Benign Proliferative Disease Research Articles

Mapping and Analysis of Protein and Gene Profile Identification of the Important Role of Transforming Growth Factor Beta in Synovial Invasion in Patients With Pigmented Villonodular Synovitis.

Pigmented villonodular synovitis (PVNS) is a rare benign proliferative disease affecting the soft-tissue lining the synovial joints and tendons. Its etiology is poorly understood, largely limiting the availability of current therapeutic options. Here, we mapped the synovial gene and protein profiles of patients with PVNS, revealed a link between synovial inflammation and invasion, and elucidated the potential molecular mechanism involved. The expression of synovial genes from 6 control individuals, 7 patients with osteoarthritis (OA), and 19 patients with PVNS was analyzed via RNA sequencing. Protein profiles from 5 control individuals, 10 patients with OA, and 32 patients with PVNS were analyzed using label-free proteomics. Microarray and reverse transcription-polymerase chain reaction analyses and immunohistochemical staining were used to evaluate inflammatory cytokine and target gene expression levels in synovial tissue, epithelial cells, and synovial fibroblasts (FLSs) derived from tissue of patients with PVNS. Various signaling pathway inhibitors, small interfering RNAs, and Western blots were used for molecular mechanism studies. Transwell migration and invasion assays were subsequently performed. In total, 522 differentially expressed proteins were identified in the tissues of patients with PVNS. By integrating RNA sequencing and microarray analyses, significant changes in the expression of epithelial-mesenchymal transition (EMT)-related genes, including transforming growth factor TGF-b induced, neural cadherin, epithelial cadherin, SNAIL, and TWIST, were confirmed in the tissue of patients with PVNS compared to the control tissue. In vitro, TGFβ induced EMT and increased epithelial cell migration and invasion. Moreover, TGFβ not only promoted interactions between epithelial cells and FLSs but also directly increased the migration and invasion abilities of FLSs by activating the classical Smad2/3 and nonclassical JNK/AKT signaling pathways. This study provides overall protein and gene profiles of PVNS and identifies the crucial role of TGFβ in synovial invasion pathology. Exploring the related molecular mechanism may also reveal a new strategy or target for PVNS therapy.

OUTCOMES OF TENOSYNOVIAL GIANT CELL TUMOUR OF THE FOOT AND ANKLE

BackgroundTenosynovial giant cell tumour (TGCT) is a benign proliferative disease affecting synovial membranes. There are two forms, localised and diffuse, which although histologically similar are managed differently. It is locally invasive and is treated in most cases by operative excision. The aim of this study was to assess outcomes from the largest single-centre experience to date in patients with this condition.MethodsA retrospective analysis of 123 cases was performed in patients treated between 2003 and 2019 with TGCT of the foot and/or ankle. Data was collected on age at presentation, radiological pattern of disease, location of disease, treatment provided and recurrence rates. The minimum follow-up was 2 years with a mean of 7.7 years.Results47 male and 76 female patients with a mean age at diagnosis of 39 (range, 11–76) years were identified. 85 (69.1%) cases were categorised as localised and 38 (30.9%) were diffuse. Half of the cases presented in the ankle (62/123, 50.4%). 89% (110) of patients underwent open operative excision of the lesion. Radiotherapy was used in 2 cases for recurrent disease. Pain was the most common postoperative symptom which developed in 20% (22/110) of cases). 13 cases were managed nonoperatively where symptoms were minimal, with one case requiring surgery at a later date. Disease recurrence was 3.5% (3/85) in localised disease and 36.8% (14/38) in diffuse disease giving an overall recurrence rate of 13.8% (17/123).ConclusionThe outcomes of TGCT management are dependent on the type of disease, the extent of preoperative erosive changes and the presence of pre-operative pain. We present a summary of recommended management based on the experience from this single tertiary centre.

Comorbidity and syntropy of benign proliferative diseases of the female reproductive system: non-genetic, genetic, and epigenetic factors (review)

Comorbidity and syntropy of benign proliferative diseases of the female reproductive system: non-genetic, genetic, and epigenetic factors (review)

Outcomes of Tenosynovial Giant Cell Tumor of the Foot and Ankle.

Tenosynovial giant cell tumor (TGCT) is a benign proliferative disease affecting synovial membranes. There are 2 forms, localized (L-TGCT) and diffuse (D-TGCT), which although histologically similar behave differently. It is locally invasive and is treated in most cases by operative excision. The aim of this study was to assess current practice, how the patients' presentation affected their outcome, as well as review the recurrence rates and complications. A retrospective analysis of 123 cases was performed in patients treated between 2003 and 2019 with TGCT of the foot and/or ankle. Data were collected on age at presentation, radiologic pattern of disease, location of disease, treatment provided, and recurrence rates. The minimum follow-up was 2 years with a mean of 7.7 years. There were 61.7% female patients with a mean age of 39 (range, 11-76) years. L-TGCT accounted for 85 (69.1%) cases and D-TGCT for 38 (30.9%). The most prevalent preoperative symptoms were a palpable mass (78/123) and pain (65/123). Radiologically confirmed recurrence in the operative group was noted in 14.5% (16/110) cases. This comprised 4% (3/75) of operatively treated L-TGCT and 37% (13/35) of operatively treated D-TGCT. Patients with pain on presentation and those with erosive changes on presenting magnetic resonance imaging (MRI) were more likely to have persistent postoperative pain (P < .001 for both). Where patients had both preoperative pain and erosive changes, 57.1% had postoperative pain. Thirteen cases were managed nonoperatively where symptoms were minimal, with 1 case requiring surgery at a later date. Outcomes of TGCT management are dependent on the disease type, extent of preoperative erosive changes, and presence of preoperative pain. These data are useful for counseling patients regarding the outcomes of surgical intervention and help guide the timing of intervention. Level III, retrospective cohort study.

Condyloma acuminata: An evaluation of the immune response at cellular and molecular levels.

Condyloma acuminata (CA) is a benign proliferative disease mainly affecting in non-keratinized epithelia. Most cases of CA are caused by low-risk human papillomavirus (HPV), mainly HPV 6 and 11. The aim of the current study was to highlight the candidate genes and pathways associated with immune alterations in individuals who did not spontaneously eliminate the virus and, thus, develop genital warts. Paraffin-embedded condyloma samples (n = 56) were analyzed by immunohistochemistry using antibodies against CD1a, FOXP3, CD3, CD4, CD8, and IFN-γ. The immunomarkers were chosen based on the evaluation of the innate and adaptive immune pathways using qPCR analysis of 92 immune-related genes, applying a TaqMan Array Immune Response assay in HPV 6 or HPV 11 positive samples (n = 27). Gene expression analysis revealed 31 differentially expressed genes in CA lesions. Gene expression validation revealed upregulation of GZMB, IFNG, IL12B, and IL8 and downregulation of NFATC4 and IL7 in CA samples. Immunohistochemical analysis showed increased FOXP3, IFN-γ, CD1a, and CD4 expression in CA than in the control tissue samples. In contrast, CD3 and CD8 expression was decreased in CA lesion samples. Increased levels of pro-inflammatory cytokines in HPV-positive patients compared with HPV-negative patients seem to reflect the elevated immunogenicity of HPV-positive CA lesions. Host defense against HPV begins during the early stages of the innate immune response and is followed by activation of T lymphocytes, which are mainly represented by CD4+ and regulatory T cells. The low CD8+ T cell count in CA may contribute to this recurrent behavior. Additional studies are needed to elucidate the mechanism of host defense against HPV infection in CA.

Molecular Detection of Epstein Barr Virus Co-Infection in HIV Positive Women Attending Selected Hospitals in Sokoto, Nigeria

Viral infections contribute a larger percentage of all human cancers. Epstein Barr virus (EBV) is a type of herpes virus with no clinical manifestation in majority of individuals. However, when it occurs in adulthood, it causes benign lymph proliferative disease known as mononucleosis. This study investigated the molecular detection of EBV co-infection among HIV positive women attending some selected hospitals in Sokoto, Nigeria. Questionnaires were administered on 80 consenting HIV positive women attending three selected hospitals in Sokoto to gather data on socio-demography and risk factors. Blood samples were aseptically collected by venipuncture from the HIV positive patients and EBV screening done using PCR analysis with primer +5' ACAACCACTCATGATGCCAC (Forward), 5' ACCGTGGTTCTGGACTATCT (Reverse) for Type 1 EBV (EBV-1) and primer +5' GGTAGCCTTAGGACATACTC (Forward), -5' TGGAGGGAGTCCTGTACTAT (Reverse) for Type 2 EBV (EBV-2). Result indicated that majority (63.75%) of the HIV positive women were in the age group of 21-30 years with EBV-1 having the highest occurrences of 60.7%. Co-infection of EBV among HIV positive women attending the selected hospitals in Sokoto, Nigeria was established with EBV-1 having the highest prevalence and in subjects in polygamous relationships.

Effect of Anchomanes difformis Ethanol Root Extract on Electrolyte Level of Testosterone-Induced Benign Prostatic Hyperplasia in Wistar Rats

Benign prostatic hyperplasia is the most common male benign proliferative disease; characterized&nbsp;by overgrowth of prostatic tissue around the urethra constricting the urethral opening. The study investigated the effect of Anchomanes difformis ethanol root extract on electrolyte level of testosterone induced benign prostatic hyperplasis in Wistar rats. Forty two matured male Wistar rats weighing 150-180 g were divided into 6 groups of 7 animals each and acclimatized for 7 days. Prostate was induced with 5mg/kg of testosterone for 21 days. Two animals were sacrificed and blood collected for PSA assay. Groups 4, 5 and 6 were treated with 1000 mg/kg, 500mg/kg and 250 mg/kg of the extract respectively. The testosterone induced group 3 was treated with finesteride standard control and group 2 represented the BPH induced control group, while group 1 served as normal control. The administration of the extract lasted for 21 days. The results obtained showed a non significant (P&gt;0.05) increase in Na+ (mmol/L) concentration at 1000mg/kg of plant extract Bph C group vs normal control, while the finesteride group had no effect on Na+ concentration treated with Bph C group. There was a significant (p&lt;0.05) reduction in Cl concentration at 1000mg/kg vs 5mg/kg of testosterone and 5mg/kg and finesteride, with no&nbsp;significant (p&gt;0.05) effect at 500 mg/kg Vs normal control. For K+ (mmol/L) concentration in plant treated groups, 1000 mg/kg increase significantly at 250 mg/kg. Conclusively, the results suggested, Anchomanes difformis root extract has the potential to maintain serum electrolytes in benign prostatic hyperplasia management induced by testosterone and diarrhea patients.

Actualization of differential diagnosis of chronic pelvic pain syndrome in women of reproductive age

The objective: to study the significance of the levels of tumor necrosis factor α (TNF-α) and brain-derived neurotrophic factor (BDNF) in the blood of patients with chronic pelvic pain syndrome (CPPS).Materials and methods. The examined cohort included 150 patients with CPPS, who according to the clinical manifestations were divided into groups A and B: group A (n=74) included the patients with CPPS and suspicion of endometriosis and group B (n=76) – patients with CPPS and suspicion for benign proliferative diseases of reproductive organs. The control group included healthy women (n=50).Serum TNF-α and plasma BDNF levels were investigated by enzyme-linked immunosorbent assay. A visual analog scale (VAS) was used to study pain intensity.Results. The mean concentration of TNF-α in blood serum was significantly higher in women of group A (10.76±0.55 pg/ml) and group B (14.65±0.95 pg/ml) than in the control one (5.02±0.31 pg/ml). The mean concentration of BDNF in blood plasma was higher in women in group A (1473.88±53.02 pg/ml; p&lt;0.001) and in group B (1711.65±66.79 pg/ml; p&lt;0.01) compared to the control group (1082.91±56.24 pg/ml). The levels of TNF-α (p&lt;0.001) and BDNF (p&lt;0.01) are significantly higher in the blood of patients with CPPS and suspected combined benign proliferative diseases of the reproductive organs (group B) than in patients with CPPS and suspected endometriosis (group A).Between the intensity of pain according to VAS and the level of TNF-α in the blood a direct correlation of medium strength was found (r=0.56) in patients of group A and group B (r=0.62). A strong direct correlation between the intensity of pain according to VAS and the level of BDNF in the blood was established in women of group A (r=0.74) and group B (r=0.83).Between the disease duration and the level of TNF-α in the blood of patients a direct correlation of medium strength (r=0.65) in group A and a direct strong correlation (r=0.72) in group B were determined. Between the duration of the disease and the level of BDNF in the blood of patients a direct correlation of average strength was also establishe, a strong correlation (r=0.67) was determined in group A and a direct strong correlation (r=0.78) – group B.Conclusions. Women with CPPS and suspicion of benign proliferative diseases of the organs of the reproductive system have significantly higher concentrations of TNF-α and BDNF in the blood compared to healthy women (p&lt;0.001).The existence of a direct correlation between the intensity of pain, the duration of the disease, and the levels of TNF-α and BDNF suggest the possibility of their use as objective markers of the effectiveness of diagnostic and therapeutic measures.

Management of temporomandibular joint diseases: a rare case report of coexisting calcium pyrophosphate crystal deposition and synovial chondromatosis

BackgroundThe coexistence of calcium pyrophosphate dihydrate crystal deposition (CPP) and synovial chondromatosis (SC) in the temporomandibular joint (TMJ) is rarely reported. CPP disease (CPPD) is complex arthritis synonymous with excessive pyrophosphate production and variable aberrations in mineral and organic phase metabolism of the joint cartilage, leading to local inundated CPP and crystal deposition of partially deciphered predispositions. Meanwhile, SC is a rare benign synovial joint proliferative disease of unclear etiology and has a low risk of malignant transformation. However, SC manifests severe joint disability and dysfunction because of connective tissue metaplasia of the synovial membrane, which forms cartilaginous nodules with or without calcifications or ossifications. These nodules often detach and form intra-articular loose bodies and very rarely within extraarticular spaces.Case presentationWe report the case of a 61-year-old man to expand the body of literature on these unusual coexisting arthropathies of the TMJ. The patient presented to our hospital in 2020 with complaints of pain in the right TMJ and trismus for over 6 months. Radiographic assessments of the TMJ provided a preoperative provisional diagnosis of SC. However, the histopathology of the open biopsy revealed tumor-like lesions comprising several deposits of rhomboid and rod-shaped crystals that displayed positive birefringence in polarized light, confirming a coexistence of CPPD. A second-stage operation was performed for the complete removal of the loose bodies and chalk-like lesions including synovectomy. No evidence of recurrence was recorded after a follow-up of nearly 1.5 years.ConclusionsIsolated CPPD and SC of the TMJ are prevalent in the literature however, monoarticular coexistence of these diseases is rare, due to the lack of consistency in the diagnostic criteria in clinical practice. Moreover, optimal treatment depends on several considerations. This report delineated the molecular etiopathology and underscored the need for continued deciphering of the causal mechanisms of coexisting CPPD and SC of the TMJ. In addition, the importance of confirmatory testing for accurate diagnosis, and appropriate management of these diseases were discussed.

Differential evaluation of the quality of life of women with chronic pelvic pain syndrome depending on concomitant pathologies.

The World Health Organization defines quality of life as a person’s perception of his position in life in the context of the culture and value systems in which he lives, as well as in relation to his goals, expectations, standards and problems. Today, chronic pelvic pain is considered a condition that can significantly affect the quality of life. At the same time, there are significant prospects for using this method to evaluate the effectiveness of treatment. The objective: to evaluate of changes in the quality of life of patients with chronic pelvic pain syndrome (CPPS) depending on accompanying pathologies. Materials and methods. The examined cohort included 150 patients with CPPS, who according to the clinical manifestations were divided into groups A and B: group A (n=74) – patients with CPPS and suspicion for endometriosis and group B (n=76) – patients with CPPS and suspicion for combined benign proliferative diseases of reproductive organs. The control group included healthy women (n=50).SF-36 questionnaire which involves the use of eight scales of questions to determine the level of quality of life was used to assess the quality of life.Results. A decrease in quality of life was found in all the scales of the SF-36 questionnaire in patients with CPPS. A statistically significant difference was found in all scales between A and B groups compared to the control group (p&lt;0.001).In addition, a significant difference was found in all scales of the questionnaire between the group with CPPS and combined benign proliferative diseases of the reproductive organs compared to the group with CPPS and endometriosis (p&lt;0.05). At the same time, the most significant changes were found in the scale of physical role functioning and the scale of social role functioning.Conclusions. The decrease in indicators on all scales of the SF-36 questionnaire in patients of the studied cohort confirms that CPPS significantly affects all areas of their quality of life. Significantly lower indicators were observed in the group with CPPS and combined hyperproliferative pathology compared to the group with CPPS and endometriosis (p&lt;0.05).

RUNX3 mediates keloid fibroblast proliferation through deacetylation of EZH2 by SIRT1

BackgroundKeloid is a benign proliferative fibrous disease featured by excessive fibroblast proliferation after skin injury. However, the mechanism of abnormal cell proliferation is still unclear. Herein, we investigated the mechanism of abnormal proliferation in keloids involving Sirtuin 1(SIRT1)/ Zeste Homolog 2 (EZH2)/ Runt-related transcription factor 3 (RUNX3). MethodsHE staining was used to observe the histopathological changes. Western blot was performed to detect SIRT1/EZH2/RUNX3 and cell cycle related proteins. RT-PCR detected EZH2 mRNA. After knockdown of EZH2 or overexpression of RUNX3, cell proliferation and cell cycle was analyzed. Immunoprecipitation was used to detect acetylated EZH2.ResultsThe results showed that overexpression of RUNX3 inhibited cell proliferation and arrested cell cycle at G1/S phase, whereas inhibition of SIRT1 promoted cell proliferation and G1/S phase of the cell cycle. Knockdown of EZH2 promoted the expression of RUNX3, inhibited cell proliferation and shortened the progression of G1 to S phase. Simultaneous knockdown of EZH2 and inhibition of SIRT1 reversed these effects. Inhibition of SIRT1 increased its protein stability by increasing EZH2 acetylation, thereby reducing the expression of RUNX3 and promoting cell proliferation.ConclusionsConclusively, the SIRT1/EZH2/RUNX3 axis may be an important pathway in the regulation of abnormal proliferation in keloids.

Clinical characteristics of 1330 elderly patients with voice diseases diagnosed by electronic laryngoscope

Objective:To investigate the clinical features of electronic laryngoscope in the diagnosis of senile voice diseases. Methods:Elderly patients who visited the outpatient department of Otolaryngology Head and Neck Surgery, Nanjing Drum Tower Hospital from September 2014 to September 2018 were collected. All patients came in with hoarseness. All patients were routinely diagnosed by electronic laryngoscopy and the results were analyzed. Results:A total of 1330 elderly patients aged 60 years and over were enrolled in this study, including 924 males and 406 females. There are significant differences in the distribution of various voice diseases in different genders（P<0.05）. Among male elderly patients, the top three were: 239 cases of throat malignant tumor（25.87%）, 182 cases of vocal cord benign proliferative disease（19.70%）, 147 cases of vocal cord leukoplakia（15.91%）. Among female elderly patients, the top three diseases were: 183 cases（45.07%） of vocal cord benign proliferative disease, 70 cases（17.24%） of laryngitis, 66 cases（16.26%） of vocal cord paralysis. There were significant differences in the distribution of different voice disorders among the three different age groups of elderly patients. The top three elderly patients aged 60-69 years were: 298 cases（35.06%） of vocal cord benign proliferative diseases, 132 cases（15.53%） of laryngopharyngeal malignant tumors, 104 cases（12.24%） of vocal cord paralysis. The top three elderly patients aged 70-79 years were: 91 cases（24.20%） of laryngopharyngeal malignant tumors, 57 cases（15.16%） of vocal cord benign proliferative diseases, 55 cases（14.63%） of vocal cord paralysis. The top three elderly patients aged 80 years and above were: 25 cases（24.04%） of laryngopharyngeal malignant tumors, 21 cases（20.19%） of vocal cord paralysis, 16 cases（15.38%） of the vocal cords are not closed completely. There were also significant differences in the distribution of various voice diseases among smokers（P<0.05）. Conclusion:With the acceleration of the aging of society, we should pay more attention to the voice of the elderly. The most common disease in elderly women with hoarseness is benign hyperplastic vocal cord disease. The high incidence of laryngeal malignant tumors in elderly male hoarseness patients who smoke should be paid special attention to. Electronic laryngoscope plays an important role in the diagnosis of voice diseases in elderly patients.

이개 상부의 재발성 결절성 근막염

Nodular fasciitis is a benign proliferative disease of fibroblasts and myofibroblasts in the subcutaneous tissues. It is confused with sarcoma because of its rapid growth, mitotic activity and high cellularity. It is thought to be reactive hyperplasia rather than a true tumor, but the exact cause of the nodular fasciitis is unknown. Nodular fasciitis rarely occurs in the auricular region. To our knowledge, less than 20 cases in ear have been reported to date. Furthermore, until now there have been no reports of such a case in supraauricular region. We report a case of recurred nodular fasciitis that occurred in a supraaucricular region with a literature review.

Rosai-Dorfman disease of the central nervous system: A clinical, radiological, and prognostic study of 12 cases.

Rosai-Dorfman disease (RDD) is a rare benign non-Langerhans cell histiocytic proliferative disease. RDD with central nervous system (CNS) involvement (CNS-RDD) is extremely rare. Its etiology is unclear, and there are no consensus recommendations for its treatment. More studies are needed to elucidate the clinical and radiological manifestations and prognosis of CNS-RDD. From January 2012 to June 2022, 12 patients with CNS-RDD (intracranial or spinal) were retrospectively evaluated, including collecting clinical data, imaging data, and pathological findings; summarizing imaging characteristics; and conducting follow-up studies on CND-RDD patient treatment and prognosis. Twelve CNS-RDD patients (nine male and three female patients, aged 12-67 years) were enrolled in this study. Nine patients represented convex and/or skull base RDD (eight with edema, six with lobulation and/or pseudopodium sign, four with multiple intracranial lesions), two patients had parenchymal RDD, and one patient had spinal cord subdural lesions. Symptoms of patients would vary according to the locations of the lesion, including but not limited to headaches, dizziness, seizures, cranial nerve dysfunction, and visual impairment. The immunohistochemistry of RDD showed positive expression of S100 and CD68 but not CD1a. Total resection (n = 7), subtotal resection (n = 3), partial resection (n = 1), and stereotaxic biopsy (n = 1) were achieved, respectively. A combination of chemotherapy plus steroid therapy was performed on two patients (relapsing case and residual lesion) and showed a remarkable effect. CNS-RDD, as a rare disease, presents a significant diagnostic challenge for clinicians. Solitary CNS-RDD are easily misdiagnosed as meningioma. However, when the MRI imaging of the disease represents dura-based masses with significant edema, homogeneous enhancement, lobulation, and/or pseudopodium sign, we should consider it might be the CNS-RDD. Surgery is an important and effective therapy for CNS-RDD. Steroids and chemotherapy are safe and effective for the postoperative treatment of relapsing cases or residual lesions.

Diffuse-type Tenosynovial Giant Cell Tumor Invading the Temporal Bone: Three Cases.

Diffuse-type tenosynovial giant cell tumor (D-TSGCT) is a destructive benign tumor-like proliferative disease that occurs in synovial tissue characterized by villous nodular hyperplasia of joints, tendon sheaths, and synovium. D-TSGCT invading the temporal bone originating from the temporomandibular joint (TMJ) is very rare. Here, we report 3 cases of temporal bone D-TSGCT originating from the TMJ. The tumors in the three cases were originating from the TMJ and further invading the middle ear, the carotid foramen or the temporal lobe respectively. The second patient clearly involved the carotid foramen. The third patient clearly affected the temporal lobe. Lesions were completely removed in 3 cases, and all 3 patients were followed up for 30, 20, and 7 months, and none had recurrence. There are very few reports describing such cases. Although this report is not representative of most scenarios, there is still a potential that it provides a relatively reliable surgical idea for similar cases.

Serum 25-Hydroxy Vitamin D Level Does Not Reflect The Severity of Wart: A Cross-Sectional Study

Objective: Verruca vulgaris is a benign epithelial proliferative disease caused by human papilloma viruses. Topical and intralesional vitamin D applications are effective methods in the treatment of warts. However, the relationship between the disease and serum vitamin D levels is unclear. The correlation between the severity of the disease and serum 25-hydroxy vitamin D (25-OH vit D) levels have not been previously investigated. This study aimed to determine the relationship between serum 25-OH vit D levels and disease severity in patients with verruca vulgaris.&#x0D; Material and Methods: Serum 25-OH vit D levels were evaluated in 40 patients with verruca vulgaris and 43 sex and age-matched healthy volunteers. Serum 25-OH vit D levels were compared by grouping the patients according to the severity and duration of verruca vulgaris disease Results: There was no significant difference in serum 25-OH vit D levels between verruca vulgaris patients and the control group (p=0.760). There was no significant difference between serum 25-OH vit D level, disease severity and disease duration in the verruca vulgaris group (p =0.102, p=0.257, respectively).&#x0D; Conclusion: Serum 25-OH vit D level was not associated with verruca vulgaris. Serum 25-OH vit D levels are not related to disease severity and duration. Our data do not support vitamin D supplementation for the prevention or treatment of verruca vulgaris.

Identification and validation of HOXD3 and UNC5C as molecular signatures in keloid based on weighted gene co-expression network analysis

BackgroundKeloid is a benign proliferative disease characterized by excessive deposition of extracellular matrix collagen during skin wound healing. The mechanisms of keloid formation have not been fully elucidated, and the current treatment methods are not effective for all keloid patients. Therefore, there is an urgent need to find more effective therapies, and our research focused on identifying characteristic molecular signatures of keloid to explore potential therapeutic targets. MethodsGene expression profiles of keloid and control group samples were retrieved from the GEO database. Taking the GSE113619 dataset as the training set, the dataset collected skin tissues from non-lesion sites of healthy and keloid-prone individuals, denoted as Day0. The second sampling was performed 42 days later at the original sampling site of control and keloid groups, denoted as Day42.The 'limma' package and Venn diagram identified differentially expressed genes (DEGs) specific to keloid day42 versus day0 samples. Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG), Reactome pathway functional enrichment, and annotation of the characteristic genes were conducted on the Metascape website. Ingenuity canonical pathways, disease & function enrichment analysis and gene interaction network were performed and predicted in Ingenuity Pathway Analysis (IPA) software. Key module genes related to keloid were filtered out by Weighted Gene Co-expression Network Analysis (WGCNA). We utilized the Least Absolute Shrinkage and Selection Operator (LASSO) algorithm to screen the characteristic genes in keloid by the ‘glmnet’ package. The area under the curve (AUC) of receiver operating characteristic (ROC) was utilized to determine the effectiveness of potential signatures in discriminating keloid samples from normal samples and performed by using the ‘pROC’ package. The enrich scores of 24 immune cells in each sample were calculated by the single-sample gene set enrichment analysis (ssGSEA) algorithm， and then the Gene Set Variation Analysis (GSVA) was performed. Finally, RNA from 4 normal and 6 keloid samples was extracted, and RT-qPCR and Western Blot validated the expression of characteristic genes. ResultsA total of 640 DEGs specific to keloid day42 versus day0 samples were detected. 69 key module genes were uncovered and implicated in ‘NCAM signaling for neurite out-growth’, ‘oncogenic MAPK signaling’, ‘transmission across chemical synapses’ pathways, and the mitotic cell cycle-related processes. Five characteristic genes (MTUS1, UNC5C, CEP57, NAA35, and HOXD3) of keloid were identified by LASSO, and among which UNC5C and HOXD3 were validated by ROC plot in external dataset, RT-qPCR and Western Blot in validation samples. The result of ssGSEA indicated that the infiltration of neutrophils showed a relatively higher abundance and natural killer cells with relatively low enrichment in the keloid group compared to the control group. UNC5C was correlated with more immune cells compared with other characteristic genes. ConclusionIn this study, characteristic genes associated with keloid were identified by bioinformatic approaches and verified in clinical validation samples, providing potential targets for the diagnosis and treatment of keloid.

Anterior Capsule Reconstruction in the Setting of PVNS.

Pigmented villonodular synovitis (PVNS) is a benign proliferative disease affecting tendon sheaths and synovial tissue. Pigmented villonodular synovitis in the foot and ankle has a high rate of recurrence, which can be destructive if incompletely removed. This case series analyzes functional outcomes after PVNS operative resection with an anterior ankle capsular reconstruction, using a novel technique. Three patients with PVNS underwent surgery between 2010 and 2020. The operative technique involved a posterior, midline approach for PVNS resection of the affected ankle joint, followed by a standard anterior approach for capsular excision. Subsequent anterior capsular reconstruction was performed with a regenerative tissue matrix and a bioresorbable anchoring system. Preoperative and postoperative range of motion for the ankle and subtalar joints, visual analog scale (VAS) for pain, and return to daily activities was assessed along with appropriate radiographs and magnetic resonance imaging (MRI) imaging. All 3 surgeries had a mean follow-up period of 52.3 (range, 4-123) months and resulted in successful recovery as assessed by the VAS and self-reported activity. Preoperative ankle dorsiflexion and plantarflexion along with subtalar inversion and eversion range of motion were all normal. Postoperative ankle motion and subtalar motion were not statistically different. No complications or recurrence of PVNS was observed. Further investigation is warranted to better understand the clinical outcomes of this technique designed to successfully eliminate PVNS recurrence. IV- Retrospective case series.

Cystitis glandularis- rare cause of urinary bladder mass: case report and literature review

BackgroundCystitis glandularis a rare benign proliferative disease of the urinary bladder mucosa is usually a microscopic finding and manifests rarely as a large visible macroscopic lesion of urinary bladder. Only few cases of cystitis glandularis presenting as urinary bladder mass in female patients have been reported in the literature. We are reporting a case of cystitis glandularis presenting as a urinary bladder mass in a very young female patient.Case presentation.Our patient, a young female 25 years of age presented in the Urology OPD with complaints of irritative lower urinary tract symptoms for two years and intermittent hematuria for one year. On evaluation, she was found to have a urinary bladder mass. Transurethral resection of her urinary bladder mass was done and on histopathological examination, it came out to be cystitis glandularis.ConclusionClinical presentation of cystitis glandularis is variable. It may remain asymptomatic or could present as irritative lower urinary tract symptoms, hematuria, or mucus in the urine. It is normally a microscopic finding but could also present as an overt urinary bladder mass however this has been reported rarely in the literature.

Ductal papilloma with atypical ductal hyperplasia – Understanding the importance of immunohistochemistry- A case report

Solitary intraductal papilloma of the breast is a common benign mammary proliferative disease and is the most common neoplasm associated with nipple discharge in women. Women with solitary papillomas have 1.5-2.0 times increased risk of developing invasive carcinoma. The papillary lesions of the breast include a broad spectrum of disorders from benign papilloma, atypical papilloma to papillary carcinoma. Benign papilloma on core needle biopsy has been found to have concurrent malignancy in about 3–5% of cases at excision. Solid papillomas commonly pose a diagnostic dilemma due to similarities with other ominous papillary lesions. The presence of ADH within a papilloma and/or in the surrounding breast is associated with an increased risk of recurrence or invasive carcinoma. The present study undertakes to fully describe the morphological changes occurring within the epithelial component of central papillomas and to search for factors of prognostic significance concerning recurrence, progression and differentiation of atypical ductal hyperplasia.