Amorphous Vanadium Oxide Research Articles

Structural study of amorphous vanadium oxide films for thin film microbattery

Solid-state thin film batteries (TFBs) consisting of amorphous V2O5/Pt/Ti/Si have been fabricated by specially designed dual target magnetron radio frequency (rf) and direct current (dc) sputtering systems at room temperature. It is shown that the discharge capacity of the TFBs is degraded with increasing cycle number; after 450 cycles, the capacity is dropped by ∼54% of the initial value. To investigate the degradation mechanism, the structural properties of as-deposited and cycled LiPON and a-V2O5 films are characterized by transmission electron microscopy (TEM) and x-ray diffraction (XRD) measurements. TEM and XRD results show that the as-deposited LiPON and V2O5 are amorphous. It is, however, shown that cycling causes the occurrence of crystallites (2–6 nm across) not only in the V2O5 film, but also in the LiPON film. Based on the structural and electrochemical results, the cycle-induced degradation of capacity is correlated to the structural change of the LiPON and V2O5.

Improving the Durability of Amorphous Vanadium Oxide Thin-Film Electrode in a Liquid Electrolyte

We report on the effects of depositing a protective inorganic solid electrolyte LiAlF 4 coating on amorphous V 2 O 5 electrode in terms of long-term cycling efficiency and stability of the V 2 O 5 in a liquid electrolyte. Two V 2 O 5 thin-film electrodes were fabricated for extensive cyclic durability testing in a LiClO 4 /propylene carbonate liquid electrolyte: One V 2 O 5 film had no overlying coating while the other had a protective thin film of solid lithium ion conducting LiAlF 4 . The protected V 2 O 5 exhibited improved durability in terms of constant capacity with repeated cycling up to 800 cycles, while the uncoated V 2 O 5 electrode displayed significant capacity loss. Our results demonstrate that deposition of an inorganic solid electrolyte (LiAlF 4 ) on amorphous V 2 O 5 films serves as a protective overlayer and enhances the long-term cycling efficiency and stability of the V 2 O 5 in a liquid electrolyte.

Effect of platinum co-sputtering on characteristics of amorphous vanadium oxide films

The effect of platinum co-sputtering on the characteristics of amorphous V 2O 5 films, grown by dc reactive sputtering, is investigated. The co-sputtering process influences the growth mechanism as well as the characteristics of the V 2O 5 films. Glancing-angle X-ray diffraction (GXRD), transmission electron microscopy (TEM), and Fourier transform infrared (FT-IR) results indicate that the microstructure of the V 2O 5 films is affected by the rf power of the co-sputtered platinum. In addition, it is found that the platinum co-sputtered V 2O 5 cathode film exhibits better cycleability than an undoped V 2O 5 cathode film. This is due to the absence of short-range order, which is generally present in undoped V 2O 5 cathode films. Possible explanations are given to describe the dependence of the cycleability V 2O 5 films on the platinum rf power and the growth mechanism of the V 2O 5 film.

Formation and structural characterisation of ammonium vanadyl phosphates prepared by solid state reactions of vanadyl(IV) phosphates in the presence of ammonia

The structural transformation of various vanadyl(IV) phosphates into vanadium oxide-containing crystalline (NH4)2(VO)3(P2O7)2 in the presence of ammonia-containing gas flows and under ammoxidation of toluene reaction conditions has been investigated using a coupled hot stage XRD and on-line GC apparatus. Two different types of crystalline layered NH4+-containing vanadium phosphates were generated as intermediate phases during the formation process: (i) NH4VOPO4·nH2O, n = 0.5, 2, 4, a kind of intercalation compound formed between 293 and 390 K, and (ii) β-(NH4)2(VO)3(P2O7)2, observed during a period where the temperature was held constant at 713 K. Besides the formation of these crystalline intermediates, the generation of X-ray amorphous states was noted. The final product, consisting of distorted ammonium vanadyl(IV) pyrophosphate [α-(NH4)2(VO)3(P2O7)2], additionally contains various amounts of X-ray amorphous vanadium oxides. The transformation process is discussed on the basis of the precursor structures. Measurable catalytic activity was not observed until the formation of β-(NH4)2(VO)3(P2O7)2. Increased catalytic activity is associated with the formation of α-(NH4)2(VO)3(P2O7)2 and the generation of vanadium oxide co-phases. The in situ XRD data obtained during the phase transformation and the evaluation of the simultaneously-received data on catalytic performance at different transformation stages provide a more detailed insight into the formation of an effective catalyst and its catalytic performance from the position of the bulk structure.

R&D on lithium batteries in the USA: high-energy electrode materials

Abstract Recent trends in R&D on lithium battery technology in the USA continue to focus on high-performance batteries, polymer electrolyte systems and the development and production of batteries for specialty markets. Research on sol–gel derived amorphous vanadium and manganese oxides as high capacity, high-energy electrode materials has shown these morphologies are capable of reversibly intercalating very large amounts of lithium and they are attractive cathode candidates. Methods to improve the kinetics of these positive electrodes are showing promise.

Lithium ion insertion in porous metal oxides

Sol–gel processing of transition metal oxide precursors has been used to produce porous materials of high surface area. The technique has permitted the synthesis of solid amorphous vanadium and manganese oxides that are capable of reversibly intercalating large amounts of lithium ions. Therefore, these materials may function as high capacity (500–600 mAh/g), high-energy positive electrodes in lithium batteries. Methods to improve the kinetics and the cycle performance of these positive electrodes are showing promise.

Microstructure study of amorphous vanadium oxide films

Conversion films of vanadium oxides are potentiodynamically generated on vanadium in acetate electrolyte systems at high voltages. The microstructure of the about 5 μm thin anodic films is investigated. X-ray diffraction and transmission electron microscopy indicate the films are complete amorphous. X-ray photoelectron spectroscopy (XPS) measurements show V 2p 3/2 binding energies of mixed valance vanadium sub oxides. Electron spin resonance (ESR) experiments on isolated films at 130 K point to paramagnetic V 4+ centers in a disordered octahedral oxygen surrounding.

Optical properties of thin films of amorphous vanadium oxides

The results of an experimental investigation of the optical properties of anodic vanadium oxide films are presented. It is shown that films of different phase composition (VO2, V2O5, or a mixture of two phases) can be obtained, depending on the oxidation regime, and that the absorption and transmission spectra are modified significantly in accordance. The optical properties of the oxides, whose composition is close to stoichiometric vanadium dioxide, demonstrate the occurrence of a metal-semiconductor phase transition in the amorphous films. The results presented are important both from the standpoint of technical applications of thin film systems based on anodic vanadium oxides and for more detailed understanding of the physical mechanism of the metal-semiconductor phase transition and the influence of structural disorder on the transition.

Charging Capacity and Cycling Stability of VO x Films Prepared by Pulsed Laser Deposition

The lithium ion charging capacity and cycling stability of vanadium oxide thin‐films prepared by pulsed laser deposition (PLD) are reported. PLD films were prepared at various temperatures and atmospheres from a target. The charging capacity of these films depended strongly on the substrate deposition temperature and atmosphere. The best crystalline films were grown at 200°C. Crystalline oriented films were prepared by PLD at 200°C in an oxygen environment. These films can be cycled in the voltage range between 4.1 and 2.0 V for more than 100 cycles with very little capacity loss. The specific charge capacity of the films was 340 Ah/kg when the discharge current density was 0.1 mA/cm2, which corresponds to 1.2 lithium atoms per vanadium atom. The capacity increased to 1.5 lithium atoms per vanadium atom when cycled at a current density of 0.02 mA/cm2. Amorphous vanadium oxide films with similar specific capacities were prepared by PLD in vacuum at 200°C. The capacity loss in these films was less than 2% after 100 cycles. Although thermally evaporated vanadium oxide films had similar initial capacities under the same charging conditions, they lost more than 17% of their charging capacity after 100 cycles. The improved cycle stability in the amorphous vanadium oxide films may be partially attributed to the improved surface morphology of the PLD films.

Formation of V2O5-based mixed oxides in flames

V2O5–TiO2 and V2O5–Al2O3 mixed oxide powders were synthesized in a hydrogen-oxygen flame using VOCl3, TiCl4, and Al(CH3)3 as precursors. The particle formation processes were investigated as a function of VOCl3 concentration by laser light-scattering and by collecting particles directly onto transmission electron microscopy grids. In the V2O5–TiO2 system, the oxides condense as an intimate mixture at all three VOCl3 concentrations. Spherical particles, 40 to 70 nm in diameter, are obtained. In the V2O5–Al2O3 system, chain-like particles composed of an intimate mixture of V2O5 and Al2O3 form at the lowest VOCl3 concentration. At high VOCl3 concentrations, the chain-like particles have a core-mantle structure (a core mainly of Al2O3 and a mantle mainly of V2O5). The crystalline form and the surface area of these mixed oxides were determined by x-ray diffractometry, FT-IR spectroscopy, and BET analysis by nitrogen desorption. These measurements indicate that amorphous vanadium oxide forms at low VOCl3 concentrations, and V2O5 is obtained at the higher VOCl3 concentrations. The structure of the amorphous vanadium oxide matches that published for vanadium oxide “supported” catalysts.

Electrochromism of vanadium-titanium oxide thin films prepared by spin-coating method

Electrochromic properties of V2O5-TiO2 thin films prepared by a spin-coating method were strongly dependent on the film compositions and heat-treatment temperatures. It was found that the nearly amorphous film of V2O5-TiO2 (3:7 in molar ratio) heat-treated at 400 °C showed coloration to reddish brown when polarized at −0.8 V vs SCE. This new coloration was concluded to be ascribable to amorphous vanadium oxide.

Synthesis of Amorphous Vanadium Oxide from Metal Alkoxide

Amorphous vanadium oxides were synthesized by the hydrolysis of tri-n-butoxy vanadile, and three types of products, gel, green precipitates and red precipitates were obtained. These products were characterized by scanning electron microscopy (SEM), X-ray diffraction (XRD), infrared absorption spectroscopy (IR), thermogravimetric-differential thermal analysis (TG-DTA) and chemical analysis. Properties of the products were correlated to the synthetic conditions, and the mechanisms of the formation of each product are proposed. (1) Gel has a network structure. It is formed when hydrolysis followed by condensation proceeds on three substitutional groups of tri-n-butoxy vanadile, (2) green precipitates are formed when the condensation reaction is inhibited. They are the aggregates of particles with small molecular weights and have short structure units with hydroxide groups at their ends, (3) red precipitates are caused by insufficient proceeding of hydrolysis. They have many alkoxy groups in their structure units and their molecular weights are between those of gels and green precipitates.

Electrochemical behaviour of amorphous V 2O 5(-P 2O 5) cathodes for lithium secondary batteries

The electrochemical behaviour of amorphous vanadium oxides (a-V 2O 5 and a-V 2O 5-P 2O 5) cathodes in lithium cells has been investigated. The reversibility of the cathodes is superior to that Of c-V 2O 5 and the cathodes can operate for > 300 cycles. The relationship between cathode composition and cycle performance has been determined, and P 2O 5, as a network-former, has been found not to harm the reversibility of cathodes. The degradation in capacity with cycling of the Li/a-V 2O 5(-P 2O 5) system is due to deterioration of the anode, i.e., an increased polarization on discharge.

Amorphous vanadium oxide catalyst surface selective in the ammoxidation of 3-picoline

which is free of recognition sites of the restriction enzymes so far tested. We assume that this core sequence has been amplified many times and altered by successive random deletions. Such a satellite is likely to be AT-rich, terminally located, and rapidly reassociating, as observed here. It would furthermore show such restriction enzyme recognition sites as can arise by random deletion. In the particular case of serially repeated ATCGGAATATCGTTTCGGAT, the recognition sequences GANTC (Hinf I), GATC (Sau 3A), TCGA (Taq I) and GAATTC (Eco RI) can arise through single deletions. These sequences would be randomly spaced on the DNA so that a restriction digest of satellite DNA would give rise to a smear. To account for the fraction of satellite DNA which is not cleavable at all by restriction enzymes, we propose that the terminal stretches of serially repeated sequences have not been altered. This would be the case if amplification were a continuing process, so that the most terminal copies of the repeat unit would be young in evolution. We are currently sequencing shotguncloned fragments of P. equorum gll sat DNA. We expect to find the underlying repeated sequence(s) as one exists in the gll sat DNA of A. suum. We are particularly interested in determining whether this repeat unit contains, like the A. suum monomer an interrupted inverted repeat. This would support the hypothesis [2, 5] that interrupted inverted repeats within the sat DNA are functional sites of both chromatin diminution and amplification in Ascaris.

Infrared and X-ray diffraction investigations of vanadium–titanium oxides for the oxidation of alcohol

Vanadium oxide supported on titania has been studied by infrared spectra and X-ray diffraction for qualitative and quantitative analysis, together with the rate of oxidation of alcohol and reduction of oxide. The rate of ethanol formation passes through a maximum at V–Ti-11 (11 wt% V2O5) in the presence or absence of oxygen gas. At low surface concentrations of vanadium oxide below V–Ti-11 a new vanadate phase is observed in the i.r. spectra. The active oxygen species correspond to amorphous or two-dimensional vanadium oxide in the catalyst. It is concluded that the catalytic activity of V–Ti oxides originates mainly from the presence of such species.