Reply to Klar: Key role of YY1 in neoangiogenesis

Abstract

In our study (1), we investigated the role of YY1 and described a potential molecular mechanism of cross-talk between YY1 and the VEGF network. YY1 binds hypoxia-inducible factor-1α on VEGF regulatory region. The specific silencing of YY1 reduced VEGF transcription by approximately 20%, the availability of active VEGF protein via AKT, and neoangiogenesis (1). Klar (2) brings to our attention the possibility that these effects also may be mediated by the homolog protein YY2. First, we consider that proteins that play a critical role in the cell occur often in multiple distinct homologous forms but not necessarily with redundant functions. YY1 and YY2 are encoded by genes mapping on different chromosomes, transcribed mRNAs with different sizes, and the proteins have different molecular masses on SDS/PAGE (70 kDa and 58 kDa, respectively). Until now, all of the studies on YY family proteins have failed to address their interactions, despite their homology (3). Second, Klar suggests that YY1 and YY2 can compete for the same regulatory element. It is well established that the role of YY1 is expression dependent. YY1 is overexpressed in human osteosarcomas (4), and YY1 is essential for murine sarcoma metastasis and survival (5). In contrast, the expression pattern of YY2 is completely unknown, and YY1/YY2 relative expression was reported to be different among cell lines. In HeLa cells (3), YY2 was present as 10.3 ± 7 per nanogram of RNA, and YY1 was present as 751 ± 0.1 mRNA copies. Third, 10% of human genes contain YY1 binding sites on their promoter. However, because YY1 and YY2 recognize the same consensus sequences, they do not bind all of the same promoters (at least in humans), they do not have the same affinity and avidity, and they do not require the same binding partner (3). YY1 can compete with YY2 to bind the target sequence whereas the opposite has not been documented. Klar and Bode (6) reported that fivefold molar excess of YY2 is not able to rescue the effects of YY1 (their figure 6B), indicating that YY1 and YY2 bind the same sequences with a markedly different affinity. Finally, Klar requests technical clarification about the specificity of siRNA against YY1. We designed YY1 siRNA oligonucleotides that did not recognize YY2 mRNA, as demonstrated by BLAST analysis using the National Center for Biotechnology Information Map Viewer Genome Browser. The sequences used in our study were: for the upper strand, 5′GCTCCAAGAACAATAGCTTGCCGAAGCAAGCTATTGTTCTTGGAGC3′; for the bottom strand, 5′GCTCCAAGAACAATAGCTTGCTTCGGCAAGCTATTGTTCTTGGAGC3′. Additionally, there are also commercially available siRNA specific for YY1 (Sigma TRC019894) that can be used alternatively in further investigations.