YY1 Binding Sites Research Articles

DNA breathing dynamics distinguish binding from nonbinding consensus sites for transcription factor YY1 in cells

The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein–DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.

Abstract 35: Elevated MicroRNA-155 Targets HBP1 to Promote the Formation of Macrophage-Derived Foam Cell and This Can Be Effectively Suppressed by YY1/HDACs Complex

Aims: We aim to investigate the role of microRNAs in the formation of macrophage-derived foam cell. Methods and results: Using quantitative RT-PCR, we found that the level of microRNA-155 (miR-155), a macrophage-associated microRNA, was significantly increased both in plasma of atherosclerotic ApoE-/- mice and in macrophages isolated from this animal model. Indeed, oxLDL effectively induced expression and release of miR-155 in macrophages. We further identified that miR-155 was required to mediate oxLDL-induced lipid uptake and ROS production of macrophages. Importantly, ectopic overexpression and knockdown experiments identified that HMG box-containing protein 1(HBP1) is a novel target of miR-155. Knockdown of HBP1considerably enhanced lipid uptake and ROS production in oxLDL-induced macrophages, and overexpression of HBP1 effectively repressed these effects caused by miR-155 overexpression. Interestingly, bioinformatics analysis identified three YY1 binding sites in promoter region of pri-miR- 155. EMSA and ChIP analyses verified YY1 directly binding to its promoter region. Furthermore, quantitative RT-PCR analysis showed that YY1/HDAC2/4 complex negatively regulated the expression of miR-155 to suppress foam cell formation. Conclusions: In oxLDL-induced macrophages, elevated miR-155 directly targets HBP1 to promote lipid uptake and ROS production, and YY1/HDAC2/4 complex effectively inhibits foam cell formation mediated by miR-155. This study reveals a novel molecular mechanism in the atherosclerosis and suggests miR-155 is a potential therapeutic target.

Functional analysis of transcription factor binding sites in human promoters

BackgroundThe binding of transcription factors to specific locations in the genome is integral to the orchestration of transcriptional regulation in cells. To characterize transcription factor binding site function on a large scale, we predicted and mutagenized 455 binding sites in human promoters. We carried out functional tests on these sites in four different immortalized human cell lines using transient transfections with a luciferase reporter assay, primarily for the transcription factors CTCF, GABP, GATA2, E2F, STAT, and YY1.ResultsIn each cell line, between 36% and 49% of binding sites made a functional contribution to the promoter activity; the overall rate for observing function in any of the cell lines was 70%. Transcription factor binding resulted in transcriptional repression in more than a third of functional sites. When compared with predicted binding sites whose function was not experimentally verified, the functional binding sites had higher conservation and were located closer to transcriptional start sites (TSSs). Among functional sites, repressive sites tended to be located further from TSSs than were activating sites. Our data provide significant insight into the functional characteristics of YY1 binding sites, most notably the detection of distinct activating and repressing classes of YY1 binding sites. Repressing sites were located closer to, and often overlapped with, translational start sites and presented a distinctive variation on the canonical YY1 binding motif.ConclusionsThe genomic properties that we found to associate with functional TF binding sites on promoters -- conservation, TSS proximity, motifs and their variations -- point the way to improved accuracy in future TFBS predictions.

A Functional Variant at a Prostate Cancer Predisposition Locus at 8q24 Is Associated with PVT1 Expression

Genetic mapping studies have identified multiple cancer susceptibility regions at chromosome 8q24, upstream of the MYC oncogene. MYC has been widely presumed as the regulated target gene, but definitive evidence functionally linking these cancer regions with MYC has been difficult to obtain. Here we examined candidate functional variants of a haplotype block at 8q24 encompassing the two independent risk alleles for prostate and breast cancer, rs620861 and rs13281615. We used the mapping of DNase I hypersensitive sites as a tool to prioritise regions for further functional analysis. This approach identified rs378854, which is in complete linkage disequilibrium (LD) with rs620861, as a novel functional prostate cancer-specific genetic variant. We demonstrate that the risk allele (G) of rs378854 reduces binding of the transcription factor YY1 in vitro. This factor is known to repress global transcription in prostate cancer and is a candidate tumour suppressor. Additional experiments showed that the YY1 binding site is occupied in vivo in prostate cancer, but not breast cancer cells, consistent with the observed cancer-specific effects of this single nucleotide polymorphism (SNP). Using chromatin conformation capture (3C) experiments, we found that the region surrounding rs378854 interacts with the MYC and PVT1 promoters. Moreover, expression of the PVT1 oncogene in normal prostate tissue increased with the presence of the risk allele of rs378854, while expression of MYC was not affected. In conclusion, we identified a new functional prostate cancer risk variant at the 8q24 locus, rs378854 allele G, that reduces binding of the YY1 protein and is associated with increased expression of PVT1 located 0.5 Mb downstream.

Abstract 1185: EZH2-mediated H3K27 trimethylation silencing of microRNAs in hepatocellular carcinoma

Abstract Although the biological pathways by which misexpressed microRNAs (miRNAs) contribute to the development of hepatocellular carcinoma (HCC) have been extensively investigated, little is known about the upstream regulatory mechanisms. Epigenetic gene silencing in cancer cells is mediated by promoter DNA methylation and at least two distinct histone modifications, polycomb-based histone H3 lysine 27 trimethylation (H3K27me3) and H3 lysine 9 dimethylation (H3K9me2). We have previously demonstrated that EZH2-mediated H3K27me3 is a mechanism of tumor-suppressor gene silencing in cancer that is potentially independent of promoter DNA methylation (Nat Genet 2008;40:741-50). Here we used an integrative genome-wide location and expression analysis to investigate the epigenetic control of miRNA expression in HCC cells and explored the involvement of transcription factors in this process. Chromatin immunoprecipitation coupled with human promoter microarrays revealed that 8, 20, and 15% of the interrogated miRNA promoters were enriched with H3K27me3, H3K9me2 and DNA methylation in Hep3B HCC cells, respectively. Some of these enriched miRNAs e.g. miR-101 and -194 have been reported to be down-regulated in primary HCCs, providing evidence on epigenetic silencing of miRNAs in HCC. Consistent with our previous observation on protein-coding genes, most of the miRNAs enriched with H3K27me3 had no detectable DNA hypermethylation; and most miRNAs showing DNA hypermethylation had no enrichment for H3K27me3. There was also minimal overlap between H3K27me3 and H3K9me2 binding on miRNA promoters. Down-regulation of EZH2 decreased global H3K27me3 level and restored expression of the H3K27me3-targeted miRNAs while 5-aza-2’-deoxycytidine and trichostatin A treatment alone or in combination did not reactivate their expression, further suggesting the independence of EZH2-mediated H3K27me3 in miRNA silencing. To identify the transcription factors involved in the formation of H3K27me3 modification, the -0.5 to +1kb regulatory regions of ∼2000 H3K27me3-bound protein-coding and miRNA genes were submitted to transcription factor binding predictions by TRANSFAC Pro. Interestingly, the binding sites for YY1, known to recruit polycomb for H3K27me3 modifications, were recurrently over-represented in these loci. Quantitative RT-PCR showed that YY1 and EZH2 were over-expressed (defined as greater than 2-fold increase) in 73% (38/52) and 87% (45/52) of HCCs compared with the paired non-tumor tissues. Overall, their expressions were significantly higher in tumor tissues (p < 0.0001) and positively correlated in these 52 pairs of HCCs (p < 0.05). In conclusion, our findings suggest that YY1 may play an important role in EZH2-mediated H3K27me3 for miRNA silencing in HCC. Acknowledgements: This study was partially supported by the General Research Fund 462309, RFCID 09080042 and Collaborative Research Fund CUHK04/CRF/08. Citation Format: {Authors}. {Abstract title} [abstract]. In: Proceedings of the 102nd Annual Meeting of the American Association for Cancer Research; 2011 Apr 2-6; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2011;71(8 Suppl):Abstract nr 1185. doi:10.1158/1538-7445.AM2011-1185

A DNA Variant within the MYO7A Promoter Regulates YY1 Transcription Factor Binding and Gene Expression Serving as a Potential Dominant DFNA11 Auditory Genetic Modifier

Mutations within MYO7A can lead to recessive and dominant forms of inherited hearing loss. We previously identified a large pedigree (referred to as the HL2 family) with hearing loss that first impacts the low and mid frequencies segregating a dominant MYO7A mutation in exon 17 at DNA residue G2164C. The MYO7A(G2164C) mutation predicts a nonconservative glycine-to-arginine (G722R) amino acid substitution at a highly conserved glycine residue. The degree of low and mid frequency hearing loss varies markedly in the family, suggesting the presence of a genetic modifier that either rescues or exacerbates the primary MYO7A(G2164C) mutation. Here we describe a single nucleotide polymorphism (SNP) T/C at position -4128 in the wild-type MYO7A promoter allele that sorts with the degree of hearing loss severity in the pedigree. Electrophoretic mobility shift assay analysis indicates that the SNP differentially regulates the binding of the YY1 transcription factor with the T(-4128) allele creating an YY1 binding site. Immunocytochemistry demonstrates that Yy1 is expressed in hair cell nuclei within the cochlea. Given that Myo7a is also expressed in cochlear hair cells, Yy1 shows the appropriate localization to regulate Myo7a transcription within the inner ear. YY1 appears to be acting as a transcriptional repressor as the MYO7A promoter allele containing the T(-4128) SNP drives 41 and 46% less reporter gene expression compared with the C(-4128) SNP in the ARPE-19 and HeLa cell lines, respectively. The T(-4128) SNP may be contributing to the severe hearing loss phenotype in the HL2 pedigree by reducing expression of the wild-type MYO7A allele.

Rex1/Zfp42 as an epigenetic regulator for genomic imprinting

Zfp42/Rex1 (reduced expression gene 1) is a well-known stem-cell marker that has been duplicated from YY1 in the eutherian lineage. In the current study, we characterized the in vivo roles of Rex1 using a mutant mouse line disrupting its transcription. In contrast to the ubiquitous expression of YY1, Rex1 is expressed only during spermatogenesis and early embryogenesis and also in a very limited area of the placenta. Yet, the gene dosage of Rex1 is very critical for the survival of the late-stage embryos and neonates. This delayed phenotypic consequence suggests potential roles for Rex1 in establishing and maintaining unknown epigenetic modifications. Consistently, Rex1-null blastocysts display hypermethylation in the differentially methylated regions (DMRs) of Peg3 and Gnas imprinted domains, which are known to contain YY1 binding sites. Further analyses confirmed in vivo binding of Rex1 only to the unmethylated allele of these two regions. Thus, Rex1 may function as a protector for these DMRs against DNA methylation. Overall, the functional connection of Rex1 to genomic imprinting represents another case where newly made genes have co-evolved with lineage-specific phenomena.

Oncogenic Potential of Yin Yang 1 Mediated Through Control of Imprinted Genes

The transcription factor Yin Yang (YY) 1 is one of the most evolutionarily well-conserved DNA binding proteins that is ubiquitously expressed among different tissue types. YY1 functions as a critical regulator for a diverse set of genes, making its role in the cancerous environment elusive. Recent studies have demonstrated that clusters of YY1 binding sites are overrepresented in imprinted gene loci. These clustered binding sites may function as a molecular rheostat with respect to YY1 protein levels. YY1 levels were documented to be altered in various tumor tissues in conjunction with the transcriptional levels of the imprinted genes it regulates. This review highlights the unexplored mechanism through which fluctuations in YY1 protein levels alter the transcriptional status of imprinted genes containing clustered YY1 binding sites, which potentially could affect cancer development and/or progression.

Reply to Klar: Key role of YY1 in neoangiogenesis

In our study (1), we investigated the role of YY1 and described a potential molecular mechanism of cross-talk between YY1 and the VEGF network. YY1 binds hypoxia-inducible factor-1α on VEGF regulatory region. The specific silencing of YY1 reduced VEGF transcription by approximately 20%, the availability of active VEGF protein via AKT, and neoangiogenesis (1). Klar (2) brings to our attention the possibility that these effects also may be mediated by the homolog protein YY2. First, we consider that proteins that play a critical role in the cell occur often in multiple distinct homologous forms but not necessarily with redundant functions. YY1 and YY2 are encoded by genes mapping on different chromosomes, transcribed mRNAs with different sizes, and the proteins have different molecular masses on SDS/PAGE (70 kDa and 58 kDa, respectively). Until now, all of the studies on YY family proteins have failed to address their interactions, despite their homology (3). Second, Klar suggests that YY1 and YY2 can compete for the same regulatory element. It is well established that the role of YY1 is expression dependent. YY1 is overexpressed in human osteosarcomas (4), and YY1 is essential for murine sarcoma metastasis and survival (5). In contrast, the expression pattern of YY2 is completely unknown, and YY1/YY2 relative expression was reported to be different among cell lines. In HeLa cells (3), YY2 was present as 10.3 ± 7 per nanogram of RNA, and YY1 was present as 751 ± 0.1 mRNA copies. Third, 10% of human genes contain YY1 binding sites on their promoter. However, because YY1 and YY2 recognize the same consensus sequences, they do not bind all of the same promoters (at least in humans), they do not have the same affinity and avidity, and they do not require the same binding partner (3). YY1 can compete with YY2 to bind the target sequence whereas the opposite has not been documented. Klar and Bode (6) reported that fivefold molar excess of YY2 is not able to rescue the effects of YY1 (their figure 6B), indicating that YY1 and YY2 bind the same sequences with a markedly different affinity. Finally, Klar requests technical clarification about the specificity of siRNA against YY1. We designed YY1 siRNA oligonucleotides that did not recognize YY2 mRNA, as demonstrated by BLAST analysis using the National Center for Biotechnology Information Map Viewer Genome Browser. The sequences used in our study were: for the upper strand, 5′GCTCCAAGAACAATAGCTTGCCGAAGCAAGCTATTGTTCTTGGAGC3′; for the bottom strand, 5′GCTCCAAGAACAATAGCTTGCTTCGGCAAGCTATTGTTCTTGGAGC3′. Additionally, there are also commercially available siRNA specific for YY1 (Sigma TRC019894) that can be used alternatively in further investigations.

Constitutive expression of the brg1 gene requires GC-boxes near to the transcriptional start site

We previously reported that BRG1, an ATPase subunit of SWI/SNF chromatin remodelling complexes, is constitutively expressed and that the alternative ATPase subunit (BRM) is inducibly expressed through differentiation in mammalian cells. In the present study, the regulatory elements that confer constitutive expression on brg1 were explored. First, we analysed the promoter proximal region surrounding its transcriptional start site. Using computer-aided analysis, a TATA-less, GC-rich promoter containing four putative binding sites for Sp1/3 was predicted. One of the putative Sp1/3-binding sites (from -21 to -15 bp) overlapped with a putative YY1-binding site. A gel-shift assay showed that YY1 but not Sp1/3 bound to this sequence and that Sp3 but not Sp1 bound to the other three predicted binding sites. Furthermore, chromatin immunoprecipitation analysis showed that Sp3 and YY1 bound to the promoter region together with TATA-binding protein in vivo. In vivo and in vitro binding assays showed that Sp3 and YY1 interacted with each other. Together, these results suggest that Sp3 and YY1 recruit general transcription factors and facilitate the assembly of a preinitiation complex.

Imprinted genes show unique patterns of sequence conservation.

BackgroundGenomic imprinting is an evolutionary conserved mechanism of epigenetic gene regulation in placental mammals that results in silencing of one of the parental alleles. In order to decipher interactions between allele-specific DNA methylation of imprinted genes and evolutionary conservation, we performed a genome-wide comparative investigation of genomic sequences and highly conserved elements of imprinted genes in human and mouse.ResultsEvolutionarily conserved elements in imprinted regions differ from those associated with autosomal genes in various ways. Whereas for maternally expressed genes strong divergence of protein-encoding sequences is most prominent, paternally expressed genes exhibit substantial conservation of coding and noncoding sequences. Conserved elements in imprinted regions are marked by enrichment of CpG dinucleotides and low (TpG+CpA)/(2·CpG) ratios indicate reduced CpG deamination. Interestingly, paternally and maternally expressed genes can be distinguished by differences in G+C and CpG contents that might be associated with unusual epigenetic features. Especially noncoding conserved elements of paternally expressed genes are exceptionally G+C and CpG rich. In addition, we confirmed a frequent occurrence of intronic CpG islands and observed a decelerated degeneration of ancient LINE-1 repeats. We also found a moderate enrichment of YY1 and CTCF binding sites in imprinted regions and identified several short sequence motifs in highly conserved elements that might act as additional regulatory elements.ConclusionsWe discovered several novel conserved DNA features that might be related to allele-specific DNA methylation. Our results hint at reduced CpG deamination rates in imprinted regions, which affects mostly noncoding conserved elements of paternally expressed genes. Pronounced differences between maternally and paternally expressed genes imply specific modes of evolution as a result of differences in epigenetic features and a special response to selective pressure. In addition, our data support the potential role of intronic CpG islands as epigenetic key regulatory elements and suggest that evolutionary conserved LINE-1 elements fulfill regulatory functions in imprinted regions.

The Canonical BMP Signaling Pathway Plays a Crucial Part in Stimulation of Dentin Sialophosphoprotein Expression by BMP-2

Dentin sialophosphoprotein (DSPP), a typical dentin-specific protein, is mainly expressed in the dentin extracellular matrix and plays a role in dentin mineralization. BMP-2 provides a strong signal for differentiation and mineralization of odontoblasts and osteoblasts. Previously, BMP-2 treatment is reported to stimulate Dspp expression in the MD10-F2 pre-odontoblast cells through activation of the heterotrimeric transcription factor Y (NF-Y). The canonical BMP signaling pathway is known to contribute greatly to biomineralization, however, it is not known whether it is involved in Dspp expression. Here, we investigated this question. Activation of the canonical BMP-2 signaling pathway in MDPC-23, preodontoblast cell, by overexpression of constitutively active Smad1/5 or downstream transcription factors Dlx5 and Runx2 stimulated Dspp expression. Conversely, knockdown of each element with siRNA significantly blocked the BMP-2-induced Dspp expression. To test whether these transcription factors downstream of BMP-2 are directly involved in regulating Dspp, we analyzed the mouse Dspp promoter. There are 5 well conserved homeodomain binding elements, H1 to H5, in Dspp proximal promoter regions (-791 to +54). A serial deletion of H1 and H2 greatly changed basal promoter activity and responsiveness to Dlx5 or Msx2. However, further deletions did not change the responsiveness to Dlx5 or Msx2. H1 and H2 sites can be suggested as specific response elements of Dlx5 and Msx2, respectively, based on their promoter activity modulation. Thus, the canonical BMP-2 signaling pathway plays a crucial part in the regulation of Dspp expression through the action of Smads, Dlx5, Runx2, and Msx2.

A variant of the interleukin‐1β gene in European sea bass, Dicentrarchus labrax L., is associated with increased resistance against Vibrio anguillarum

Vibriosis caused by the pathogenic bacterium Vibrio (Listonella) anguillarum leads to serious losses in European sea bass, Dicentrarchus labrax. Because of its pleiotropic activity in controlling immune and inflammatory responses against various pathogens, interleukin-1beta (IL-1beta) is an attractive candidate for resistance to bacterial vibriosis. Four polymorphisms c.76 + 52C>T, c.76 + 157A>G, c.76 + 215A>and c76 + 310A>G of IL1B were genotyped in progeny of four families of wild sea bass captured in geographically distinct regions of the Black Sea and Sea of Azov and challenged with V. anguillarum. In the transmission disequilibrium test, the TGGG haplotype of IL1B showed significant overtransmission from parents to surviving progeny, thereby suggesting an association with higher resistance to V. anguillarum infection (Odds Ratio 0.38, P < 10(-7)). Using a luciferase reporter assay, we found a 1.4-fold increase in transcription activity of the protective IL1B TGGG variant compared to the susceptible CAAA variant of IL1B. The higher transcriptional activity of IL1B TGGG may arise from the functional effects of c.76 + 157A>G and c.76 + 215A>G polymorphisms disrupting potential binding sites for glucocorticoid receptor and YY1, both are negative transcription regulators.

The Impact of CpG Island on Defining Transcriptional Activation of the Mouse L1 Retrotransposable Elements

BackgroundL1 retrotransposable elements are potent insertional mutagens responsible for the generation of genomic variation and diversification of mammalian genomes, but reliable estimates of the numbers of actively transposing L1 elements are mostly nonexistent. While the human and mouse genomes contain comparable numbers of L1 elements, several phylogenetic and L1Xplore analyses in the mouse genome suggest that 1,500–3,000 active L1 elements currently exist and that they are still expanding in the genome. Conversely, the human genome contains only 150 active L1 elements. In addition, there is a discrepancy among the nature and number of mouse L1 elements in L1Xplore and the mouse genome browser at the UCSC and in the literature. To date, the reason why a high copy number of active L1 elements exist in the mouse genome but not in the human genome is unknown, as are the potential mechanisms that are responsible for transcriptional activation of mouse L1 elements.Methodology/Principal FindingsWe analyzed the promoter sequences of the 1,501 potentially active mouse L1 elements retrieved from the GenBank and L1Xplore databases and evaluated their transcription factors binding sites and CpG content. To this end, we found that a substantial number of mouse L1 elements contain altered transcription factor YY1 binding sites on their promoter sequences that are required for transcriptional initiation, suggesting that only a half of L1 elements are capable of being transcriptionally active. Furthermore, we present experimental evidence that previously unreported CpG islands exist in the promoters of the most active TF family of mouse L1 elements. The presence of sequence variations and polymorphisms in CpG islands of L1 promoters that arise from transition mutations indicates that CpG methylation could play a significant role in determining the activity of L1 elements in the mouse genome.ConclusionsA comprehensive analysis of mouse L1 promoters suggests that the number of transcriptionally active elements is significantly lower than the total number of full-length copies from the three active mouse L1 families. Like human L1 elements, the CpG islands and potentially the transcription factor YY1 binding sites are likely to be required for transcriptional initiation of mouse L1 elements.

A role for YY1 in repression of dominant negative LEF-1 expression in colon cancer

Lymphoid enhancer factor 1 (LEF-1) mediates Wnt signaling via recruitment of β-catenin to target genes. The LEF1 gene is aberrantly transcribed in colon cancers because promoter 1 (P1) is a Wnt target gene and is activated by TCF–β-catenin complexes. A second promoter in intron 2 (P2) produces dominant negative LEF-1 isoforms (dnLEF-1), but P2 is silent because it is repressed by an upstream distal repressor element. In this study we identify Yin Yang 1 (YY1) transcription factor as the P2-specific factor necessary for repression. Site-directed mutagenesis and EMSA were used to identify a YY1-binding site at +25 in P2, and chromatin immunoprecipitation assays detected YY1 binding to endogenous LEF1 P2. Mutation of this site relieves P2 repression in transient transfections, and knockdown of endogenous YY1 relieves repression of integrated P2 reporter constructs and decreases the H3K9me3 epigenetic marks. YY1 is responsible for repressor specificity because introduction of a single YY1-binding site into the P1 promoter makes it sensitive to the distal repressor. We also show that induced expression of dnLEF-1 in colon cancer cells slows their rate of proliferation. We propose that YY1 plays an important role in preventing dnLEF-1 expression and growth inhibition in colon cancer.

Unfolded protein response suppresses CEBPA by induction of calreticulin in acute myeloid leukaemia

The unfolded protein response (UPR) is triggered by the accumulation of misfolded proteins within the endoplasmic reticulum (ER). The role of the UPR during leukemogenesis is unknown so far. Here, we studied the induction of mediators of the UPR in leukaemic cells of AML patients. Increased expression of the spliced variant of the X-box binding protein 1 (XBP1s) was detected in 17.4% (16 of 92) of AML patients. Consistent with activated UPR, this group also had increased expression of ER-resident chaperones such as the 78 kD glucose-regulated protein (GRP78) and of calreticulin. Conditional expression of calreticulin in leukaemic U937 cells was found to increase calreticulin binding to the CEBPA mRNA thereby efficiently blocking translation of the myeloid key transcription factor CEBPA and ultimately affecting myeloid differentiation. Consequently, leukaemic cells from AML patients with activated UPR and thus increased calreticulin levels showed in fact suppressed CEBPA protein expression. We identified two functional ER stress response elements (ERSE) in the calreticulin promoter. The presence of NFY and ATF6, as well as an intact binding site for YY1 within these ERSE motifs were essential for mediating sensitivity to ER stress and activation of calreticulin. Thus, we propose a model of the UPR being activated in a considerable subset of AML patients through induction of calreticulin along the ATF6 pathway, thereby ultimately suppressing CEBPA translation and contributing to the block in myeloid differentiation.

Regulation of the LEF1 gene's alternative promoter

LEF1 is a DNA‐binding transcription factor and a downstream component of the Wnt signaling pathway. The LEF1 gene has multiple promoters and produces two distinct proteins: a full‐length, growth‐promoting form produced from promoter 1 (P1), LEF1, and a truncated, growth‐suppressing form produced from promoter 2 (P2), dnLEF1. In tissues where LEF1 is normally expressed, both promoters are active, producing both forms of LEF1. However, in colon cancer, LEF1 is aberrantly expressed, and only the full‐length, growth‐promoting protein is produced. P1 is a Wnt target, explaining its transcriptional upregulation in Wnt‐driven colon cancers. P2 is silent because it is actively repressed. A genomic region upstream of P2 that is necessary for its repression has been delimited, however, the protein components and exact mechanism of repression are unknown. In this study we describe one component of the repressor machinery, identified through site‐directed mutagenesis of the LEF1 core promoter 2. A YY1 binding site at the +25 location was identified, which, when mutated, greatly reduces repressor function. The binding of YY1 to the +25 site in vitro is shown by gel shift, while ChIP suggests in vivo binding of YY1 within a colon cancer cell line. The functional role of YY1 is confirmed through siRNA knockdown of YY1, which results in loss of repressor function. These findings suggest a pivotal role for YY1 in repression of P2.Supported by NIH.

A Region of the Human HOXD Cluster that Confers Polycomb-Group Responsiveness

Polycomb group (PcG) proteins are essential for accurate axial body patterning during embryonic development. PcG-mediated repression is conserved in metazoans and is targeted in Drosophila by Polycomb response elements (PREs). However, targeting sequences in humans have not been described. While analyzing chromatin architecture in the context of human embryonic stem cell (hESC) differentiation, we discovered a 1.8kb region between HOXD11 and HOXD12 (D11.12) that is associated with PcG proteins, becomes nuclease hypersensitive, and then shows alteration in nuclease sensitivity as hESCs differentiate. The D11.12 element repressed luciferase expression from a reporter construct and full repression required a highly conserved region and YY1 binding sites. Furthermore, repression was dependent on the PcG proteins BMI1 and EED and a YY1-interacting partner, RYBP. We conclude that D11.12 is a Polycomb-dependent regulatory region with similarities to Drosophila PREs, indicating conservation in the mechanisms that target PcG function in mammals and flies.

Isolation and Functional Analysis of CXCR7 Promoter - a Novel Receptor for Stromal Derived Factor-1 (SDF-1): Different Regulation of Expression in Human Hematopoietic Cells Versus Pediatric Sarcomas.

Abstract 4583Stromal derived factor-1 (SDF-1) binds to seven transmembrane-span G-protein coupled receptor CXCR4 and directs homing of CXCR4+ hematopoietic stem cells to bone marrow (BM) as well as metastasis of CXCR4+ cancer cells. Recently, a new SDF-1 binding receptor has been identified and named CXCR7. With identification of this receptor a role of SDF-1 in directing chemotaxis of CXCR7+ hematopoietic cells as well as metastasis of CXCR7+ tumors become more complex. While CXCR7 is expressed at very low level on normal hematopoietic stem cells, its expression becomes high on leukemic cells. Similarly we noticed high expression of CXCR7 on several pediatric sarcomas (e.g., rhabdomyosarcomas and neuroblastomas) that very often metastasize/infiltrate BM. The aim of our study was to evaluate 5′ fragment of CXCR7 gene for promoter activity and analyze how its expression is regulated in CXCR7+ human hematopoietic cells as well as in CXCR7+ human rhabdomyosarcoma cells (RMS). The putative CXCR7 promoter was cloned by employing specific primers for 5′ fragment of CXCR7 gene. We found that this 2.5 kb 5′ DNA fragment adjacent to CXCR7 gene contains three potential hypoxia responsive element (HRE)- (-100-104, -965-969, -1306-1310), five NF-kB- (-32-42, -308-318, -1019-1029, -1375-1379, -2145-2155), four NRF-1 binding sites (-1030-1040, -1468-1478, -1980-1990, -2085-2095), one c-myb binding site at -15-19 and at -702-706 a binding site for negative transcription regulatory factor YY1. We generated 8 constructs containing smaller CXCR7 promoter fragments and three constructs containing mutated distal NF-kB and HREs as well as c-myb that were subcloned into a pGL4.10 vector. The promoter activity of these fragments was tested in transfected human hematopoietic cells (THP-1) and RMS cell line (RD) by measuring luciferase activity. While the minimal promoter activity in human hematopoietic cells was retained in 80 bp short fragment containing c-myb binding site, similar activity in human rhabdomyosarcoma cells required longer 150 bp fragment containing proximal NF-kB binding element. We noticed that while mutation of c-myb binding site in CXCR7 promoter in THP-1 cells reduces promoter activity by ∼50%, mutation of proximal NF-kB-binding site in CXCR7 promoter completely inhibits promoter activity in RD cells. This was confirmed by knock-down of c-myb by shRNA and chemical inhibition of NF-kB respectively. Furthermore, we noticed that during hypoxia in contrast to CXCR4, CXCR7 expression does not change in hematopoietic cells, however is significantly downregulated in rhabdomyosarcoma cells. This could be explained by upregulation of negative transcripton factor YY1 during hypoxia, as evidenced by RQ-PCR and confirmed by CHIP assay. In conclusion we have demonstrated that 5′ fragment of CXCR7 possesses promoter activity and is differently regulated in hematopoietic versus sarcoma cells - in c-myb or NF-kB dependent manner respectively. Furthermore, we also found that in contrast to hematopoietic cells hypoxia inhibits CXCR7 promoter activity in RMS cells in YY1-dependent manner. Disclosures:No relevant conflicts of interest to declare.

YY1-dependent transcriptional regulation of the human GDAP1 gene

Charcot–Marie–Tooth disease (CMT) is a heritable neurodegenerative condition, some types of which (notably CMT4A) are caused by mutations in the GDAP1 gene that encodes a protein of unknown molecular function implicated in regulation of mitochondrial fission. Here we present for the first time a functional analysis of the GDAP1 gene promoter which we found to be transcriptionally regulated by YY1, a broadly studied factor that seems to be involved in regulating many of the same cellular phenomena as GDAP1. We show that GDAP1 is broadly expressed in cancer cell lines of different tissue origin, contrasting with the restricted neuronal distribution reported by some authors. There is a consensus YY1 binding site in the GDAP1 core promoter which we show to be functional in both in vitro binding assays and in living cells. Overexpression of YY1 activated the GDAP1 promoter in a reporter gene system as well as increased the level of endogenous mRNA. RNAi-mediated knockdown of YY1 in HEK293 cells led to decreased GDAP1 expression. While YY1 is known to exert both positive and negative regulatory influences on nuclear-encoded mitochondrial proteins, as well as on neurodegeneration-related genes, in all cell lines we studied (including neuroblastoma) the effect of YY1 on GDAP1 expression is activatory. This leads to interesting conclusions about the possible clinical role of this interaction and suggests a broader regulatory network.