The antitumor effect of miR-448 in epithelial ovarian cancer.

Abstract

BackgroundOvarian cancer (OC) is the seventh most commonly diagnosed cancer in the world and the tenth most common in China. Target agents such as bevacizumab and poly (ADP-ribose) polymerase (PARP) inhibitors show efficacy only in the early stages of some cases; therefore, more effective molecular targeting agents need to be developed. microRNAs (miRNA) have emerged as new biomarkers in the clinical diagnosis and treatment of OC. Among these, miRNA-448 has been shown to exert a tumor-suppressor role in numerous cancer types. However, the function of miR-448 in OC remains poorly understood.MethodsThe miR-448 in cancer tissues and cell lines was tested by quantitative real-time polymerase chain (qRT-PCR). The miR-448 levels were altered by miR-448 mimics (UUGCAUAUGUAGGAUGUCCCAU) or miR-448 antisense oligonucleotide transfection (miR20001532-1-5). Cell growth was evaluated by MTT assay, and cell apoptosis was assayed by annexin V-FITC (detecting apoptotic cells by binding to phosphatidylserine) and propidium iodide (PI, detecting death cells by binding to DNA) (Cat. No. ab54775, Abacam). The target gene of miR-448 was confirmed by dual-luciferase reporter assays.ResultsIn this study, we found that miR-448 showed low expression in epithelial ovarian cancer (EOC) tissues and that the low expression of miR-448 was related to low survival rate. miR-448 may thus inhibit cellular proliferation and promote apoptosis by binding the 3'UTR of zinc finger E-box-binding homeobox 2 (ZEB2) and inhibiting the expression of ZEB2.ConclusionsOur study suggests that miR-448 has an inhibitory role in OC.