Zinc Finger Domain-containing Protein Research Articles

Upregulation of p52-ZER6 (ZNF398) increases reactive oxygen species by suppressing metallothionein-3 in neuronal cells.

ZNF398/ZER6 belongs to the Krüppel-associated box (KRAB) domain-containing zinc finger proteins (K-ZNFs), the largest family of transcriptional repressors in higher organisms. ZER6 exists in two isoforms, p52 and p71, generated through alternative splicing. Our investigation revealed that p71-ZER6 is abundantly expressed in the stomach, kidney, liver, heart, and brown adipose tissue, while p52-ZER6 is predominantly found in the stomach and brain. The role of p52-ZER6 in neurons has remained unclear. Leveraging open-source RNA-seq data, we identified metallothionein 3 (MT3) as a target gene of p52-ZER6 in mouse hippocampal neuronal HT-22cells. Through chromatin immunoprecipitation assays, we identified the putative DNA-binding motif (CTAGGGGGGTTGTTATCTCTTTGG) of p52-ZER6 in the promoter region of MT3. Furthermore, we demonstrated an interaction between p52-ZER6 and estrogen receptor alpha (ERα) in the nucleus of SH-SY5Y cells, which led to the inhibition of p52-ZER6's DNA occupancy on the promoter of the MT3 gene. MT3 is a cysteine-rich, low molecular-weight protein known for reducing oxidative stress, reactive oxygen species (ROS), and metal toxicity. Our study revealed that overexpression of p52-ZER6 reduced the levels of MT3, increasing ROS levels, which was mitigated by co-overexpression of ERα. Notably, we also observed upregulation of p52-ZER6 and reduction of MT3 in the cortex of 5xFAD, an Alzheimer's disease (AD) mouse model. These findings suggest a potential pathological mechanism involving p52-ZER6-mediated ROS production in AD pathogenesis.

Liposomes-Loaded miR-9-5p Alleviated Hypoxia-Ischemia-Induced Mitochondrial Oxidative Stress by Targeting ZBTB20 to Inhibiting Nrf2/Keap1 Interaction in Neonatal Mice.

Aims: Hypoxia ischemia (HI) is a leading cause of cerebral palsy and long-term neurological sequelae in infants. Given that mitochondrial dysfunction in neurons contributes to HI brain damage, this study aimed to investigate the regulatory role of miR-9-5p in mitochondrial function following HI injury. Results: Overexpression of miR-9-5p in HI mice or H2O2-exposed PC12 cells suppressed neuronal injury, associated with increased mitochondrial copy number, normalizing mitochondrial membrane potential, improved nuclear factor-erythroid factor 2-related factor 2 (Nrf2) activation, and downregulation of Keap1. This was mediated, in part, through the ability of this miR-9-5p to bind and regulate the transcriptional activity of zinc finger and BTB domain-containing protein 20 (ZBTB20). Further study suggested that the knockdown of ZBTB20 exerts neuroprotection by inhibiting Nrf2/Keap1 interaction to promote the translocation of Nrf2 from the cytoplasm to the nucleus and the consequent expression of antioxidant proteins. Notably, the protective effects of miR-9-5p overexpression against HI-induced mitochondrial damage were reversed by the Nrf2 inhibitor ML385. Finally, the utilization of liposomes for the delivery of miR-9-5p (miR-9-5p@Lip) presents a promising therapeutic strategy for the treatment of HI injury. Innovation: miR-9-5p is a potential therapeutic agent for ischemic stroke through its modulation of the ZBTB20/Nrf2/Keap1 signaling pathway, influencing mitochondrial function and antioxidant response. Furthermore, the use of liposomal delivery for miR-9-5p offers a promising therapeutic strategy for HI injury. Conclusion: Overexpression of miR-9-5p protects against cerebral HI injury by modulating mitochondrial function through the ZBTB20/Nrf2/Keap1 signaling pathway. Antioxid. Redox Signal. 00, 000-000.

Transcription Impairment of TMEM208 by ZBTB14 Suppresses Breast cancer Radiotherapy Resistance

Zinc finger and BTB domain-containing protein (ZBTB) proteins have been implicated in different cellular processes, including DNA damage responses and cell cycle progression. However, the mechanism by which ZBTB14 modulates radiotherapy (RT) radioresistance (RT-R) remains to be elucidated. We aimed to elucidate the regulation mechanism of ZBTB14 in breast cancer (BC) RT-R. Using integrated bioinformatics prediction, ZBTB14 was identified as a hub transcription factor related to RT-R in BC. ZBTB14 was significantly under-expressed in non-responders and RT-R/BC cells, whereas its target transmembrane protein 208 (TMEM208) was significantly overexpressed in non-responders and RT-R/BC cells. Chromatin immunoprecipitation-qPCR and luciferase reporter assays revealed that ZBTB14 downregulated TMEM208 expression through transcriptional repression. Overexpression of ZBTB14 significantly inhibited the malignant biological behavior of BC cells and tumor growth in vivo, and further upregulation of TMEM208 reversed the biological activity and radiotherapy resistance of RT-R/BC cells inhibited by overexpression of ZBTB14.

Elucidating the genetic basis of bulb-related traits in garlic (Allium sativum) through genome-wide association study

The genetic architecture of garlic bulb related traits were still not well elucidated due to its big and complex genome. In this study, genotyping-by-sequencing (GBS) in 163 garlic accessions mainly from China were conducted. All the 163 garlic accessions were divided into three subpopulations, and largely consistent with geographic origins. Genome-wide association study (GWAS) was conducted for 5 garlic bulb related traits across four environments. Totally, 26 significantly loci were identified in two or more environments and located within or near 431 genes, and explain 14.0–31.7 % of the phenotypic variances. Among these, qBW5.1 was nearly with the qBH5.1. Four loci were reported previously, whereas the remaining 22 are likely to be new. Gene ontology enrichment analysis showed that the candidate genes were significantly enriched in metabolic process, biosynthetic process and catalytic activity. Nine candidate genes encode the zinc finger domain-containing protein, serine/threonine-protein kinase, peroxygenase, auxin-induced protein, ethylene-responsive transcription and E3-Ubiquitin protein ligases were identified and validated. Additionally, a meaningful achievement is one kompetitive allele-specific PCR marker, Kasp_chr7_BW for bulb weight were successfully developed and validated in a diverse panel. These results uncover the genetic mechanism of garlic bulb related traits and provide accessions and KASP markers for further garlic molecular breeding.

ZSCAN16 expedites hepatocellular carcinoma progression via activating TBC1D31

ObjectiveHepatocellular carcinoma (HCC) is fatal and poses great challenges to early diagnosis and effective treatment. This paper sought to expound the function of Zinc finger and SCAN domain-containing protein 16 (ZSCAN16) and TBC1 domain family member 31 (TBC1D31) in HCC progression.MethodsZSCAN16 and TBC1D31 levels were detected by RT-qPCR, Western blot, and immunohistochemistry. The transcriptional regulation of TBC1D31 by ZSCAN16 was demonstrated by ChIP-qPCR and dual-luciferase assay. Colony formation assay, migration and invasion assays, TUNEL staining, CCK-8 assay, flow cytometry, and western blot analysis were adopted to evaluate the biological activity of HCC cells. The role of the ZSCAN16/TBC1D31 axis in HCC was demonstrated by lentiviral gene intervention combined with functional rescue experiments. Hep3B cells were used to establish a nude mouse xenograft tumor model to study the role of the ZSCAN16/TBC1D31 axis in vivo.ResultsZSCAN16 and TBC1D31 were highly expressed in HCC. Downregulation of ZSCAN16 repressed the proliferation, migration, and invasion of HCC cells while promoting apoptosis, as well as curbing tumor growth in vivo. Mechanistic studies showed that ZSCAN16 mediated the transcriptional activation of TBC1D31, which in turn led to tumor development. TBC1D31 overexpression reversed the inhibitory effect of ZSCAN16 knockdown on the malignant behavior and tumor growth of HCC cells and accelerated tumor development.ConclusionZSCAN16 mediates transcriptional activation of TBC1D31 and promotes HCC progression.

TMEM209 promotes hepatocellular carcinoma progression by activating the Wnt/β-catenin signaling pathway through KPNB1 stabilization

Hepatocellular carcinoma (HCC) is the most common malignancy in the liver, with a poor prognosis. Transmembrane protein 209 (TMEM209) involves multiple biological processes, such as substance transportation and signal transduction, and is abundantly expressed in tumor tissues. However, the relationship between TMEM209 and HCC has not been comprehensively elucidated. In this study, we aimed to illustrate this issue by in vitro and in vivo experiments. Bioinformatic analysis and clinical sample validation revealed that TMEM209 was upregulated in HCC and correlated with reduced survival duration. Functionally, TMEM209 promoted the proliferation, migration, invasion, and EMT of HCC cells in vitro and facilitated tumor growth and metastasis in xenograft models. Mechanistically, TMEM209 promoted the proliferation and metastasis of HCC in a KPNB1-dependent manner. Specifically, TMEM209 could bind to KPNB1, thereby competitively blocking the interaction between KPNB1 and the E3 ubiquitin ligase RING finger and CHY zinc finger domain-containing protein 1 (RCHY1) and preventing K48-associated ubiquitination degradation of KPNB1. Ultimately, the Wnt/β-catenin signaling pathway was activated, contributing to the progression of the malignant phenotype of HCC. In conclusion, the molecular mechanism underlying the TMEM209/KPNB1/Wnt/β-catenin axis in HCC progression was elucidated. TMEM209 is a potential biomarker and therapeutic target for HCC.

Structural insights into the recognition of purine-pyrimidine dinucleotide repeats by zinc finger protein ZBTB43.

Purine-pyrimidine repeats (PPRs) can form left-handed Z-form DNA and induce DNA double-strand breaks (DSBs), posing a risk for genomic rearrangements and cancer. The zinc finger (ZF) and BTB domain-containing protein 43 (ZBTB43) is a transcription factor containing two Cys2-His2 (C2H2) and one C3H1 zinc fingers and plays a crucial role in maintaining genomic and epigenomic integrity by converting mutagenic Z-form PPRs to the B-form in prospermatogonia. Despite its importance, the molecular mechanism underlying the recognition of PPRs by ZBTB43 remains elusive. In this study, we determined the X-ray crystal structure of the ZBTB43 ZF1-3 in complex with the B-form DNA containing the CA repeats sequence. The structure reveals that ZF1 and ZF2 primarily recognize the CACA sequence through specific hydrogen-bonding and van der Waals contacts via a quadruple center involving Arg389, Met411, His413, and His414. These interactions were further validated by fluorescence-based DNA-binding assays using mutated ZBTB43 variants. Our structural investigation provides valuable insights into the recognition mechanism of PPRs by ZBTB43 and suggests a potential role for ZBTB43 in the transformation of Z-DNA to B-DNA, contributing to the maintenance of genomic stability.

ORANGE interplays with TCP7 to regulate endoreduplication and leaf size.

Leaf size is a crucial agronomic trait directly affecting crop yield, which is mainly determined by coordinated cell proliferation, growth, and differentiation. Although endoreduplication is known to be correlated with the onset of cell differentiation and leaf size, the underlying molecular mechanisms are largely unclear. The DnaJ-like zinc finger domain-containing protein ORANGE (OR) was initially demonstrated to confer the massive accumulation of carotenoids in cauliflower curds. However, the cauliflower or mutant also possesses other phenotypes such as smaller curds, smaller leaves with elongated petioles, and delayed flowering. Here, we demonstrated that OR physically interacts with the transcription factor TCP7, which promotes endoreduplication by inducing the expression of the cell cycle gene CYCLIN D 1;1 (CYCD1;1). Overexpression of OR resulted in smaller rosette leaves, whereas the OR-silencing plants had larger rosette leaves than wild-type plants. Our microscopic observations and flow cytometry analysis revealed that the variation in leaf size was a result of different endoreduplication levels. Genetic analyses showed that OR functions antagonistically with TCP7 in regulating the endoreduplication levels in leaf cells. While the expression of OR is induced by TCP7, OR represses the transactivation activity of TCP7 by affecting its binding capability to the TCP-binding motif in the promoter region of CYCD1;1. Through this interaction, OR negatively regulates the expression of CYCD1;1 and reduces the nuclear ploidy level in rosette leaf cells. Our findings provide new insights into the regulatory network of leaf size and also reveal a regulatory circuit controlling endoreduplication in leaf cells.

Insertion of short L1 sequences generates inter-strain histone acetylation differences in the mouse

BackgroundGene expression divergence between populations and between individuals can emerge from genetic variations within the genes and/or in the cis regulatory elements. Since epigenetic modifications regulate gene expression, it is conceivable that epigenetic variations in cis regulatory elements can also be a source of gene expression divergence.ResultsIn this study, we compared histone acetylation (namely, H3K9ac) profiles in two mouse strains of different subspecies origin, C57BL/6 J (B6) and MSM/Ms (MSM), as well as their F1 hybrids. This identified 319 regions of strain-specific acetylation, about half of which were observed between the alleles of F1 hybrids. While the allele-specific presence of the interferon regulatory factor 3 (IRF3) binding sequence was associated with allele-specific histone acetylation, we also revealed that B6-specific insertions of a short 3′ fragment of LINE-1 (L1) retrotransposon occur within or proximal to MSM-specific acetylated regions. Furthermore, even in hyperacetylated domains, flanking regions of non-polymorphic 3′ L1 fragments were hypoacetylated, suggesting a general activity of the 3′ L1 fragment to induce hypoacetylation. Indeed, we confirmed the binding of the 3′ region of L1 by three Krüppel-associated box domain-containing zinc finger proteins (KZFPs), which interact with histone deacetylases. These results suggest that even a short insertion of L1 would be excluded from gene- and acetylation-rich regions by natural selection. Finally, mRNA-seq analysis for F1 hybrids was carried out, which disclosed a link between allele-specific promoter/enhancer acetylation and gene expression.ConclusionsThis study disclosed a number of genetic changes that have changed the histone acetylation levels during the evolution of mouse subspecies, a part of which is associated with gene expression changes. Insertions of even a very short L1 fragment can decrease the acetylation level in their neighboring regions and thereby have been counter-selected in gene-rich regions, which may explain a long-standing mystery of discrete genomic distribution of LINEs and SINEs.

Oncoprotein SET-associated transcription factor ZBTB11 triggers lung cancer metastasis

Metastasis is the major cause of lung cancer-related death, but the mechanisms governing lung tumor metastasis remain incompletely elucidated. SE translocation (SET) is overexpressed in lung tumors and correlates with unfavorable prognosis. Here we uncover SET-associated transcription factor, zinc finger and BTB domain-containing protein 11 (ZBTB11), as a prometastatic regulator in lung tumors. SET interacts and collaborates with ZBTB11 to promote lung cancer cell migration and invasion, primarily through SET-ZBTB11 complex-mediated transcriptional activation of matrix metalloproteinase-9 (MMP9). Additionally, by transcriptional repression of proline-rich Gla protein 2 (PRRG2), ZBTB11 links Yes-associated protein 1 (YAP1) activation to drive lung tumor metastasis independently of SET-ZBTB11 complex. Loss of ZBTB11 suppresses distal metastasis in a lung tumor mouse model. Overexpression of ZBTB11 is recapitulated in human metastatic lung tumors and correlates with diminished survival. Our study demonstrates ZBTB11 as a key metastatic regulator and reveals diverse mechanisms by which ZBTB11 modulates lung tumor metastasis.

Anti-ZSCAN1 Autoantibodies Are a Feasible Diagnostic Marker for ROHHAD Syndrome Not Associated with a Tumor.

Recent studies have reported the presence of autoantibodies against zinc finger and SCAN domain-containing protein 1 (ZSCAN1) in the sera of patients with rapid-onset obesity with hypoventilation, hypothalamic and autonomic dysregulation (ROHHAD) syndrome associated with neuroendocrine tumors, suggesting immunologic and paraneoplastic processes as the pathologic underpinnings. Moreover, several hypothalamic regions, including the subfornical organ (SFO), were reported to exhibit antibody reactivity in a patient with ROHHAD syndrome not associated with a tumor. Whether ROHHAD syndrome not associated with a tumor is associated with anti-ZSCAN1 autoantibodies remains unclear. We used a comprehensive protein array analysis to identify candidate molecules in the sera of patients with ROHHAD syndrome and identified ZSCAN1 as a target antigen. We also found that ZSCAN1 was co-expressed at the site of antibody reactivity to the IgG in the patient serum observed in mouse SFOs and an enzyme-linked immunosorbent assay showed that >85% of the patients with ROHHAD syndrome were positive for anti-ZSCAN1 autoantibodies. These results suggest anti-ZSCAN1 autoantibodies as a feasible diagnostic marker in ROHHAD syndrome regardless of the presence of a tumor.

Epigenetic silencing ZSCAN23 promotes pancreatic cancer growth by activating Wnt signaling

ABSTRACT Pancreatic ductal adenocarcinoma (PDAC) is the most malignant tumor. Zinc finger and SCAN domain-containing protein 23 (ZSCAN23) is a new member of the SCAN domain family. The expression regulation and biological function remain to be elucidated. In this study, we explored the epigenetic regulation and the function of ZSCAN23 in PDAC. ZSCAN23 was methylated in 60.21% (171/284) of PDAC and its expression was regulated by promoter region methylation. The expression of ZSCAN23 inhibited cell proliferation, colony formation, migration, invasion, and induced apoptosis and G1/S phase arrest. ZSCAN23 suppressed Panc10.05 cell xenograft growth in mice. Mechanistically, ZSCAN23 inhibited Wnt signaling by interacting with myosin heavy chain 9 (MYH9) in pancreatic cancer cells. ZSCAN23 is frequently methylated in PDAC and may serve as a detective marker. ZSCAN23 suppresses PDAC cell growth both in vitro and in vivo.

Serum DLAT Is a Potential Diagnostic Marker in AFP-Negative HCC

The aim of this study was to analyze dihydrolipoyllysine-residue acetyltransferase (DLAT) expression and diagnostic ability in hepatocellular carcinoma (HCC), assess its role in HCC growth, and factors affecting it. We conducted bioinformatics analyses, examined DLAT expression and prognosis in pre-cancer, and performed Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment studies while investigating its correlation with immunity. We also predicted regulatory factors, and detected DLAT in HCC cells using quantitative PCR (qPCR) and Western blotting, and in patient serum via enzyme-linked immunosorbent assay (ELISA). We found that DLAT was found to be upregulated in HCC and identified as an independent risk factor associated with immune cells. DLAT expression was regulated by hsa-miR-122-5p and the transcription factors zinc finger protein 148 (ZNF148), Myc-associated zinc-finger protein (MAZ), and Zinc finger and BTB domain-containing protein 12 (ZBTB12). Surprisingly, there was an increase in DLAT promoter methylation. The area under the receiver operating characteristic curves (AUCs) for serum DLAT in distinguishing HCC from healthy controls, high-risk individuals, and non-HCC cohorts were 0.905, 0.754, and 0.831, respectively. Combining DLAT with alpha-fetoprotein (AFP) improved diagnostic accuracy, with AUCs of 0.957, 0.819, 0.773, and 0.887 for the respective comparisons. Notably, serum DLAT was positive in 71.4% of AFP-negative HCC patients. And the transfection of hsa-miR-122-5p mimic could down regulate DLAT expression.

ZNF471 Interacts with BANP to Reduce Tumour Malignancy by Inactivating PI3K/AKT/mTOR Signalling but is Frequently Silenced by Aberrant Promoter Methylation in Renal Cell Carcinoma.

Background: Renal cell carcinoma (RCC) is one of the most common malignant tumours of the urinary system. However, the aetiology and pathogenesis of RCC remain unclear. The C2H2 zinc finger protein (ZNF) family is the largest transcriptional regulatory factor family found in mammals, and Krüppel-associated box domain-containing zinc finger proteins (KRAB-ZFPs) constitute the largest subfamily of the C2H2 zinc finger protein family and play an important role in the occurrence and development of tumours. The aim of this study was to explore the role of abnormal methylation of ZNF471 in the development of renal carcinoma. Methods: In this study, we first used the TCGA and EWAS Data Hub databases to analyse the expression and methylation levels of ZNF471 in renal carcinoma tissues and adjacent normal tissues. Second, we collected samples of renal cancer and adjacent normal tissues at Peking University First Hospital to investigate the expression and methylation level of ZNF471 in renal cancer tissues and the relationships between these levels and the clinicopathological features and prognosis of patients with renal cancer. Next, we investigated the effects of ZNF471 on the proliferation, metastasis, cell cycle progression, and apoptosis of renal cell carcinoma cells by cell biology experiments. Finally, we elucidated the underlying molecular mechanisms of ZNF471 in renal cell carcinoma by transcriptome sequencing, bioinformatics analysis and molecular biology experiments. Results: The expression of ZNF471 in renal carcinoma tissues and cell lines was significantly lower than that in adjacent normal tissues and cell lines due to abnormal promoter CpG methylation. Furthermore, the expression of ZNF471 in renal carcinoma tissues was negatively correlated with tumour stage and grade in patients with renal carcinoma. The results of the cell biology experiments showed that ZNF471 could significantly inhibit the proliferation, migration and cell cycle progression of renal cell carcinoma cells and promote apoptosis in these cells. In addition, ZNF471 could interact with BANP and suppress the malignant phenotype of RCC by inactivating the PI3K/AKT/mTOR signalling pathway. Conclusions: As an important tumour suppressor, ZNF471 can interact with BANP in renal cancer cells and inhibit the activation of the PI3K/AKT/mTOR signalling pathway, thereby inhibiting the occurrence and development of renal cancer.

Demethylase FTO inhibits the occurrence and development of triple-negative breast cancer by blocking m 6A-dependent miR-17-5p maturation-induced ZBTB4 depletion.

Triple-negative breast cancer (TNBC) is a subtype of breast cancer, and its mechanisms of occurrence and development remain unclear. In this study, we aim to investigate the role and molecular mechanisms of the demethylase FTO (fat mass and obesity-associated protein) in TNBC. Through analysis of public databases, we identify that FTO may regulate the maturation of miR-17-5p and subsequently influence the expression of zinc finger and BTB domain-containing protein 4 (ZBTB4), thereby affecting the occurrence and progression of TNBC. We screen for relevant miRNAs and mRNAs from the GEO and TCGA databases and find that the FTO gene may play a crucial role in TNBC. In vitro cell experiments demonstrate that overexpression of FTO can suppress the proliferation, migration, and invasion ability of TNBC cells and can regulate the maturation of miR-17-5p through an m 6A-dependent mechanism. Furthermore, we establish a xenograft nude mouse model and collect clinical samples to further confirm the role and impact of the FTO/miR-17-5p/ZBTB4 regulatory axis in TNBC. Our findings unveil the potential role of FTO and its underlying molecular mechanisms in TNBC, providing new perspectives and strategies for the research and treatment of TNBC.

RNA-Seq of Phenotypically Distinct Eimeria maxima Strains Reveals Coordinated and Contrasting Maturation and Shared Sporogonic Biomarkers with Eimeria acervulina.

Strains of Eimeria maxima, an enteric parasite of poultry, vary in virulence. Here, we performed microscopy and RNA sequencing on oocysts of strains APU-1 (which exhibits more virulence) and APU-2. Although each underwent parallel development, APU-1 initially approached maturation more slowly. Each strain sporulated by hour 36; their gene expression diverged somewhat thereafter. Candidate biomarkers of viability included 58 genes contributing at least 1000 Transcripts Per Million throughout sporulation, such as cation-transporting ATPases and zinc finger domain-containing proteins. Many genes resemble constitutively expressed genes also important to Eimeria acervulina. Throughout sporulation, the expression of only a few genes differed between strains; these included cyclophilin A, EF-1α, and surface antigens (SAGs). Mature and immature oocysts uniquely differentially express certain genes, such as an X-Pro dipeptidyl-peptidase domain-containing protein in immature oocysts and a profilin in mature oocysts. The immature oocysts of each strain expressed more phosphoserine aminotransferase and the mature oocysts expressed more SAGs and microneme proteins. These data illuminate processes influencing sporulation in Eimeria and related genera, such as Cyclospora, and identify biological processes which may differentiate them. Drivers of development and senescence may provide tools to assess the viability of oocysts, which would greatly benefit the poultry industry and food safety applications.

De novo missense variants in ZBTB47 are associated with developmental delays, hypotonia, seizures, gait abnormalities, and variable movement abnormalities.

The collection of known genetic etiologies of neurodevelopmental disorders continues to increase, including several syndromes associated with defects in zinc finger protein transcription factors (ZNFs) that vary in clinical severity from mild learning disabilities and developmental delay to refractory seizures and severe autism spectrum disorder. Here we describe a new neurodevelopmental disorder associated with variants in ZBTB47 (also known as ZNF651), which encodes zinc finger and BTB domain-containing protein 47. Exome sequencing (ES) was performed for five unrelated patients with neurodevelopmental disorders. All five patients are heterozygous for a de novo missense variant in ZBTB47, with p.(Glu680Gly) (c.2039A>G) detected in one patient and p.(Glu477Lys) (c.1429G>A) identified in the other four patients. Both variants impact conserved amino acid residues. Bioinformatic analysis of each variant is consistent with pathogenicity. We present five unrelated patients with de novo missense variants in ZBTB47 and a phenotype characterized by developmental delay with intellectual disability, seizures, hypotonia, gait abnormalities, and variable movement abnormalities. We propose that these variants in ZBTB47 are the basis of a new neurodevelopmental disorder.

Transcription Factor Zbtb20 as a Regulator of Malignancy and Its Practical Applications.

Zbtb20 (zinc finger and BTB domain-containing protein 20) is a transcription factor with a zinc finger DNA binding domain and a BTB domain responsible for protein-protein interaction. Recently, this TF has received attention because new data showed its pivotal involvement in normal neural development and its regulatory effects on proliferation and differentiation in different tissues. Zbtb20 was shown to increase proliferation and migration and confer resistance to apoptosis in the contexts of many malignant tumors like hepatocellular carcinoma, non-small-cell lung carcinoma, gastric adenocarcinoma, glioblastoma multiforme, breast cancer, and acute myeloid leukemia. The involvement of Zbtb20 in tumor biology is best studied in hepatocellular carcinoma, where it is a promising candidate as an immunohistochemical tumor marker or may be used in patient screening. Here we review the current data connecting Zbtb20 with malignant tumors.

Circ_0001602 aggravates the progression of acute myeloid leukemia by regulating the miR-192-5p/ZBTB20 axis

ABSTRACTBackgroundAcute myeloid leukemia (AML) is a malignant blood cancer with a poor prognosis and complex pathogenesis. Recently, the critical role of circular RNAs (circRNAs) has been demonstrated in the malignant progression of AML. This study aimed to investigate the functional role and underlying mechanism of circ_0001602 in AML development.MethodsQuantitative real-time polymerase chain reaction (qRT-PCR) assay was conducted for detecting the expression of circ_0001602, CCND3, microRNA-192-5p (miR-192-5p), and Zinc Finger and BTB Domain-Containing Protein 20 (ZBTB20) mRNA. RNase R assay and Actinomycin D assay were implemented to determine the characteristics of circ_0001602. Cell counting Kit-8 (CCK-8) assay was performed to evaluate cell proliferation. Flow cytometry was employed for assessing cell cycle distribution and apoptosis. Dual-luciferase reporter assay and RIP assay were utilized for confirming the interactions between miR-192-5p and circ_0001602 or ZBTB20.ResultsCirc_0001602 and ZBTB20 were upregulated and miR-192-5p level was reduced in AML tissues and cells. Depletion of circ_0001602 repressed cell proliferation and induced cell cycle arrest and apoptosis in AML cells. Functionally, circ_0001602 was identified to be the sponge of miR-192-5p, and miR-192-5p silence restored the suppressive effects of circ_0001602 knockdown on AML cell progression. Furthermore, ZBTB20 was a target of miR-192-5p, and ZBTB20 overexpression neutralized the miR-192-5p-mediated inhibiting actions on the malignant phenotypes of AML cells. Besides, circ_0001602 could sponge miR-192-5p to positively regulate ZBTB20 expression.ConclusionCirc_0001602 contributed to AML cell development at least partially through modulating the miR-192-5p/ZBTB20 axis, which provided new insights for AML treatment.

Genetic features and genomic targets of human KRAB-zinc finger proteins.

Krüppel-associated box (KRAB) domain-containing zinc finger proteins (KZFPs) are one of the largest groups of transcription factors encoded by tetrapods, with 378 members in human alone. KZFP genes are often grouped in clusters reflecting amplification by gene and segment duplication since the gene family first emerged more than 400 million years ago. Previous work has revealed that many KZFPs recognize transposable element (TE)-embedded sequences as genomic targets, and that KZFPs facilitate the co-option of the regulatory potential of TEs for the benefit of the host. Here, we present a comprehensive survey of the genetic features and genomic targets of human KZFPs, notably completing past analyses by adding data on close to a hundred family members. General principles emerge from our study of the TE-KZFP regulatory system, which point to multipronged evolutionary mechanisms underlaid by highly complex and combinatorial modes of action with strong influences on human speciation.