based on their ability to complete items successfully. In constructing the test, Binet and Simon set items at a particular age level based on whether 75% of the students of that age would pass it (Freeman, 1962) . Additionally, each item was expected to be passed by those students who overall were chronologically older and of normal or high ability (Aiken, 1994). In developing classifications of subnormal Binet's assertion was that one must first establish how a normal child replies (Binet & Simon, 1905a, p. 73). Although seems self-evident, during the early 20th century Binet's use of the comparative approach, one he had gained from the natural sciences, was not the norm. Binet's approach to standardization is still the norm today (Freeman, 1962). From Classification to Quantification Binet's goal was to develop a measuring scale of intelligence, but he warned that this scale, properly speaking, does not permit the of the because intellectual qualities are not superposable, and therefore cannot be measured as linear surfaces are measured, but are, on the contrary, a classification, a hierarchy among diverse intelligences; and for the necessities of practice classification is equivalent to a measure (Binet & Simon, 1905a, p. 40-41). The distinction of whether intelligence scores serve to classify or has become increasingly blurred over time by the change in terms used to describe individual results and the popularization of Stevens' scales of measurement (Stevens, 1946), which appeared to support the assumptions required to make those changes. …

A Case of Unverricht‐Lundborg Type Progressive Myoclonus Epilepsy Confirmed by Cystatin B Gene Mutation

Purpose: Detection of an expansion of a minisatellite repeat unit in the promoter region of the cystatin B gene confirmed thc diagnosis of progressive myoclonus epilepsy or Unverricht‐Lundborg type in a 31‐year‐old Japanese male. Care history: The patieut was a child of a non‐consanguineous marriage without family history of epilepsy, born uncvcntfully at term. Development was normal until 8 years of age. Febrile seizures had onset at age I, and seizures recurred at age 5. At age 8, the patient expcrieuced chest discomfort during exercise. Evaluation included an EEG, which revealed photosensitivity. Finger trcmor and myoclonus were noted by age 10. Generalized tonic‐clonic seizures (GTC) occurred upon awakening 1–2 times per month. Generalized myoclonus progressed with consequent stumbling or fdling. Initially, stumbling wits while running, but by age 12, even while walking. He was unablc to walk by himself by age IS. At the time of institutioiialization at age 18, hc was awkward i n writing and had difficulty in eating without aasistance. Mental deterioration was mild. Characteristics of myoclonus: Myoclonus appeared in all muscles, usually asynchronously but synchronously when exaggerated, and required him to grip the arms of his wheelchair to avoid flinging extremities or jumping up from thc chair. Eye‐opening, mental stress, photic or tactile stimuli, and intentional movcmcnts all activated myoclonus. Slccp suppressed myoclonus, but generalized myoclonus was marked upon awakening, and sometimes evolvcd to GTC. Neurological findings: Neither sensory disturbance nor wcakncss was noted. Marked activation of myoclonus made examination of cerebellar function difficult, but nystagmus was not observed. IQ was 70 by the Binet test at age 17, and Verbal IQ by the WISC‐R was 56 at age 3 I. MRI showed slight dilatation of both cerebral and cerebellar sulci. Neurological findings: (1) Interictal EEG demonstratcd multifocal small spikes over bilateral frontal, central, or occipital acas, but no diffuse spike‐waves. During wakefulncss when myoclonus often obscured the underlying EEG, spikes were too small to be recognizcd but slightly increased in the light sleep. (2) Myoclonua did not often accompany spikes, but sometimes appeared 10–20 msec behind small focal spikes. (3) 8–18 Hz photic stimuli markedly activated myoclonus from eyc lids to the whole body and sometimes progressed to GTC. (4) Ictal EEG of photosensitive gcneralizcd seiiures suggested 2 types; cpilcptic GTC and extremely exaggerated and sustained gcneralizcd myoclonus. (5) Giant visual evokcd potcntials (VEP) with amplitude of &gt;50 KV werc seen by age 23 and subsequently decreased in amplitudc. Somatosensory evoked potentials (SEP) also showcd high amplitude at age 31. Gene cinalysis by Southern blot: Genomic DNA from the patient and his parents was digcsted by Pstl and electrophoresed in a agarose gel, then transferred to a nylon membrane, which was hybridized with the probe made by PCR‐amplification of the 5′‐flanking region of cystatin B gene of a normal Japanese individual using the primers, Y7 (S TCGGCGCCCGGAAAGACGATACCA‐3′) and Y8 (5′‐AGGG‐ GACGCGGCGGCTCCTCAG‐3′). A 2.6 Kb band was seen in normal controls, but a single band of 3.4–3.5 Kb was observed in the patient. A 3.4–3.5 Kb band in addition to a normal 2.6 Kb band was observed in his parents indicating carrier of the cxpanded allele. Conclusion: This genetically confirmed case suggested characteristics of Unverricht‐Lundborg disease; (1) febrile GTC occurred at age 1, but his onset of epilepsy could be considered to be at age 8. Progression was rapid around age 10–15 but extremely slow thereafter. (2) Despite dysarthria and motor dysfunction due to marked action myoclonus or tremor, mental deterioration was relatively mild. (3) After adolescence, EEG worsening also was extremely slow in both background activity and multifocal small spikes, which did not often correspond to myoclonus. (4) Giant SEP and VEP may bc an objective indicator of cortical hyperexcitability, which may gradually decline aftcr its peak n adolcscencc. Charncteristics

Growth of Cognitive Abilities: Dynamic Models and Scaling

A dynamic model of cognitive growth, proposed by van Geert, has been extended in three different directions. (A) A term has been added to take into account external driving forces, that is, exposure to material to be learned. (B) A method has been developed to apply the model to cross-sectional studies. (C) Using ideas of Item Response Theory, a procedure has been developed to use the model to scale tests of cognitive abilities that consist of questions of varying difficulty. The model we use is an attempt to understand cognitive growth as the result of two driving forces: namely, the autocatalytic force proposed by van Geert that is due to processes internal to the person, while the other force is an external force and due to exposure to the material to be learned. Using the model, it is possible to derive a distribution function, g(d;t), that gives the fraction of correct responses by examinees of age t to questions of difficulty d. The model is tested by fitting the theoretical distribution function with the observed distribution of scores obtained by the testing of a large group of children ages 2 to 15 years on a Stanford–Binet test.

The Dutch curve: The introduction and reception of intelligence testing in the Netherlands, 1908–1940

In the Netherlands, intelligence testing has been pragmatic and has not generated the heated controversies found in other cultures. Four historical reasons are presented for this paradoxical development. First, the Binet test was used mainly as a diagnostic instrument for professional judgments about admission to special education. Second, the eugenic use of IQ tests was moderated by the marginal position of eugenics in Dutch society. Third, the process of pillarization gave considerable power to denominational groups in Dutch society, and they strongly criticized deterministic ideas about the heredity of intelligence. Fourth, the educational scientist, cognitive psychologist, philosopher, and government adviser, Philip Kohnstamm, was very influential in Dutch science and politics. He rejected intelligence testing and its deterministic connotations in favor of the idea of the educability of cognitive capacities.

A Reconceptualization of the Effects of Undernutrition on Children's Biological, Psychosocial, and Behavioral Development and commentaries

A Reconceptualization of the Effects of Undernutrition on Children's Biological, Psychosocial, and Behavioral Development and commentaries

Increasing the Validity of Cross-Cultural Assessments: Use of Improved Methods for Test Adaptations 1Laboratory of Psychometric and Evaluative Research Report No.275. Amherst, MA: University of Massachusetts, School of Education. Paper presented at the 23rd International Congress of Applied Psychology, Madrid, 1994.

Translating or adapting psychological and educational tests from one language and culture to other languages and cultures has been a common practice for almost a hundred years, beginning with Binet's test of intelligence. Despite the long history and the many good reasons for adapting tests, proper methods for conducting test adaptations and establishing score equivalence are not well known by psychologists. The purpose of this paper is to focus attention on judgmental and statistical methods and procedures for adapting tests with special focus on procedures for identifying poorly adapted items. When these methods are correctly applied, the validity of any cross-cultural uses of the adapted test should be increased.

After Binet: French intelligence testing, 1900-1950.

This article (based on published writings of the researchers plus unpublished data and reports in recently opened archives) examines why Alfred Binet's concept of multifaceted intelligence requiring lengthy and varied testing continued and flourished in the 1920s and 1930s in the laboratories of Henri Pieron, Henri Laugier and other French psychologists and psychotechnicians. While the Americans and British evolved theories and practices of intelligence measurement reducible to a single number, most French psychologists used a much more subtle and complex understanding of the phenomenon. This hindered mass applications of intelligence tests which did not occur in France until the end of the Second World War. The Terman version of Binet's test did not re-enter France until 1950.

Race, Region, and Education: An Analysis of Black and White Scores on the 1917 Army Alpha Intelligence Test

In 1917 the United States Army sponsored the most sweeping application of standardized testing then yet attempted. Using an instrument modeled after Lewis Terman's modified version of the Binet test (the well known Stanford-Binet test), the Army administered tests to some 1,750,000 men, most of them draftees, under the direction of a team of psychologists headed by Harvard University professor Robert M. Yerkes. From the standpoint of these psychologists, the Army testing program was seen as a grand opportunity to measure systematically the general of American men-and to identify critical points of variation in performance from one social group to another. These men were concerned to see whether their own theories of variability in intelligence would hold up in the face of such a massive application of a single series of tests.' As it turned out, they must have been satisfied. The group with the highest median scores was native whites, followed in descending order by immigrant whites and native (particularly Southern) blacks. While the average white mental age, as determined by

Social Deviance and the ‘Discovery’ of the Moron

ABSTRACT American psychologist Henry H. Goddard's introduction of the Binet test in the United States was hailed by contemporaries as a major advance in diagnostic technique. With it he ‘discovered’ the moron, who was believed to suffer from a mild type of mental deficiency that had previously been unidentified. But Goddard had actually grafted his new classification onto an older tradition that was based on social judgments about what constituted normal behaviour. This paper describes the social context of Goddard's discovery along with the assumptions and methods that resulted in his ‘scientific’ confirmation of the earlier, socially constructed prototype.

Correlations of Scores of Low Vision Children on the Perkins–Binet Tests of Intelligence for the Blind, the Wisc–R and the Wrat

The purpose of this study was to examine the correlation of the Perkins–Binet Tests of Intelligence for the Blind, Form U; the Wechsler Intelligence Scale for Children—Revised (WISC–R), Verbal Scale; and the Wide Range Achievement Test (WRAT). These three tests were administered to 52 low vision children in the third, fifth, seventh, and ninth grades in residential and day school programs in Ohio. Means and standard deviations were computed for scores at each grade level and for the total group. Results indicated that the mean ten scores on the two tests of intelligence were significantly different. In addition, there was a moderate correlation of the WISC–R with the WRAT but only a low correlation of the Perkins–Binet with the WRAT. Implications of these results are discussed and recommendations are made for further research.

Interaction of young children on a ward for physically handicapped as demonstrated by the present game.

Conducted the "present" game with 25 children who ranged in age from 4-6 to 9-10 and who were residing on a ward for the physically handicapped. The game was played 10 times; each session lasted 15 minutes. Children who received the present most frequently had fewer behavioral problems, had been hospitalized longer, had higher IQs on the WISC, Binet, and simplified tests developed in Japan, and had better use of their lower extremities than did other patients.

87 LINGUISTIC DEVELOPMENT BETWEEN 12 AND 24 MONTHS: A COGNITIVE PREDICTOR

The ages of attainment of expressive language milestones were elicited from parents of 96 middle class children at each well child visit from birth to 24 months. Mean frequency of milestone recall was 83%. Stanford Binet (SB) and Peabody Picture Vocabulary Tests (PPVT) were administered at 36 months of age: IQscores (mean ± SD) were 114 ± 11 and 112 ± 14, respectively. Pearson product-moment correlation coefficients between each milestone and test are noted in the Table.The ages of attainment of these milestones show a significant inverse correlation, p<.05, with three-year cognitive and language ability. Similar significant correlations were noted with the Vineland, Griffith and subtests of the McCarthy Scales. Sequential milestones of increasing vocabulary sizeand phrase complexity under two years can aid in early prediction of intellectual function.

100 HEARING IMPAIRMENT IN LOW BIRTH WEIGHT (LBW) CHIL DREN

Audiometric tests (tympanogram, acoustic reflex, and pure tone) were performed at 3-5 years of age on 41 LBW ( 0.21 ≥20 days and low risk (Group II, n=18) with FiO2 >0.21 ≤6 days. Group I had a more severe neonatal course with more asphyxia (Apgar ≤4 at 1 min.) (p<.02), acidosis (p<.01), BPD (p<.01), sepsis (p<.01) and days of hospitalization (M±SD) 92±28 vs. 62±15 (p<.01). The groups had a similar socioeconomic scale rating. Audiometric testing revealed 16/23 (62%) of Group I had conductive hearing loss compared to 7/18 (38%) of Group II (p<.01). The children with conductive hearing loss had a greater incidence of respiratory morbidity (pneumonia, otitis media or chronic wheezing) between 4 months and 3 years (p<.01). Sensorineural loss was identified in 2 children in Group I and 1 child in Group II. Moderate to severe hearing loss (conductive or sensorineural) (≥40 dB) was greater in Group I (9 of 23) than Group II (1 of 18) (p<.02). Bayley MDI scores and Stanford Binet tests of the hearing loss children vs. normal hearing children revealed no significant differences between 9 months and 3-4 years. We conclude that LBW survivors with a more severe neonatal course are at significant risk of developing conductive hearing loss although the latter, per se, did not adversely affect the developmental test scores of the LBW survivors.

Double Perspective

We thought our son was advanced even as a baby, but as we had no other children we weren't sure. He began to cross-country ski with us when he was two, and learned to ice skate from a children's instructor at four. Now, at seven, he's on a pee-wee hockey team and won an award this past season. We didn't know much about school programs and enrolled him without question in first grade. The following spring (he turned 6 in April) we took him for an independent evaluation at a university connected child study center. We were rather astounded by the findings. On the Binet test our son was found to have an IQ of 150. On an achievement-type test his placement looked like this: Math—grade 5.3, Word Recognition—grade 6.4, Reading Comprehension—grade 4.1, and Spelling—grade 4.2. On a silent reading test, he got a grade level score of 5.8. We arranged a conference with his school principal and teacher and took the report. We felt our son ought to be given more to do as he'd been getting very restless. His teacher wouldn't even read the report as she said she didn't want to be swayed by information other than her own. The principal read it and said that tests didn't tell everything. They both said our son was becoming a behavior problem in the classroom and he shouldn't be given any advanced work until he could learn to control himself. They put him in second grade. Now at age 7, he's not interested in school, doesn't want to do anything hard. His teacher says he is worse than ever and he should be kept back in second grade until he learns to control himself. He has become disobedient and refuses to work at his assignments. We feel desperate. What can we do?