Zinc Finger E-box Binding Homeobox Research Articles

Laryngeal Squamous Cell Carcinoma: Potential Molecular Mechanism and Prognostic Signature Based on Immune-Related Genes.

BackgroundImmune-related genes (IRGs) are closely related to the incidence and progression of tumors, potentially indicating that IRGs play an important role in laryngeal squamous cell carcinoma (LSCC).Material/MethodsAn RNA sequencing dataset containing 123 samples was collected from The Cancer Genome Atlas. Based on immune-related differentially expressed genes (IRDEGs), a potential molecular mechanism of LSCC was explored through analysis of information in the Gene Ontology (GO) resource and the Kyoto Encyclopedia of Genes and Genomes (KEGG), and protein-protein interactions (PPIs). A regulatory network of transcriptional regulators and IRDEGs was constructed to explore the underlying molecular mechanism of LSCC at the upstream level. Candidates from IRDEGs for signature were screened via univariate Cox analysis and using the least absolute shrinkage and selection operator (LASSO) technique. The IRDEG signature of LSCC was constructed by using a multivariate Cox proportional hazards model.ResultsGO and KEGG analysis showed that IRDEGs may participate in the progression of LSCC through immune-related reactions. PPI analysis demonstrated that, among the IRDEGs in LSCC, the Kininogen 1; C-X-X motif chemokine ligand 10; elastase, neutrophil expressed; and LYZ genes are hub genes in the development of LSCC. At the upstream level, SPI1, SP140, signal transducer and activator of transcription 4, zinc finger E-box binding homeobox, and Ikaros family zinc finger 2 are the hub transcriptional regulators of IRDEGs. The risk score based on the IRDEG signature was able to distinguish prognosis in patients with LSCC and represents an independent prognostic risk factor for LSCC.ConclusionsFrom the perspective of IRGs, we first constructed an IRDEG signature related to the prognosis of LSCC, which can be used as a novel marker to predict prognosis in patients with LSCC.

Polydatin inhibits ZEB1-invoked epithelial-mesenchymal transition in fructose-induced liver fibrosis.

High fructose intake is a risk factor for liver fibrosis. Polydatin is a main constituent of the rhizome of Polygonum cuspidatum, which has been used in traditional Chinese medicine to treat liver fibrosis. However, the underlying mechanisms of fructose‐driven liver fibrosis as well as the actions of polydatin are not fully understood. In this study, fructose was found to promote zinc finger E‐box binding homeobox 1 (ZEB1) nuclear translocation, decrease microRNA‐203 (miR‐203) expression, increase survivin, activate transforming growth factor β1 (TGF‐β1)/Smad signalling, down‐regulate E‐cadherin, and up‐regulate fibroblast specific protein 1 (FSP1), vimentin, N‐cadherin and collagen I (COL1A1) in rat livers and BRL‐3A cells, in parallel with fructose‐induced liver fibrosis. Furthermore, ZEB1 nuclear translocation‐mediated miR‐203 low‐expression was found to target survivin to activate TGF‐β1/Smad signalling, causing the EMT in fructose‐exposed BRL‐3A cells. Polydatin antagonized ZEB1 nuclear translocation to up‐regulate miR‐203, subsequently blocked survivin‐activated TGF‐β1/Smad signalling, which were consistent with its protection against fructose‐induced EMT and liver fibrosis. These results suggest that ZEB1 nuclear translocation may play an essential role in fructose‐induced EMT in liver fibrosis by targeting survivin to activate TGF‐β1/Smad signalling. The suppression of ZEB1 nuclear translocation by polydatin may be a novel strategy for attenuating the EMT in liver fibrosis associated with high fructose diet.

Jagged1-Notch1-deployed tumor perivascular niche promotes breast cancer stem cell phenotype through Zeb1

Zinc finger E-box binding homeobox 1 (Zeb1) has been demonstrated to participate in the acquisition of the properties of cancer stem cells (CSCs). However, it is largely unknown how signals from the tumor microenvironment (TME) contribute to aberrant Zeb1 expression. Here, we show that Zeb1 depletion suppresses stemness, colonization and the phenotypic plasticity of breast cancer. Moreover, we demonstrate that, with direct cell-cell contact, TME-derived endothelial cells provide the Notch ligand Jagged1 (Jag1) to neighboring breast CSCs, leading to Notch1-dependent upregulation of Zeb1. In turn, ectopic Zeb1 in tumor cells increases VEGFA production and reciprocally induces endothelial Jag1 in a paracrine manner. Depletion of Zeb1 disrupts this positive feedback loop in the tumor perivascular niche, which eventually lessens tumor initiation and progression in vivo and in vitro. In this work, we highlight that targeting the angiocrine Jag1-Notch1-Zeb1-VEGFA loop decreases breast cancer aggressiveness and thus enhances the efficacy of antiangiogenic therapy.

Theabrownin inhibits the cytoskeleton‑dependent cell cycle, migration and invasion of human osteosarcoma cells through NF‑κB pathway‑related mechanisms.

Considering the high metastatic potential of osteosarcoma, not only pro-apoptosis, but also anti-metastasis is important for anti-osteosarcoma therapy. Previously, the authors reported the pro-apoptotic and tumor-inhibitory effects of theabrownin (TB) on osteosarcoma cells; however, its effects on the metastasis-related migration and invasion of osteosarcoma cells remain unknown. The present study conducted RNA sequencing (RNA-seq) on xenograft zebrafish samples and performed in vitro experiments, including RT-qPCR, cell viability analysis, clone formation assay, cell cycle analysis, immunofluorescence, cell migration assay, cell invasion assay, wound healing assay and western blot (WB) analysis to evaluate the anti-metastatic effects and mechanism of TB against osteosarcoma cells. The RNA-seq data revealed that TB significantly downregulated the expression of genes involved in the microtubule bundle formation of U2OS cells, which was verified by RT-qPCR. The cell viability and clone formation data indicated that TB significantly inhibited U2OS cell viability and colony numbers. The results of cell cycle analysis revealed the blocked cell cycle progression of U2OS by TB. The immunofluorescent data revealed an evident cytoskeleton-inhibitory effect of TB against the microfilament and microtubule formation of U2OS cells. The results of cell migration and invasion demonstrated that TB significantly inhibited U2OS cell migration and invasion. The results of WB analysis revealed that TB significantly regulated key molecules of epithelial-mesenchymal transition [EMT; e.g., E-cadherin, vimentin, Snail-1, Slug and zinc finger E-box-binding homeobox 1 (ZEB-1)] and those of the nuclear factor (NF)-κB pathway (e.g., NF-κB, phospho-IKKα and phospho-IKKβ), indicating that NF-κB pathway-related EMT suppression may mediate the mechanisms underlying the anti-migratory and anti-invasive effects of TB against osteosarcoma. To the best of our knowledge, this is the first study on the inhibitory effects and mechanisms of TB on the cytoskeleton-dependent cell cycle, migration and invasion of human osteosarcoma cells. The findings presented herein suggest that TB may be a promising anti-metastatic candidate for anti-osteosarcoma therapy.

LncRNA NR_027471 Functions as a ceRNA for miRNA-8055 Leading to Suppression of Osteosarcoma by Regulating the Expression of TP53INP1.

Osteosarcoma is a malignancy with high aggressiveness and poor prognosis, which occurs mainly in children. The therapeutic strategy against osteosarcoma includes surgery combined with chemotherapy and radiotherapy. Although the treatment of osteosarcoma has been improved in recent years, there is a large proportion of patients with incurable osteosarcoma. Investigation of the mechanism of osteosarcoma progression would be of great help in discovering therapeutic targets for this disease. Long non-coding RNAs play critical roles in the pathogenesis of different types of cancer. The current study showed that long non-coding RNA NR_027471 was downregulated in osteosarcoma cells. In vitro and in vivo studies indicated that upregulation of NR_027471 impeded the viability, proliferation, and invasion of osteosarcoma, as well as induced cell cycle arrest at G1. In addition, binding of miR-8055 to NR_027471 was demonstrated, thereby influencing the expression of tumor protein p53 inducible nuclear protein 1 (TP53INP1). Knockdown of NR_027471 promoted epithelial–mesenchymal transition by inhibiting E-cadherin and increasing the expression of zinc finger E-box-binding homeobox 1 (ZEB1), Snail, and fibronectin. These results suggested that overexpression of NR_027471 upregulated TP53INP1 by sponging to miR-8055, leading to suppression of osteosarcoma cell proliferation and progression.

Long Noncoding RNA HOTAIR Promotes Epithelial-Mesenchymal Transition and Is a Suitable Target to Inhibit Peritoneal Dissemination in Human Scirrhous Gastric Cancers

Objectives: Scirrhous gastric cancer, which accounts for approximately 10% of all gastric cancers, often disseminates to the peritoneum, leading to intractable cases with poor prognosis. There is an urgent need for new treatment approaches for this difficult cancer. Methods: We previously established an original cell line, HSC-60, from a scirrhous gastric cancer patient and isolated a peritoneal-metastatic cell line, 60As6, in nude mice following orthotopic inoculations. In the present study, we focused on the expression of long noncoding ribonucleic acid (RNA) (lncRNA) in the cell lines and investigated the mechanism on peritoneal dissemination. Results: We demonstrated that an lncRNA, HOX transcript antisense RNA (HOTAIR), is expressed significantly more highly in 60As6 than HSC-60 cells. Then, using both HOTAIR knockdown and overexpression experiments, we showed that high-level expression of HOTAIR promotes epithelial-mesenchymal transition (EMT) in 60As6 cells. By luciferase assay, we found that HOTAIR directly targets and binds to miR-217, and that miR-217 directly binds to Zinc finger E-box-binding homeobox 1 (ZEB1). The knockdown of HOTAIR in 60As6 cells significantly reduced the invasion activity and peritoneal dissemination – and significantly prolonged the survival – in the orthotopic tumor mouse model. Conclusion: An EMT-associated pathway (the HOTAIR-miR-217-ZEB1 axis) appears to inhibit peritoneal dissemination and could lead to a novel therapeutic strategy against scirrhous gastric cancer in humans.

Knockdown of lncRNA ZNRD1-AS1 inhibits progression of bladder cancer by regulating miR-194 and ZEB1.

BackgroundBladder cancer (BC) is a common urinary neoplasm with high incidence worldwide. Long noncoding RNA zinc ribbon domain containing 1 antisense RNA 1 (ZNRD1‐AS1) has been reported to be upregulated in BC. However, the exact role of ZNRD1‐AS1 as well as its mechanism remains poorly understood.MethodsZinc ribbon domain containing 1 antisense RNA 1, and its potential downstream genes microRNA‐194 (miR‐194) and zinc finger E‐box binding homeobox 1 (ZEB1) levels were detected via quantitative real‐time polymerase chain reaction or western blot. Cell proliferation, migration, invasion, and epithelial‐mesenchymal transition (EMT) were detected to assess the influences of ZNRD1‐AS1, miR‐194 and ZEB1 on BC cells by colony formation, cell counting kit‐8 (CCK‐8), transwell analysis or western blot. The relationship between miR‐194 and ZNRD1‐AS1 or ZEB1 was analyzed by luciferase activity analysis. The xenograft experiment was performed to assess the function of ZNRD1‐AS1 in vivo.ResultsZinc ribbon domain containing 1 antisense RNA 1level was upregulated in BC. ZNRD1‐AS1 silence repressed proliferation, migration, invasion and EMT in BC cells. MiR‐194 was identified as a target of ZNRD1‐AS1, and miR‐194 upregulation repressed proliferation, migration, invasion, and EMT by ZNRD1‐AS1 sponging. ZEB1 was targeted via miR‐194 and its interference impeded proliferation, migration, invasion, and EMT. Moreover, ZNRD1‐AS1 regulated ZEB1 expression via miR‐194. Besides, inhibition of ZNRD1‐AS1 attenuated tumor growth by miR‐194/ZEB1 axis in vivo.ConclusionKnockdown of ZNRD1‐AS1 suppressed BC cell development in vitro and in vivo via targeting miR‐194 to regulate ZEB1, indicating a novel avenue for treatment of BC.

MicroRNA-140 Represses Esophageal Cancer Progression via Targeting ZEB2 to Regulate Wnt/β-Catenin Pathway

BackgroundMicroRNAs have been reported to play regulatory functions in various cancers, including esophageal cancer. The aim of this study was to investigate the effects of miR-140 on the progression of esophageal cancer and the underlying regulatory mechanism. MethodsThe levels of miR-140 and zinc finger E-box-binding homeobox 2 (ZEB2) messenger RNA in esophageal cancer tissues and cell lines were measured by quantitative real-time polymerase chain reaction. The protein levels of ZEB2, β-catenin, c-Myc, and cyclinD1 were determined by Western blot. Cell proliferation and apoptosis were determined by 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide assay and flow cytometry, respectively. Cell migration and invasion were assessed by transwell assay. In addition, the relationship between miR-140 and ZEB2 was predicted by TargetScan online database and confirmed by dual-luciferase reporter assay. The tumor xenograft model was used to verify the role of miR-140 in esophageal cancer progression in vivo. ResultsThe expression of miR-140 was downregulated whereas ZEB2 expression was upregulated in esophageal cancer tissues compared with paracancerous normal tissues. Functionally, both miR-140 overexpression and ZEB2 knockdown inhibited proliferation, migration, and invasion and induced apoptosis in esophageal cancer cells. ZEB2 overexpression reversed the effects of miR-140 on proliferation, apoptosis, migration, and invasion of esophageal cancer cells. Mechanistically, ZEB2 was identified as a target of miR-140. Furthermore, miR-140 suppressed Wnt/β-catenin pathway by regulating ZEB2 expression in esophageal cancer cells. MiR-140 inhibited tumor growth of esophageal cancer through repressing ZEB2 expression in vivo. ConclusionsOur results demonstrated that miR-140 inhibited esophageal cancer development by targeting ZEB2 through inactivating Wnt/β-catenin pathway.

SALL4 promotes tumor progression in breast cancer by targeting EMT.

Sal-like protein 4 (SALL4) is overexpressed in breast cancer and might contribute to breast cancer progression, but the molecular mechanism remains unknown. Here, we found that within a group of 371 ethnic Chinese breast cancer patients, SALL4 was associated with lower grade (P = .002) and progesterone receptor positivity (P = .004) for overall cases; lower Ki67 (P = .045) and high vimentin (P = .007) for luminal cases. Patients with high SALL4 expression in lymph node metastasis showed a significantly worse survival than those with low expression. Knockout of SALL4 in a triple-negative breast cancer cell line MDA-MB-231-Red-FLuc-GFP led to suppressed ability in proliferation, clonogenic formation, migration, and mammosphere formation in vitro, tumorigenicity and lung colonization in vivo. On the other hand, overexpression of SALL4 enhanced migration and mammosphere formation in vitro and tumorigenicity in vivo. Mechanistically, there was a positive correlation between SALL4 expression and mesenchymal markers including Zinc finger E-box binding homeobox 1 (ZEB1), vimentin, Slug, and Snail in vivo. Chromatin immunoprecipitation experiment indicated that SALL4 can bind to the promoter region of vimentin (-778 to -550 bp). Taken together, we hypothesize that SALL4 promotes tumor progression in breast cancer by inducing the mesenchymal markers like vimentin through directly binding to its promoter. Increased SALL4 level in metastatic lymph node relative to the primary site is an important poor survival marker in breast cancer.

ZEB1-Mediated Transcriptional Upregulation of circWWC3 Promotes Breast Cancer Progression through Activating Ras Signaling Pathway

Zinc finger E-box binding homeobox 1 (ZEB1) has been widely recognized as an important driver of tumor growth and metastasis. However, nothing is known about ZEB1-regulated circular (circ)RNAs in cancer. In the current study, we evaluated the function of a novel ZEB1-regulated circRNA derived from the WWC3 gene locus, circWWC3 in breast cancer progression. We found that ZEB1 upregulated circWWC3 expression but not the linear WWC3 mRNA expression. circWWC3 is highly expressed in breast cancer tissues and is associated with the poor prognosis of breast cancer patients. Silencing of circWWC3 significantly suppresses the proliferation, migration, and invasion of breast cancer cells. Mechanically, circWWC3 upregulates multiple oncogenes’ expression of the Ras signaling pathway through acting as the sponge of microRNA (miR)-26b-3p and miR-660-3p. Moreover, short hairpin (sh)RNA-mediated knockdown of circWWC3 partially antagonized ZEB1-mediated breast cancer growth and metastasis in vivo. Our findings reveal that ZEB1-mediated upregulation of circWWC3 promotes breast cancer progression through activating Ras signaling pathway, which provides a potential therapeutic target and prognostic biomarker for breast cancer.

Hypoxia‐inhibited miR‐338‐3p suppresses breast cancer progression by directly targeting ZEB2

Hypoxia plays an essential role in the development of various cancers. The biological function and underlying mechanism of microRNA‐338‐3p (miR‐338‐3p) under hypoxia remain unclarified in breast cancer (BC). Herein, we performed bioinformatics, gain and loss of function of miR‐338‐3p, a luciferase reporter assay, and chromatin immunoprecipitation (ChIP) in vitro and in a tumor xenograft model. We also explored the potential signaling pathways of miR‐338‐3p in BC. We detected the expression levels and prognostic significance of miR‐338‐3p in BC by qRT‐PCR and in situ hybridization. MiR‐338‐3p was lowly expressed in BC tissues and cell lines, and BC patients with underexpression of miR‐338‐3p tend to have a dismal overall survival. Functional experiments showed that miR‐338‐3p overexpression inhibited BC cell proliferation, invasion, migration, and epithelial‐mesenchymal transition (EMT) process, whereas miR‐338‐3p silencing abolished these biological behaviors. Zinc finger E‐box‐binding homeobox 2 (ZEB2) was validated as a direct target of miR‐338‐3p. ZEB2 overexpression promoted while ZEB2 knockdown abolished the promoted effects of miR‐338‐3p knockdown on cell biological behaviors through the NF‐ĸB and PI3K/Akt signal pathways. HIF1A can transcriptionally downregulate miR‐338‐3p under hypoxia. In total, miR‐338‐3p counteracts hypoxia‐induced BC cells growth, migration, invasion, and EMT via the ZEB2 and NF‐ĸB/PI3K signal pathways, implicating miR‐338‐3p may be a promising target to treat patients with BC.

Abstract 4873: Molecular mechanism of neddylation-dependent suppression of cancer cell migration

Abstract Neddylation is a process by which NEDD8 is covalently conjugated to target proteins by sequential enzymatic reaction. Its role in cancer cell migration has only been recently acknowledged. Previously in cancer cell migration, the epithelial to mesenchymal transition (EMT) process has been well-known to play an important role in both invasion and metastasis by promoting mesenchymal phenotype in epithelial cells. However, the role of neddylation in the EMT process and its mechanistic details are yet to be elucidated. We recently reported that neddylation plays a crucial role in cancer cell migration through the PI3K-Akt pathway. Here, we report that inhibiting neddylation activates the hypoxia-inducible factor-1α through the PI3K-Akt pathway, which eventually regulates the EMT-activator zinc finger E-box binding homeobox 1 in various cancer cell lines. As induction of hypoxia-inducible factor-1α is known to deteriorate the state of cancer and EMT process is one of the hallmarks of metastasis in cancer, our findings uncover the novel association of hypoxia-inducible factor-1α and zinc finger E-box binding homeobox 1 through the process of neddylation. Citation Format: Yang-Sook Chun, Jieun Seo, Jun Bum Park. Molecular mechanism of neddylation-dependent suppression of cancer cell migration [abstract]. In: Proceedings of the Annual Meeting of the American Association for Cancer Research 2020; 2020 Apr 27-28 and Jun 22-24. Philadelphia (PA): AACR; Cancer Res 2020;80(16 Suppl):Abstract nr 4873.

Abstract 5042: Targeting the ERK5 and ERK1/2 pathways simultaneously induces mesenchymal to epithelial transition in TNBC

Abstract Extracellular signal-regulated kinase (ERK) 5, a member of mitogen activated protein kinase (MAPK) family, is an emerging target in cancer therapeutics. Activation of ERK5 via overexpression induces EMT and hormone-independent growth of breast cancer. EMT leads to the loss of cell polarity, downregulation of E-cadherin, and upregulation of mesenchymal markers snail, zinc-finger E-box binding homeobox (ZEB1), and vimentin. EMT is also associated with drug resistance. Although ERK1/2 and ERK5 activation is known to mediate EMT, the effect of ERK1/2 and ERK5 inhibition on mesenchymal to epithelial transition (MET), the reverse of EMT, is poorly understood in cancer.Triple negative breast cancer (TNBC) cells have a mesenchymal phenotype and show poor sensitivity to chemotherapy agents. The loss of estrogen, progesterone hormone receptors and human epidermal growth factor receptors (HER2) contributes to the aggressive state of the disease and lack of targeted therapy. Activation of the intracellular signaling pathways such as the MAPK pathway mediates tumorigenesis in TNBCs. MEK1/2 inhibitors have been successful clinical drug candidates; however, there is emerging evidence that the activation of the MEK5-ERK5 pathway mediates resistance to the MEK1/2 inhibitors in several BRAF and KRAS-mutant cancers. The effect of MEK1/2 inhibition on MEK5-mediated EMT, cell survival, and migration in TNBC is less well understood. Therefore, we hypothesize that dual inhibition of the ERK1/2 and ERK5 pathways is a relevant strategy to target TNBCs.In the present study, the effect of dual ERK1/2 and ERK5 inhibition on MET, cell viability, migration, and anchorage-independent growth was evaluated in TNBC. ERK1/2 and ERK5 activities were modulated via pharmacological inhibitors and molecular tools. Cell morphology and protein expression of EMT markers E-cadherin, ZEB1, snail, and vimentin were evaluated. XMD8-92, an ERK5 inhibitor was found to synergize with doxorubicin in lung and cervical cancer cells. Therefore, the effect of dual ERK1/2 and ERK5 on doxorubicin sensitivity was evaluated. Citation Format: Akshita Bhatt, Thomas Wright, Van Barnes, Suravi Chakrabarty, Patrick Flaherty, Matthew Burow, Jane Cavanaugh. Targeting the ERK5 and ERK1/2 pathways simultaneously induces mesenchymal to epithelial transition in TNBC [abstract]. In: Proceedings of the Annual Meeting of the American Association for Cancer Research 2020; 2020 Apr 27-28 and Jun 22-24. Philadelphia (PA): AACR; Cancer Res 2020;80(16 Suppl):Abstract nr 5042.

The antitumor effect of miR-448 in epithelial ovarian cancer.

BackgroundOvarian cancer (OC) is the seventh most commonly diagnosed cancer in the world and the tenth most common in China. Target agents such as bevacizumab and poly (ADP-ribose) polymerase (PARP) inhibitors show efficacy only in the early stages of some cases; therefore, more effective molecular targeting agents need to be developed. microRNAs (miRNA) have emerged as new biomarkers in the clinical diagnosis and treatment of OC. Among these, miRNA-448 has been shown to exert a tumor-suppressor role in numerous cancer types. However, the function of miR-448 in OC remains poorly understood.MethodsThe miR-448 in cancer tissues and cell lines was tested by quantitative real-time polymerase chain (qRT-PCR). The miR-448 levels were altered by miR-448 mimics (UUGCAUAUGUAGGAUGUCCCAU) or miR-448 antisense oligonucleotide transfection (miR20001532-1-5). Cell growth was evaluated by MTT assay, and cell apoptosis was assayed by annexin V-FITC (detecting apoptotic cells by binding to phosphatidylserine) and propidium iodide (PI, detecting death cells by binding to DNA) (Cat. No. ab54775, Abacam). The target gene of miR-448 was confirmed by dual-luciferase reporter assays.ResultsIn this study, we found that miR-448 showed low expression in epithelial ovarian cancer (EOC) tissues and that the low expression of miR-448 was related to low survival rate. miR-448 may thus inhibit cellular proliferation and promote apoptosis by binding the 3'UTR of zinc finger E-box-binding homeobox 2 (ZEB2) and inhibiting the expression of ZEB2.ConclusionsOur study suggests that miR-448 has an inhibitory role in OC.

Platelet adherence to cancer cells promotes escape from innate immune surveillance in cancer metastasis.

The impacts of post‑operative abdominal infectious complications increase hematogenous distant metastasis and result in poor long‑term survival after curative resection. Even if curative resection can be performed, the presence of circulating tumor cells is affected. The liver, the most common site of metastases, is an important organ in innate immune surveillance. However, the molecular mechanisms of distant hematogenous metastasis are not yet fully known. Platelets are crucial components in the tumor microenvironment that function to promote tumor progression and metastasis. The purpose of this study was to identify the effect of platelets on escape from innate immune surveillance in post‑operative abdominal infectious complications. Platelet adherence was assessed by co‑culturing human pancreatic cancer cells including transforming growth factor (TGF‑β)‑treated BxPC‑3. CD44 isoform, transcription factors and epithelial‑mesenchymal transition markers were examined using western blotting. We also assessed whether cancer cells surrounded by activated platelets could escape from innate immune surveillance, using infectious and non‑infectious mouse models injected intraperitoneally with LPS. Platelets were found to preferentially adhere to mesenchymal cells rather than epithelial cells. BxPC‑3 epithelial cells showed upregulation of CD44‑variant and epithelial splicing regulatory protein 1 (ESRP‑1) expression. However, Panc‑1 mesenchymal cells and TGF‑β‑treated BxPC‑3 cells showed upregulation of CD44‑standard and zinc finger E‑box‑binding homeobox 1 (ZEB‑1) expression and a reduction in ESRP‑1. In the non‑infectious model, cancer cells were not found in the liver. In the infectious model, although epithelial cells without platelet adhesion were in an apoptotic state, mesenchymal cells showed many viable cancer cells surrounded by activated platelets. Cancer cells were suggested to have phenotypic plasticity through the switching of CD44 isoforms. Mesenchymal cells, which express CD44‑standard, could escape from immune surveillance by becoming surrounded by adhered activated platelets. Therefore, it may be necessary to administer antiplatelet agents to prevent distant hematogenous metastasis when post‑operative abdominal infectious complications occur.

Long non‑coding RNA ZEB2‑AS1 affects cell proliferation and apoptosis via themiR‑122‑5p/PLK1axis in acute myeloid leukemia.

Acute myeloid leukemia (AML) is a highly heterogeneous disease featured by the clonal accumulation of immature myeloid cells. Zinc finger E-box binding homeobox 2 (ZEB2)-antisense RNA 1 (AS1) has been verified to participate in the progression of several types of cancer, including AML. However, the potential mechanisms of ZEB2-AS1 in AML have not yet been fully elucidated. The present study aimed to elucidate the role and regulatory mechanisms of ZEB2-AS1 in AML. The expression of ZEB2-AS1, microRNA-122-5p (miRNA/miR-122-5p) and polo-like kinase 1 (PLK1) was detected by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) in AML tissues or cells. Cell proliferation and apoptosis were examined by methyl thiazolyl tetrazolium (MTT) assay and apoptosis assay, respectively. The protein levels were examined by western blot analysis. The targeted sequence between miR-122-5p and ZEB2-AS1 or PLK1 was predicted using an online database and verified by dual-luciferase reporter assay. A mouse tumor xenograft model was established to confirm the effects of ZEB2-AS1 on tumor growth in vivo. The results revealed that the expression levels of ZEB2-AS1 and PLK1 were upregulated, while those of miR-122-5p were downregulated in AML tissues and cells. The knockdown of ZEB2-AS1 inhibited proliferation and induced apoptosis in vitro, and inhibited tumor growth in vivo. By experimental verification, ZEB2-AS1 was found to negatively regulate miR-122-5p expression and PLK1 was found to be a target gene of miR-122-5p. Furthermore, ZEB2-AS1 was verified to regulate the expression of PLK1 by sponging miR-122-5p in AML cells. On the whole, the findings of the present study demonstrate that ZEB2-AS1 promotes cell proliferation and inhibits apoptosis, at least partly by targeting PLK1 mediated by miR-122-5p in AML cells.

LncRNA ZEB2-AS1: A promising biomarker in human cancers.

Long non-coding RNAs (lncRNAs) are one of the ncRNAs that transcript with length more than 200 nt that are not translated into protein. Studies have shown that lncRNAs have regulatory function in human disease especially cancers. lncRNA dysfunction causes altered cellular behavior including proliferation, invasion, and migration, and also it can inhibit apoptosis. Long non-coding zinc finger E-box binding homeobox 2 antisense RNA1 (lnZEB2-AS1) is one of the lncRNAs that plays the oncogenic role in different cancers. Dysregulation of lncZEB2-AS1 can lead to tumorigenesis and cancer progression. lncZEB2-AS1 may be introduced as a diagnostic marker or therapeutic target for human cancers. In this review, we describe briefly the mechanism of ZEB2-AS1 in cells and its function in cancer progression.

Long noncoding RNA HOTAIR promotes breast cancer development by targeting ZEB1 via sponging miR-601

BackgroundBreast cancer (BC) is a common malignancy worldwide. It has been reported that long non-coding RNA (lncRNA) HOX transcript antisense RNA (HOTAIR) is abnormally expressed in BC. However, the role of HOTAIR in the malignancy of BC is worth further discussion. This study aims to clarify the function and molecular mechanism of HOTAIR in BC.MethodsQuantitative real-time polymerase chain reaction (qRT-PCR) was employed to determine the expression of HOTAIR, microRNA (miR)-601 and zinc finger E-box binding homeobox 1 (ZEB1). Cell counting kit-8 (CCK-8) and transwell assay were used to detect the proliferation, migration and invasion of cells. Further, the protein levels of AKT, phosphorylated-AKT (p-AKT), ZEB1 and Ki-67 were confirmed by western blot (WB) assay. Moreover, dual-luciferase reporter assay was applied to examine the targeting relationship between HOTAIR and miR-601 or miR-601 and ZEB1. In addition, animal experiments were conducted to verify the effect of HOTAIR on BC tumor growth in vivo.ResultsHOTAIR was upregulated in BC tissues and cells, and its knockdown suppressed the proliferation, migration, invasion and the activity of AKT signaling pathway of BC cells. HOTAIR could serve as a sponge of miR-601. Further experiments revealed that miR-601 inhibitor could reverse the inhibition effect of HOTAIR silencing on the progression of BC. Meanwhile, ZEB1 was a target of miR-601, and its overexpression could invert the suppression effect of miR-601 overexpression on the progression of BC. Additionally, ZEB1 expression was regulated by HOTAIR and miR-601. Furthermore, interference of HOTAIR could attenuate BC tumor growth in vivo.ConclusionIn short, this study demonstrated that HOTAIR promoted the proliferation, migration, invasion of BC through regulating the miR-601/ZEB1 axis, which provided a theoretical basis for the research on lncRNA-directed therapeutics in BC.

MicroRNA 200b promotes mesenchymal-to-epithelial transition in anaplastic thyroid carcinoma.

Anaplastic thyroid cancer (ATC) remains a cancer with one of the worst prognoses, despite novel targeted therapies. The median survival rate has not improved for decades. Epithelial-to-mesenchymal transition (EMT) is a crucial step in physiological processes and in cancer progression, but the underlying mechanisms are not yet fully understood. The current study examined the role of microRNA (miR)-200b in mesenchymal-to-epithelial transition in ATC. Total RNA and miR isolation were performed from ATC cell lines transfected with a miR-200b mimic. After miR-200b mimic transfection, expression levels of E-cadherin, vimentin and zinc finger E-box binding homeobox 1 (ZEB1) were confirmed by reverse transcription-quantitative PCR and western blotting. Additionally, cell migration was evaluated using miR-200b mimic and scrambled negative control-transfected cells. A total of 14 human ATC and 15 non-cancerous human thyroid tissues were immunohistochemically stained and scored as controls for E-cadherin, vimentin and ZEB1. In ATC tissues and cell lines, the mesenchymal marker ZEB1 was significantly upregulated and the epithelial marker E-cadherin was significantly downregulated. Additionally, the mesenchymal marker vimentin was significantly upregulated in ATC tissues and in one ATC cell line. MiR-200b mimic transfection significantly increased vimentin and ZEB1 expression, but E-cadherin expression remained below the measurement sensitivity. Furthermore, miR-200b overexpression decreased cell migration. The current study suggested that miR-200b may regulate the expression levels of mesenchymal markers such as vimentin and ZEB1 in ATC and may promote mesenchymal-to-epithelial transition.

MicroRNAs and Their Influence on the ZEB Family: Mechanistic Aspects and Therapeutic Applications in Cancer Therapy.

Molecular signaling pathways involved in cancer have been intensively studied due to their crucial role in cancer cell growth and dissemination. Among them, zinc finger E-box binding homeobox-1 (ZEB1) and -2 (ZEB2) are molecules that play vital roles in signaling pathways to ensure the survival of tumor cells, particularly through enhancing cell proliferation, promoting cell migration and invasion, and triggering drug resistance. Importantly, ZEB proteins are regulated by microRNAs (miRs). In this review, we demonstrate the impact that miRs have on cancer therapy, through their targeting of ZEB proteins. MiRs are able to act as onco-suppressor factors and inhibit the malignancy of tumor cells through ZEB1/2 down-regulation. This can lead to an inhibition of epithelial-mesenchymal transition (EMT) mechanism, therefore reducing metastasis. Additionally, miRs are able to inhibit ZEB1/2-mediated drug resistance and immunosuppression. Additionally, we explore the upstream modulators of miRs such as long non-coding RNAs (lncRNAs) and circular RNAs (circRNAs), as these regulators can influence the inhibitory effect of miRs on ZEB proteins and cancer progression.