Zinc Finger Research Articles

Identification of the BBX gene family in blueberry at different chromosome ploidy levels and fruit development and response under stress

BackgroundBlueberry (Vaccinium spp.) fruits are rich in flavonoids such as anthocyanins and have a high nutritional value. The zinc finger protein transcription factor B-box (BBX) plays important roles in plant growth and development, hormone response, abiotic stress, and anthocyanin accumulation. However, studies on the BBX family in blueberry are lacking.ResultsIn total, 83 VcBBX and 24 VdBBX genes were identified in tetraploid and diploid blueberry, respectively. A correlation was observed between the number of BBX genes in blueberry and chromosome ploidy. Gene loss and specific replication during blueberry evolution may lead to an imbalance of quantitative relationship between VcBBX and VdBBX genes. The analysis of transcriptome and quantitative reverse transcription–polymerase chain reaction data revealed that the expression pattern of BBX genes depended on the developmental stage of blueberry fruit. Gibberellin inhibited the expression of most VcBBX genes. Abscisic acid promoted the expression of some members of the BBX family. The expression levels of VcBBX15b4, VcBBX21a1, and VcBBX30a in blueberry leaves were significantly downregulated under blue light treatment, whereas that of VcBBX15c3 was significantly upregulated under red light treatment.ConclusionIn total, 83 VcBBX and 24 VdBBX genes were identified in 2 types of blueberries. Fruit development and transcription profiles under different stresses were analyzed. These findings will support further investigation of how BBX genes are involved in regulating hormone treatment and light stress during the growth and development of blueberry.

Technological approaches for commercial production of functional food through fish farming: Opportunities and challenges

Functional foods and nutraceuticals have gained attention as a result of the emergence of several human health disorders, including abdominal, obesity, diabetes, cardiovascular diseases, and neurodegeneration. The components of functional foods influence the physiological system, which enhances human health and fights against illness. The global consumption of fish and fish products has increased in recent years, driven by the presence of omega-3 fatty acids, oligosaccharides, glucosamine, vitamins A, D, and E, as well as minerals such as magnesium, potassium, copper, sulfur, zinc, iodine, and proteins. It is widely acknowledged that functional food ingredients are important for promoting health, lowering the risk of disease, and lowering medical expenses. Fish farming has emerged as a source of novel functional ingredients from marine resources for functional food as well as for therapeutics. The review paper will also cover various technological approaches such as CRISPR-Cas9 mediated gene editing, zinc finger nucleases, and TALENs for enhanced production of bioactive compounds from genetically modified fishes for commercial production of functional food as well as nutraceuticals. Keywords: Fish farming, Zinc finger nuclease, CRISPR/Cas9, Functional food, Nutraceuticals, Omega-3 fatty acids

GATA3: Orchestrating cellular fate through differentiation and proliferation.

Cell proliferation and differentiation are two fundamental biological processes that occur in biological systems, tightly regulated by various factors such as transcription factors (TFs). Zinc finger proteins are TFs responsible for maintaining the biological balance via coordinating development and functionality within the living cells. GATA binding protein 3 (GATA3), one of the zinc finger proteins, plays an essential role in driving differentiation and proliferation-related processes, thereby contributing to the regulation of the dynamism and productivity of living cells. By elucidating the complex interactions governed by GATA3, this underscores its significance in maintaining cellular homeostasis. Thus, the current review delves into the molecular pathways influenced by GATA3, highlighting its involvement in multiple developmental processes of various tissues and body sites, particularly in the hematopoietic system (T-cell differentiation), neural tissue differentiation, adipose tissue, as well as epithelial cell maturation.

Translational Approach using Advanced Therapy Medicinal Products for Huntington's Disease.

Current therapeutic approaches for Huntington's disease (HD) focus on symptomatic treatment. Therefore, the unavailability of efficient disease-modifying medicines is a significant challenge. Regarding the molecular etiology, targeting the mutant gene or advanced translational steps could be considered promising strategies. The evidence in gene therapy suggests various molecular techniques, including knocking down mHTT expression using antisense oligonucleotides and small interfering RNAs and gene editing with zinc finger proteins and CRISPR-Cas9-based techniques. Several post-transcriptional and post-translational modifications have also been proposed. However, the efficacy and long-term side effects of these modalities have yet to be verified. Currently, cell therapy can be employed in combination with conventional treatment and could be used for HD in which the structural and functional restoration of degenerated neurons can occur. Several animal models have been established recently to develop cell-based therapies using renewable cell sources such as embryonic stem cells, induced pluripotent stem cells, mesenchymal stromal cells, and neural stem cells. These models face numerous challenges in translation into clinics. Nevertheless, investigations in Advanced Therapy Medicinal Products (ATMPs) open a promising window for HD research and their clinical application. In this study, the ATMPs entry pathway in HD management was highlighted, and their advantages and disadvantages were discussed.

ZDHHC3-LYPLA1 regulates PRRSV-2 replication through reversible palmitoylation.

Porcine reproductive and respiratory syndrome virus (PRRSV) is a highly contagious swine pathogen, causing respiratory problems in piglets and reproductive failure in sows. Palmitoylation, catalyzed by zinc finger Asp-His-His-Cys (ZDHHC) domain-containing palmitoyl acyltransferases, plays intricate roles in virus infection. However, whether palmitoylation regulates PRRSV replication is incompletely understood. Here, we report that inhibition of palmitoylation by 2-bromo palmitate (2-BP) promotes PRRSV multiplication. ZDHHC3 is identified as the key palmitoyl transferase regulating PRRSV replication in PAMs infection. Mechanistically, ZDHHC3 catalyzes nucleocapsid (N) protein palmitoylation at cysteine 90. This modification prevents the Nsp9-N protein interaction and subsequent viral RNA synthesis. Furthermore, LYPLA1 de-palmitoylates N protein, thus counteracting the ZDHHC3's activity on PRRSV replication. Meanwhile, the administration of small-molecule inhibitor ML348 targeting LYPLA1 could hinder PRRSV-2 replication. In summary, our results underscore the critical role of reversible palmitoylation in PRRSV replication. These findings might provide potential new anti-PRRSV strategies.

ZFP-CanPred: Predicting the effect of mutations in zinc-finger proteins in cancers using protein language models

ZFP-CanPred: Predicting the effect of mutations in zinc-finger proteins in cancers using protein language models

GATAD1 is involved in sphingosylphosphorylcholine-attenuated myocardial ischemia-reperfusion injury by modulating myocardial fatty acid oxidation and glucose oxidation

Modulating the equilibrium between glucose metabolism and lipid metabolism represents highly promising novel strategies for therapy of myocardial ischemia/reperfusion (I/R) injury. Sphingosylphosphorylcholine (SPC), an intermediate metabolite of sphingolipids, has shown cardioprotective roles during myocardial infarction by regulating the activities of various transcript factors. Gene microarray revealed that SPC significantly upregulated the expression of GATA zinc finger domain protein 1 (GATAD1), which is a vital transcript factor affecting heart development and various heart diseases. However, it remains unclear whether SPC is involved in the regulation of cardiac fatty acid and glucose metabolism via GATAD1. In this study, we found that myocardium-specific Gatad1 knockout (Gatad1 CKO) significantly increased the myocardial infarct size, impaired cardiac function in I/R mice, and disrupted the protective effect of SPC on the hearts of I/R mice. Immunofluorescence experiment and western blot evaluation of the nuclear-cytoplasmic fractionation sample showed that GATAD1 acted as a transcription factor and was regulated by SPC. Double fluorescence reporting experiment and quantitative polymerase chain reaction (qPCR) revealed that GATAD1 could inhibit the expression of genes involved in fatty acid oxidation (FAO), i.e., acetyl-coenzyme A acyltransferase 2 (Acaa2) and medium-chain acyl-CoA dehydrogenase (Acadm), and promoted the expression of genes involved in glucose oxidation, i.e., pyruvate dehydrogenase E1 α subunit (Pdha1). Small interfering RNA (SiRNA) or overexpression strategies confirmed the pro-apoptotic roles of Acaa2 and Acadm and anti-apoptotic role of Pdha1 in cardiac myocytes challenged with I/R treatment. In summary, our findings suggest that SPC can be used as a candidate to prevent I/R injury by reshaping fatty acid and glucose metabolism. Transcription factor GATAD1 plays a crucial role in regulating fatty acid oxidation and glucose oxidation homeostasis and is involved in SPC-mediated cardioprotection during I/R of the heart. Our study identifies GATAD1 as a new therapeutic target for clinical treatment of myocardial I/R injury.

ANGPTL3 overcomes sorafenib resistance via suppression of SNAI1 and CPT1A in liver cancer.

Liver cancer, encompassing hepatocellular carcinoma (HCC) and hepatoblastoma, the latter of which primarily occurs in early childhood, is the most common malignant tumor arising from liver and is responsible for a significant number of cancer-related deaths worldwide. Targeted drugs have been used for anti-liver cancer treatment in the advanced stage, while their efficacy is greatly compromised by development of drug resistance. Drug resistance is a complicated process regulated by intrinsic and extrinsic signals and has been associated with poorer prognosis in cancer patients. In the current study, online available dataset analysis uncovered that angiopoietin-like protein 3 (ANGPTL3) manifested lower expression in sorafenib-resistant liver cancer cell lines. Additionally, ANGPTL3 was downregulated in HCC tissues, with its expression positively correlated with good prognosis. Functionally, ectopic expression of ANGPTL3 re-sensitized sorafenib-resistant cells, enhancing the sorafenib-induced reduction in cell viability and migration by suppressing zinc finger protein SNAI1 (SNAI1) expression and the protein stability of carnitine O-palmitoyltransferase 1, liver isoform (CPT1A). Clinical correlation analysis revealed that ANGPTL3 was negatively associated with SNAI1 expression. In conclusion, we identify a novel association between ANGPTL3, SNAI1 and CPT1A on sorafenib therapeutic response. Targeting ANGPTL3/SNAI1/CPT1A axis may serve as a therapeutic approach to improve prognosis of liver cancer patients with sorafenib resistance.

Relationship between blood DNA methylation, diet quality indices and metabolic health: Data from Obekit study.

Epigenetic mechanisms, which can be modulated by dietary factors, have been proposed as a possible factor in understanding interindividual differences in disease susceptibility. We aimed to determine the relationships between DNA methylation (DNAm), diet quality, and metabolic health in Spanish individuals. This is a transversal study encompassing 337 male and female participants in the Obekit study. Diet quality was assessed using a validated semiquantitative food frequency questionnaire and seven previously established scores: overall, healthy and unhealthy Plant-Based Diet Index (PDI, hPDI and uPDI, respectively), dietary diversity score (DDS), unprocessed/minimally processed foods (MPF) and ultra-processed foods (UPF) consumption and Mediterranean diet (MD) score. DNAm was analyzed in white blood cells using the Infinium MethylationEPIC v1.0 BeadChip kit. After filtering by a variance >0.36, we have worked with 5,261 CpG sites. We found four false discovery rate (FDR)-significant correlations between nutrients and CpGs sites: cg00167275 (GLUD1) correlated with alcohol, cg05218090 with folic acid, cg16682935 (PAPSS2) with selenium, and cg09821790 (SLC7A6) with fish food. One differentially methylated region (DMR) located at zinc finger protein gene 57 (ZFP57) was closely related to obesity and specific nutrients, food groups, and diet quality indices. The regression models of diet quality based on DNAm demonstrated that the most predictive values were when UPF and hPDI were considered. Also, UPF and hPDI were the best indices for predicting the main cardiometabolic risk factors. Our finding suggests that specific nutrients and diet quality indices may influence the degree of DNAm and putatively, the metabolic health in Spanish individuals.

Upregulation of p52-ZER6 (ZNF398) increases reactive oxygen species by suppressing metallothionein-3 in neuronal cells.

ZNF398/ZER6 belongs to the Krüppel-associated box (KRAB) domain-containing zinc finger proteins (K-ZNFs), the largest family of transcriptional repressors in higher organisms. ZER6 exists in two isoforms, p52 and p71, generated through alternative splicing. Our investigation revealed that p71-ZER6 is abundantly expressed in the stomach, kidney, liver, heart, and brown adipose tissue, while p52-ZER6 is predominantly found in the stomach and brain. The role of p52-ZER6 in neurons has remained unclear. Leveraging open-source RNA-seq data, we identified metallothionein 3 (MT3) as a target gene of p52-ZER6 in mouse hippocampal neuronal HT-22cells. Through chromatin immunoprecipitation assays, we identified the putative DNA-binding motif (CTAGGGGGGTTGTTATCTCTTTGG) of p52-ZER6 in the promoter region of MT3. Furthermore, we demonstrated an interaction between p52-ZER6 and estrogen receptor alpha (ERα) in the nucleus of SH-SY5Y cells, which led to the inhibition of p52-ZER6's DNA occupancy on the promoter of the MT3 gene. MT3 is a cysteine-rich, low molecular-weight protein known for reducing oxidative stress, reactive oxygen species (ROS), and metal toxicity. Our study revealed that overexpression of p52-ZER6 reduced the levels of MT3, increasing ROS levels, which was mitigated by co-overexpression of ERα. Notably, we also observed upregulation of p52-ZER6 and reduction of MT3 in the cortex of 5xFAD, an Alzheimer's disease (AD) mouse model. These findings suggest a potential pathological mechanism involving p52-ZER6-mediated ROS production in AD pathogenesis.

Infectious Subgenomic Amplicon Strategies for Japanese Encephalitis and West Nile Viruses.

Classical methods for constructing infectious cDNA clones of flaviviruses are often hindered by instability and toxicity. The Infectious-Subgenomic-Amplicons (ISA) method is an advancement which utilizes overlapping DNA fragments representing viral genomic sequence and in-cell recombination to bypass bacterial plasmid assembly. However, the ISA method has limitations due to the toxicity of some ISA DNA fragments in bacteria during synthetic production. We validated modified ISA strategies for producing toxic ISA Japanese encephalitis virus (JEV) and West Nile virus (WNV) DNA fragments. Three approaches were explored, including subdividing toxic DNA fragments into two sub-fragments for synthetic clonal production, using a low-copy bacterial plasmid, and subdividing the toxic DNA fragments into four short overlapping sub-fragments, each up to 1.8 kb. The latter novel approach in ISA applications enabled the synthesis of entirely bacteria-free ISA DNA fragments. Our results demonstrate that subdividing toxic fragments into sub-fragments smaller than 1.8 kb for synthesis is the efficient strategy, circumventing the need for bacterial plasmids and ensuring rapid production of synthetic flaviviruses. This method also shortens the production timeline. We also compared the efficacy of JEV and WNV ISA in zinc finger antiviral protein 1 (ZAP) wild-type and knockout cells and found that knockout cells may be more effective for ISA rescue of flaviviruses, including CpG-enriched strains for live attenuated vaccines. The validated modified ISA strategies provide an efficient approach for producing synthetic JEV and WNV. This will enable rapid research during outbreaks of emerging flaviviruses by facilitating the quick generation of new virus variants.

Functional Role of Bap170 Domains in Enhancer-Dependent Gene Activity in Drosophila melanogaster.

The Bap170 subunit of the SWI/SNF chromatin remodeler exhibits activator functions when artificially recruited to the LacZ reporter promoter in enhancer-dependent transcription. In this study, the functional significance of Bap170 protein domains in reporter activation was analyzed. Deletion of the ARID domain does not reduce Bap170 activity. Increased expression of the LacZ reporter was observed in the form of Bap170 without a region that includes LXXLL motifs. Deletions of the central (RFX domain and IDRs) and C-terminal region (zinc fingers) of Bap170 lead to a significant decrease in transgene expression. Apparently, these regions of Bap170 are critical for the function of this protein in enhancer-dependent transcription.

Zinc-finger PARP proteins ADP-ribosylate alphaviral proteins and are required for interferon-γ-mediated antiviral immunity.

Viral manipulation of posttranslational modifications (PTMs) is critical to enable control over host defenses. Evidence suggests that one such PTM, adenosine 5'-diphosphate (ADP)-ribosylation, is important for viral replication, but the host and viral components involved are poorly understood. Here, we demonstrate that several human poly(ADP-ribose) polymerase (PARP) proteins, including the zinc-finger domain containing PARP7 (TiPARP) and PARP12, directly ADP-ribosylate the alphaviral nonstructural proteins (nsPs), nsP3 and nsP4. These same human PARP proteins inhibit alphavirus replication in a manner that can be antagonized by the ADP-ribosylhydrolase activity of the virally encoded macrodomain. Last, we find that knockdown of any of the three CCCH zinc-finger domain containing PARPs, PARP7, PARP12, or the enzymatically inactive PARP13 (ZAP/ZC3HAV1), attenuates the antiviral effects of interferon-γ on alphavirus replication. Combined with evolutionary analyses, these data suggest that zinc-finger PARPs share an ancestral antiviral function that can be antagonized by the activity of viral macrodomains, indicative of an ongoing evolutionary conflict between host ADP-ribosylation and viruses.

Deletion of smooth muscle ZFP36 promotes neointimal hyperplasia in mice.

Platelet-derived growth factor (PDGF-BB) released from the injured intima induces the proliferation and migration of vascular smooth muscle cells (VSMCs), which is the key mechanism of neointimal hyperplasia. Zinc finger 36 (ZFP36), a widespread RNA-binding protein, is important for pathological processes in many diseases. In this study we investigated the role of ZFP36 in VSMCs proliferation, migration and neointimal hyperplasia in mice. We generated smooth muscle-specific Zfp36 knockout (Zfp36SMKO) mice, and established restenosis mouse models by ligation of left carotid artery in Zfp36SMKO mice. We showed that the expression levels of ZFP36 were significantly decreased in human atherosclerotic coronary arteries and murine injured carotid arteries compared with controls. Compared to control Zfp36fl/fl mice, Zfp36SMKO mice displayed accelerated neointimal hyperplasia. In cultured mouse VSMCs, PDGF-BB (20 ng/mL) significantly downregulated ZFP36 expression through KLF4 binding site in Zfp36 promoter. We revealed that ZFP36 could bind to the mRNA of cell migration-inducing protein (CEMIP) and promoted its degradation in VSMCs, thereby reducing the expression of CEMIP protein. Knockdown of Cemip inhibited VSMCs proliferation and migration induced by Zfp36 knockout, thereby suppressing neointimal hyperplasia in Zfp36SMKO mice. We conclude that vascular smooth muscle ZFP36 has a protective effect against neointimal hyperplasia by reducing CEMIP expression. ZFP36 is downregulated by vascular injury and PDGF-BB treatment, which promotes VSMCs proliferation and migration and neointima formation. The results suggest that targeting ZFP36 may represent a novel therapeutic strategy for preventing or treating neointimal hyperplasia and related cardiovascular diseases.

The zinc-finger transcription factor Blimp1/Prdm1 is required for uterine remodelling and repair in the mouse.

The zinc finger transcription factor Blimp1/PRDM1 regulates gene expression in diverse cell types. Its activity controls the maternal decidual response at early post-implantation stages of development. The present experiments demonstrate surprisingly that Blimp1 activity in the uterus is required for tissue remodelling at sites of embryonic failure. Moreover Blimp1 mutant females are refractory to RU486 induced decidual shedding. RNA-seq together with immunostaining experiments strongly suggest that the failure to up-regulate expression of the matrix metalloprotease Mmp10 in combination with insufficient suppression of BMP signalling, likely explain Blimp1-dependent phenotypic changes. In the post-partum uterus Blimp1 together with Mmp10 are highly upregulated at sites of tissue repair following placental detachment. Conditional Blimp1 removal significantly impairs the re-epithelization process and severely impacts involution of the endometrium and luminal epithelium. Overall these results identify Blimp1 as a master regulator of uterine tissue remodelling and repair.

ZNF251 haploinsufficiency confers PARP inhibitors resistance in BRCA1-mutated cancer cells through activation of homologous recombination.

Poly (ADP-ribose) polymerase inhibitors (PARPis) represent a promising new class of agents that have demonstrated efficacy in treating various cancers, particularly those with BRCA1/2 mutations. Cancer-associated BRCA1/2 mutations disrupt DNA double-strand break (DSB) repair by homologous recombination (HR). PARP inhibitors (PARPis) have been used to trigger synthetic lethality in BRCA1/2-mutated cancer cells by promoting the accumulation of toxic DSBs. Unfortunately, resistance to PARPis is common and can occur through multiple mechanisms, including the restoration of HR and/or stabilization of replication forks. To gain a better understanding of the mechanisms underlying PARPis resistance, we conducted an unbiased CRISPR-pooled genome-wide library screen to identify new genes whose deficiency confers resistance to the PARPi olaparib. Our research revealed that haploinsufficiency of the ZNF251 gene, which encodes zinc finger protein 251, is associated with resistance to PARPis in various breast and ovarian cancer cell lines carrying BRCA1 mutations. Mechanistically, we discovered that ZNF251 haploinsufficiency leads to stimulation of RAD51-mediated HR repair of DSBs in olaparib-treated BRCA1-mutated cancer cells. Moreover, we demonstrated that a RAD51 inhibitor reversed PARPi resistance in ZNF251 haploinsufficient cancer cells harboring BRCA1 mutations. Our findings provide important insights into the mechanisms underlying PARPis resistance by highlighting the role of RAD51 in this phenomenon.

Genome-wide association scan and candidate gene analysis for seed coat color in sesame (Sesamum indicum L.)

IntroductionSeed coat color in sesame is a crucial trait for breeding programs as it is closely associated with important characteristics such as oil content, protein levels, and disease resistance, which directly influence seed quality and market value.MethodsThis study investigates the genetic basis of seed coat color in 200 Sudanese sesame genotypes grown for two consecutive years through comprehensive phenotyping, genomic diversity analysis, genome-wide association studies (GWAS), and candidate gene discovery.Results and discussionPhenotypic analysis across two growing seasons revealed high heritability and significant correlations among color parameters (L*, a*, and b*), indicating strong genetic control over seed coat color. The genomic analysis identified distinct clusters among sesame accessions, with rapid linkage disequilibrium decay suggesting a high level of recombination. GWAS identified significant SNPs associated with seed coat color traits, revealing key genomic regions on chromosomes 3, 6, 9, 12, and 13. Candidate gene analysis highlighted several genes, including DOF zinc finger proteins and WRKY transcription factors, which may play essential roles in pigment biosynthesis pathways. These findings provide valuable insights for breeding programs to enhance desirable seed coat color traits in sesame.

Liposomes-Loaded miR-9-5p Alleviated Hypoxia-Ischemia-Induced Mitochondrial Oxidative Stress by Targeting ZBTB20 to Inhibiting Nrf2/Keap1 Interaction in Neonatal Mice.

Aims: Hypoxia ischemia (HI) is a leading cause of cerebral palsy and long-term neurological sequelae in infants. Given that mitochondrial dysfunction in neurons contributes to HI brain damage, this study aimed to investigate the regulatory role of miR-9-5p in mitochondrial function following HI injury. Results: Overexpression of miR-9-5p in HI mice or H2O2-exposed PC12 cells suppressed neuronal injury, associated with increased mitochondrial copy number, normalizing mitochondrial membrane potential, improved nuclear factor-erythroid factor 2-related factor 2 (Nrf2) activation, and downregulation of Keap1. This was mediated, in part, through the ability of this miR-9-5p to bind and regulate the transcriptional activity of zinc finger and BTB domain-containing protein 20 (ZBTB20). Further study suggested that the knockdown of ZBTB20 exerts neuroprotection by inhibiting Nrf2/Keap1 interaction to promote the translocation of Nrf2 from the cytoplasm to the nucleus and the consequent expression of antioxidant proteins. Notably, the protective effects of miR-9-5p overexpression against HI-induced mitochondrial damage were reversed by the Nrf2 inhibitor ML385. Finally, the utilization of liposomes for the delivery of miR-9-5p (miR-9-5p@Lip) presents a promising therapeutic strategy for the treatment of HI injury. Innovation: miR-9-5p is a potential therapeutic agent for ischemic stroke through its modulation of the ZBTB20/Nrf2/Keap1 signaling pathway, influencing mitochondrial function and antioxidant response. Furthermore, the use of liposomal delivery for miR-9-5p offers a promising therapeutic strategy for HI injury. Conclusion: Overexpression of miR-9-5p protects against cerebral HI injury by modulating mitochondrial function through the ZBTB20/Nrf2/Keap1 signaling pathway. Antioxid. Redox Signal. 00, 000-000.

A pan-cancer analysis: predictive role of ZNF32 in cancer prognosis and immunotherapy response

The zinc finger protein 32 (ZNF32) has been associated with high expression in various cancers, underscoring its significant function in both cancer biology and immune response. To further elucidate the biological role of ZNF32 and identify potential immunotherapy targets in cancer, we conducted an in-depth analysis of ZNF32. We comprehensively investigated the expression of ZNF32 across tumors using diverse databases, including TCGA, CCLE, TIMER2.0, KM-Plotter, cBioPortal, ImmuCellAI. We investigated correlations between ZNF32 expression and various factors such as prognosis, immune infiltration, immunotherapy, DNA methylation, and biological functions. Furthermore, we performed in vitro research to validate the significance of ZNF32 in head and neck cancer (HNSC). Our study revealed that ZNF32 was high in various types of cancer, including ACC, BRCA, and others, indicating its important potential as a prognostic biomarker. Significant changes in CNA and DNA methylation were associated with high ZNF32 expression. ZNF32 was notably linked to various immune characteristics, including immune cell infiltration, MSI, TMB and immune checkpoint gene expression, indicating its potential in informing immunotherapy approaches. Interestingly, in FaDu and CAL27 cell lines, the group with elevated ZNF32 expression exhibited increased levels of immune checkpoint markers, such as CTLA-4 and PD-L1. Overexpression of ZNF32 significantly enhanced proliferation and migration in FaDu and CAL27 cell lines, as demonstrated through CCK-8 assays, colony formation, flow cytometry, Transwell migration, and Boyden invasion assays. Our in vitro experiments confirmed that ZNF32 promotes malignant behavior by driving HNSC cell proliferation and migration. These results imply that ZNF32 might be a promising target for tumor prognosis and immunotherapy. Our results highlight the important role of ZNF32 in tumorigenesis and provide novel perspectives for potential cancer treatment strategies.

An involvement of a new zinc finger protein PbrZFP719 into pear self-incompatibility reaction.

This study indicated that the CCHC-type zinc finger protein PbrZFP719 involves into self-incompatibility by affecting the levels of reactive oxygen species and cellulose content at the tips of pollen tubes. S-RNase-based self-incompatibility (SI) facilitates cross-pollination and prevents self-pollination, which in turn increases the costs associated with artificial pollination in fruit crops. Self S-RNase exerts its inhibitory effects on pollen tube growth by altering cell structures and components, including reactive oxygen species (ROS) level and cellulose content. Presently, only a limited number of genes have been implicated in the gametophytic SI. In this study, the CCHC-type zinc finger proteins (ZFP), PbrZFP719, was found to be more highly expressed in pollen grains and pollen tubes than other ZFPs. Experimental over-expression of PbrZFP719 via pollen magnetofection and its knockdown using antisense oligonucleotides demonstrated that PbrZFP719 positively mediates pollen tube growth in pear. Further analyses revealed that variations in PbrZFP719 expression correlate with the changes in ROS levels and cellulose content at the tips of pollen tubes. Notably, PbrZFP719 expression was reduced in pollen tubes treated with self S-RNase. These results suggest that self S-RNase can inhibit pollen tube growth by decreasing ROS levels and cellulose content through the downregulation of PbrZFP719 expression. The information provide insights into a novel mechanism by which self S-RNase inhibits pollen tube growth during SI reaction and offers a refined approach for gene over-expression in pollen tube.