A Case of Unverricht‐Lundborg Type Progressive Myoclonus Epilepsy Confirmed by Cystatin B Gene Mutation

Abstract

Purpose: Detection of an expansion of a minisatellite repeat unit in the promoter region of the cystatin B gene confirmed thc diagnosis of progressive myoclonus epilepsy or Unverricht‐Lundborg type in a 31‐year‐old Japanese male. Care history: The patieut was a child of a non‐consanguineous marriage without family history of epilepsy, born uncvcntfully at term. Development was normal until 8 years of age. Febrile seizures had onset at age I, and seizures recurred at age 5. At age 8, the patient expcrieuced chest discomfort during exercise. Evaluation included an EEG, which revealed photosensitivity. Finger trcmor and myoclonus were noted by age 10. Generalized tonic‐clonic seizures (GTC) occurred upon awakening 1–2 times per month. Generalized myoclonus progressed with consequent stumbling or fdling. Initially, stumbling wits while running, but by age 12, even while walking. He was unablc to walk by himself by age IS. At the time of institutioiialization at age 18, hc was awkward i n writing and had difficulty in eating without aasistance. Mental deterioration was mild. Characteristics of myoclonus: Myoclonus appeared in all muscles, usually asynchronously but synchronously when exaggerated, and required him to grip the arms of his wheelchair to avoid flinging extremities or jumping up from thc chair. Eye‐opening, mental stress, photic or tactile stimuli, and intentional movcmcnts all activated myoclonus. Slccp suppressed myoclonus, but generalized myoclonus was marked upon awakening, and sometimes evolvcd to GTC. Neurological findings: Neither sensory disturbance nor wcakncss was noted. Marked activation of myoclonus made examination of cerebellar function difficult, but nystagmus was not observed. IQ was 70 by the Binet test at age 17, and Verbal IQ by the WISC‐R was 56 at age 3 I. MRI showed slight dilatation of both cerebral and cerebellar sulci. Neurological findings: (1) Interictal EEG demonstratcd multifocal small spikes over bilateral frontal, central, or occipital acas, but no diffuse spike‐waves. During wakefulncss when myoclonus often obscured the underlying EEG, spikes were too small to be recognizcd but slightly increased in the light sleep. (2) Myoclonua did not often accompany spikes, but sometimes appeared 10–20 msec behind small focal spikes. (3) 8–18 Hz photic stimuli markedly activated myoclonus from eyc lids to the whole body and sometimes progressed to GTC. (4) Ictal EEG of photosensitive gcneralizcd seiiures suggested 2 types; cpilcptic GTC and extremely exaggerated and sustained gcneralizcd myoclonus. (5) Giant visual evokcd potcntials (VEP) with amplitude of >50 KV werc seen by age 23 and subsequently decreased in amplitudc. Somatosensory evoked potentials (SEP) also showcd high amplitude at age 31. Gene cinalysis by Southern blot: Genomic DNA from the patient and his parents was digcsted by Pstl and electrophoresed in a agarose gel, then transferred to a nylon membrane, which was hybridized with the probe made by PCR‐amplification of the 5′‐flanking region of cystatin B gene of a normal Japanese individual using the primers, Y7 (S TCGGCGCCCGGAAAGACGATACCA‐3′) and Y8 (5′‐AGGG‐ GACGCGGCGGCTCCTCAG‐3′). A 2.6 Kb band was seen in normal controls, but a single band of 3.4–3.5 Kb was observed in the patient. A 3.4–3.5 Kb band in addition to a normal 2.6 Kb band was observed in his parents indicating carrier of the cxpanded allele. Conclusion: This genetically confirmed case suggested characteristics of Unverricht‐Lundborg disease; (1) febrile GTC occurred at age 1, but his onset of epilepsy could be considered to be at age 8. Progression was rapid around age 10–15 but extremely slow thereafter. (2) Despite dysarthria and motor dysfunction due to marked action myoclonus or tremor, mental deterioration was relatively mild. (3) After adolescence, EEG worsening also was extremely slow in both background activity and multifocal small spikes, which did not often correspond to myoclonus. (4) Giant SEP and VEP may bc an objective indicator of cortical hyperexcitability, which may gradually decline aftcr its peak n adolcscencc. Charncteristics