Amorphous vanadium oxide catalyst surface selective in the ammoxidation of 3-picoline

Abstract

which is free of recognition sites of the restriction enzymes so far tested. We assume that this core sequence has been amplified many times and altered by successive random deletions. Such a satellite is likely to be AT-rich, terminally located, and rapidly reassociating, as observed here. It would furthermore show such restriction enzyme recognition sites as can arise by random deletion. In the particular case of serially repeated ATCGGAATATCGTTTCGGAT, the recognition sequences GANTC (Hinf I), GATC (Sau 3A), TCGA (Taq I) and GAATTC (Eco RI) can arise through single deletions. These sequences would be randomly spaced on the DNA so that a restriction digest of satellite DNA would give rise to a smear. To account for the fraction of satellite DNA which is not cleavable at all by restriction enzymes, we propose that the terminal stretches of serially repeated sequences have not been altered. This would be the case if amplification were a continuing process, so that the most terminal copies of the repeat unit would be young in evolution. We are currently sequencing shotguncloned fragments of P. equorum gll sat DNA. We expect to find the underlying repeated sequence(s) as one exists in the gll sat DNA of A. suum. We are particularly interested in determining whether this repeat unit contains, like the A. suum monomer an interrupted inverted repeat. This would support the hypothesis [2, 5] that interrupted inverted repeats within the sat DNA are functional sites of both chromatin diminution and amplification in Ascaris.