Yellow Mosaic Research Articles

Determining genetic combining ability, heterotic potential and gene action for yield contributing traits and Yellow Vein Mosaic Virus (YVMV) resistance in Okra (Abelmoschus esculentus(L.) Monech.)

AbstractBreeding for resistance to biotic stress and higher yield is a continuous process. Thus, the identification of desirable parents with good combining ability and nature of gene action for the target trait is of utmost importance. Hence, in this present investigation, 10 lines and three testers of Okra were crossed in line × tester mating design to generate 30 testcross progenies and their evaluation along with parents and check in a randomized complete block design with three replications. To depict the true picture of genetic variation among the parental genotypes, molecular diversity analysis was also carried out using genomic-simple sequence repeats before crossing to ascertain that sufficient variability is present among the parents. The molecular analysis grouped the parental genotypes into four clusters (I–IV). The analysis of variance revealed that all the treatments were significant for most of the traits. The combining ability analysis suggested Pusa A-4 as the best general combiner for earliness, Pusa Bhindi-5 for high yield, and DOV-92 for fruit length, plant height, yield per plant, and coefficient of infection for Yellow Vein Mosaic Virus Disease resistance. Similarly, the specific combining ability analysis suggested that the cross combinations DOV-92 × Pusa Bhindi-5 followed by DOV-92 × Pusa A-4 and DOV-92 × Pusa Sawani exhibit high economic heterosis for yield per plant as well as for disease resistance. Finally, estimation of the degree of dominance and predictability ratio was also worked out which indicated the prevalence of non-additive gene action for most of the traits pointing towards sufficient scope for heterosis breeding in Okra.

First Report of Mume Virus A Infection of Prunus persica in China

Mume virus A, belonging to Capillovirus in the family Betaflexiviridae, was discovered recently from Japanese apricot (Prunus mume) and exhibited diffuse chlorotic spots on leaves (Marais et al. 2018). To date, Japanese apricot is the only known host of Mume virus A (MuVA) (Maliogka et al. 2018). Peach (Prunus persica) is a delicious and healthy summer fruit grown in most temperate regions of the world. More than 20 different viruses infecting peach trees have been reported (Jo et al. 2018). In April 2019, the leaves from four peach trees showing severe yellow mosaic and leaf curling were collected from peach orchards in Xinjiang, China. The pooled total RNA was extracted from these four trees leaves with TRIzol reagent (Life Technologies Corporation, Carlsbad, CA) and subjected to high-throughput sequencing (HTS) using a PE150 sequence strategy on an Illumina HiSeq2000 (Novogene Corporation, Tianjin, China). Approximately 39.3 million of 150-bp paired-end reads were obtained and used for de novo transcriptome assembly by SPAdes Genome Assembler (Bankevich et al. 2012). A total of 89,163 contigs with N50 of 866 bp were obtained and then were annotated by BLASTX analysis against the NCBI nr virus database (Altschul et al. 1997). Six known viruses (apple chlorotic leaf spot virus, Asian prunus virus 2, cherry green ring mottle virus, nectarine stem pitting-associated virus, peach associated luteovirus, and plum bark necrosis stem pitting-associated virus) and one known viroid (hop stunt viroid) were identified. Moreover, a 7,623-bp contig with a coverage of 84.4-fold was identified as capillovirus-related sequence. To classify the capillovirus accurately, pairwise genome alignments analysis was performed between all members of the Capillovirus genus using PASC online tool (Bao et al. 2014). The closest match was the genome of MuVA (NC_040568.1), sharing 78.36% nucleotide identity, followed by those of some isolates of cherry virus A, sharing less than 58.5% nucleotide identity. This result suggests that the capillovirus from peach belongs to the same species with the MuVA from apricot but should be a different isolate. We designated it as isolate pp, and its HTS-derived viral genome sequence was deposited in GenBank (accession no. MN412555). To confirm the HTS experiment results, from the same peach orchards, 23 peach leaf samples from different trees were collected, and total RNA was extracted with TRIzol reagent with standard procedures following the instructions. The RNA was subsequently used to test for pp isolate by reverse transcription polymerase chain reaction (PCR) using specific primers DT-MVAF5716 (5′-CTTCACATCGGAGCTGTCCT-3′) and DT-MVAR6277 (5′-TGCTGATTGCTTCAGACCCT-3′), targeting a portion of the open reading frame 2 (putative movement protein). Eleven samples produced the expected 560-bp PCR fragment. Three PCR products randomly selected were cloned into pMD19-T Vector (TaKaRa) for Sanger sequencing. All sequences of amplicons shared nearly 100% sequence identity with the corresponding region of the HTS-derived viral genome sequence. However, at least the other two viruses and viroid had been detected in all 11 MuVA-positive samples, so the symptoms of the initial sample cannot be explained by MuVA infection. To our knowledge, this is the first report of MuVA infecting peach trees. This report suggests that MuVA may have a broad host range in the genus Prunus.

Screening of Advanced Breeding Lines (ABLs) of green gram [Vigna radiata (L.) Wilczek] in F6 generation for reaction to Mungbean Yellow Mosaic Virus (MYMV) disease under field condition

Green gram is a store of nutrients and is a hardy pulse crop. It provides huge amount of phytochemicals and antioxidants but production is affected by many biological stress factors and among them MYMV stands first. Keeping this point in view, in the present investigation, 110 ABLs derived from fourteen families of green gram were evaluated for reaction to MYMV during summer-2019 at MARS, University of Agricultural Sciences, Dharwad, Karnataka. Amongst the breeding lines evaluated, 2BRD-2, 3BRD-18, 3BRD-9, 4BRD-1, 6BRD-9, 7BRD-7, 7BRD-12, 8BRD-20, E-19, PM-5 recorded resistant reaction and 5BRD-14 and 7BRD-13 recorded moderate resistance to MYMV with less than 10 per cent PDI value. Among 11 checks, TM-96-2 and SML-1815 showed resistance reaction; LGG-460 and RGM-1028 showed highly resistance reaction; MH-421 and IPM-409-4 showed moderately resistance reaction to MYMV with less than 20 per cent PDI value. These ABLs could be further used in resistant breeding programmes.

The C-terminal region of the 2a protein and 2b protein of cucumber mosaic virus are involved in the induction of shoestring-like leaf blade in tomato

Cucumber mosaic virus (CMV) has numerous strains with distinct pathological properties in nature. In this study, we focused on the distinct host-specificity of two isolates of CMV regarding induction of the shoestring-like leaf blade (SLB) in tomato (Solanum lycopersicum cv. Sekaiichi). During the initial infection stage, plants inoculated with CMV-D8 and CMV-Y developed green/yellow systemic mosaic and stunting. Late in infection, CMV-D8 caused severe systemic symptoms with SLB on the newly emerged leaves, whereas CMY-Y caused severe yellow mosaic with stunting. Accumulation of viral RNA of CMV-D8 during initial infection was higher than for CMV-Y, but their levels did not differ significantly at 5 weeks post inoculation. Pseudorecombination and recombination analyses between CMV-D8 and CMV-Y genomic RNAs showed that recombinant that contained the C-terminal region of 2a and the entire 2b protein of CMV-D8 (D2a-C/D2b) induced SLB. Changing isoleucine to valine at position 830 in the 2a ORF played an important role in formation of chronic SLB. We further elucidated that infection with CMV-D8 or the recombinant Y1Y2(D2a-C/D2b)D3, but not with CMV-Y, upregulated miRNAs and transcript levels of AGO1, which is involved in RNA silencing, and of HD-ZIP, TCP4, and PHAN, which are essential for leaf morphogenesis. The present results first demonstrated that the cooperative function of D2a-C/D2b is involved indispensably in SLB formation. In addition, we suggest that D2a-C/D2b region interferes with the miRNA pathway that is associated with RNA silencing and leaf morphogenesis, leading to the enhanced virulence of CMV-D8.

Current Progress on the Detection of Plant Viruses, with Special Reference on Zucchini Yellow Mosaic Virus.

Current Progress on the Detection of Plant Viruses, with Special Reference on Zucchini Yellow Mosaic Virus.

Morphological and Molecular Screening of Soybean Genotypes against Yellow Mosaic Virus Disease

Background: The growth and productivity of soybean are adversely affected by an array of biotic factors. Viruses are one of them as they cause great loss to the yield of soybean in India. The present study was conducted with an objective to identify yellow mosaic virus (YMV) resistant genotypes among the selected set of 53 soybean genotypes. Methods: The field screening was performed to identify YMV resistant genotypes. The field data was compared with molecular data recorded on the basis of gene specific SSR molecular markers. Result: During field study, 11 genotypes were found to be highly resistant, 26 resistant, 6 moderately resistant, 4 moderately susceptible, 3 susceptible, while three genotypes namely: JS335, JS 97-52 and RVS 2001-4 were found to be highly susceptible. In molecular analysis three genotypes viz.,: JS 20-29, JS 20-69 and JS 20-98 were found to be resistant against YMV. Among the polymorphic SSR markers the highest genetic diversity (0.4785) was observed with Satt554 while lowest genetic diversity (0.037) was observed with Satt308. Similarly polymorphism information content (PIC) was highest (0.364) in Satt554 and lowest (0.0363) in Satt308 among all polymorphic markers used for screening against YMV. The resistant genotypes identified in this study may be used as donor of resistance gene against YMV to develop improved genotypes which would stand as barrier against spread of the disease to newer areas and thus it can boost production and productivity of soybean in the country.

The occurrence of Pea enation mosaic virus 1 and Pea enation mosaic virus 2 from disease-affected pea fields in China.

Pea (Pisum sativum L.) is an economically important legume crop that is commonly used as dry beans, fresh peas, pods and shoots (Guo et al. 2009). Pea enation mosaic is an important virus disease of pea caused by two viruses in an obligate symbiosis, pea enation mosaic virus 1 (PEMV-1, Enamovirus, Luteoviridae) and pea enation mosaic virus 2 (PEMV-2, Umbravirus, Tombusviridae) (Hema et al. 2014). In November 2019, foliar yellow mosaic and vein enations symptoms were observed from pea plants in five fields of Honghe autonomous prefecture, Yunnan province, China. Incidence of symptomatic plants ranged from 20 to 40% and was distributed in both small and large fields. Leaves with typical virus-like symptoms were collected from five symptomatic pea plants in two fields and used for total RNA extraction. The five extracts of equimolar quantities were pooled into a sample and subjected to High Throughput Sequencing (HTS) by Illumina HiSeq system. Analyses of raw RNA reads were performed using CLC Genomics Workbench 12 (Qiagen). A total of 60,009,746 RNA reads were obtained from the sample, and de novo assembly of the reads using the CLC Genomics generated 88,105 contigs. BLASTN searches revealed the presence of contigs with high similarities to PEMV-1, PEMV-2, Pea seed-borne mosaic virus, and Bean yellow mosaic virus. To confirm the presence of PEMV-1 and PEMV-2 in the samples, two virus-specific primer pairs were designed based on the contig sequences obtained by HTS in this study. Primer pairs PEMV-1F/PEMV-1R (5'-ATGCCGACTAGATCGAAATC-3'/5'-TCAGAGGGAGGCATTCATTA-3') that flank the cp gene of PEMV-1 and PEMV-2F/PEMV-2R (5'-ATGACGATAATCATTAATG-3'/5'-TCACCCGTAGTGAGAGGCA-3') that target the ORF3 region of PEMV-2 were used to amplify the two viruses in RT-PCR. DNA fragments of the expected sizes (PEMV-1, 570 bp; PEMV-2, 693 bp) were amplified from all five samples. The RT-PCR products were cloned and sequenced. Sequence analysis showed that the 570-bp amplicon (MT481989) shared the highest nucleotide sequence identity of 98.95% with PEMV-1 (Z48507), while the 693-bp fragment (MT481990) had the highest nucleotide sequence identity of 97.4% with PEMV-2 isolate JKI (MK948534). One gram of the symptomatic leaves from each of the five plants was homogenized with 5 mL of 0.01 M phosphate-buffered saline (PBS buffer), pH 7.0. Each of the resulted saps was used to inoculate onto five healthy pea seedlings. A total of 25 healthy pea seedlings were inoculated, and 16 inoculated plants developed yellowing and mottling at 10 days post inoculation (dpi); no symptoms were observed on control plants inoculated only with PBS buffer. The formation of the typical enation was observed along the veins of lower side of the symptomatic leaves of the inoculated plants at 30 dpi. PEMV-1 and PEMV-2 infection were confirmed by RT-PCR assays using the specific primer pairs described above. Although the presence of the pea enation mosaic virus complex was suspected in China based on symptomatology (Brunt et al. 1997), to our knowledge, this is the first molecular confirmation of PEMV-1 and PEMV-2 occurrence in China. The co-infection of PEMV-1 and PEMV-2 usually cause severe yield losses; therefore, integration of detection and control measures is important in pea production regions where the two viruses occurred.

First report of Sugarcane Streak Mosaic Virus (SCSMV) infecting sugarcane in Côte d'Ivoire.

Sugarcane streak mosaic virus (SCSMV; Poaceavirus; Potiviridae) is the causal agent of streak mosaic disease of sugarcane (Saccharum interspecific hybrids), a major industrial crop that is widely cultivated in tropical and subtropical regions for sugar and ethanol production. was first reported by Hall et al. (1998) from quarantined germplasm material exhibiting mosaic symptoms imported from Pakistan into the USA. Subsequently, the virus was also reported to occur in most of the Asian countries like Bangladesh, India, Indonesia, Iran, Sri Lanka, Thailand, Vietnam and China (Chatenet et al. 2005; Hema et al. 2008, Kasemsin et al. 2016, Putra et al. 2014, Xu et al. 2010, Moradi et al. 2015; Moradi et al. 2018, Zhang et al. 2018). Until now, there is no report of SCSMV outside the Asian continent. From February to October 2018, sugarcane plants exhibiting symptoms such as irregular yellow and green mosaic, interveinal chlorotic specks, and streaks were observed in Bafing (Borotou-Koro), Marahoué (Zuénoula) and Tchologo (Ferkéssédougou) regions of Côte d'Ivoire (Fig. 1a). Varieties under large-scale commercial cultivation such as R570, R579, SP711406, Co997, Co449, M1176/77, M2593/92, M2580/95, and M1400/86 were all symptomatic. A total of 94 sugarcane leaf samples were collected from these regions and, among those, 82 showed disease symptoms and 12 were symptomless. Samples were first tested for the presence of sugarcane mosaic virus (SCMV), which causes mosaic a disease that is already present in Africa. Serological tests with infected sap using a Double Antibody Sandwich (DAS)- Enzyme Linked Immuno Sorbent Assay (ELISA) kit (DSMZ, RT-0166, Braunschweig, Germany) were negative for SCMV and no amplification product was obtained by RT-PCR using primers specific to the coat protein (CP) gene of SCMV (Putra et al. 2003). The 82 symptomatic leaves tested positive by DAS-ELISA with SCSMV antiserum (polyclonal antibodies were graciously provided by Prof. Hema M. of the Sri Venkateswara University, Tirupati, AP, India), whereas the 12 symptomless samples tested negative. To confirm these results, virus free greenhouse-grown sugarcane varieties Co997 and M1176/77, were mechanically inoculated with 10 sap extracts from 10 SCSMV-infected sugarcane leaf samples. Sap was also extracted from DAS-ELISA negative sugarcane leaves and used as negative control. For sap preparation, leaves were homogenized with a mortar in 2 mL of phosphate buffer 0.01 M pH 7.2 (ratio 1:10). Fifteen 4-week-old plants per variety were inoculated separately with each sap. All inoculated plants exhibited streak mosaic symptoms 13 days post-inoculation (fig. 1b), and the presence of SCSMV in the inoculated plants was confirmed by DAS-ELISA. Total RNA was extracted from four symptomatic leaf samples, one symptomless and one DAS-ELISA positive sample using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). cDNA was synthesized using M-MLV Reverse Transcriptase (Promega, Cat.No.M1705, Madison, WI, USA) following the manufacturer's instructions. A 690-nucleotide fragment of the CP gene was amplified by reverse transcription-polymerase chain reaction (RT-PCR) with primers SCSMV-F690 and SCSMV-R690 (Viswanathan et al. 2008). All primers were synthesized by Eurogentec (Seraing, Belgium). Aliquots of RT-PCR products (5 μl) were analyzed by electrophoresis on 1.2 % (w/v) agarose gel, stained with ethidium bromide and visualized on a UV transilluminator (Fig. 2). An amplification product of the expected size was obtained for all five symptomatic or DAS ELISA positive but not for the symptomless sample. Two RT-PCR products were sequenced and deposited in GenBank under accession Nos. LR594547 and LR594582. These partial CP gene sequences shared highest nucleotide identity with two isolates of SCSMV from India in GenBank: 91% with JN315855 and 90% with EF655859, thus confirming that SCSMV was occurring in sugarcane in Côte d'Ivoire. To our knowledge, this is the first report of natural infection of sugarcane by SCSMV in Africa. Streak mosaic is a serious threat to the entire sugar industry in West Africa and needs further investigations as it may affect sugarcane yields and impact local economies. Our findings further illustrate the need to develop virus-free germplasm for local, national, and international distribution of sugarcane.

Charcoal Rot and Yellow Mosaic Virus Diseases of Soybean Under Hot Spot Condition: Symptoms, Incidence and Resistance Characterization

Charcoal Rot and Yellow Mosaic Virus Diseases of Soybean Under Hot Spot Condition: Symptoms, Incidence and Resistance Characterization

Association of a begomovirus-satellite complex with yellow vein and leaf curl disease of hollyhock (Alcea rosea) in India.

Geminiviruses cause considerable yield loss in several crop plants worldwide. In 2016, several hollyhock plants displaying yellow mosaic and leaf curling symptoms were noticed in a nursery of Jawaharlal Nehru University, New Delhi, India. Analysis of the collected samples indicated an association of monopartite and bipartite begomoviruses with satellites. Three begomoviruses (including a member of a new begomovirus species), two alphasatellites, and a betasatellite were isolated from yellow-mosaic-disease-affected plants. Similarly, a begomovirus, two alphasatellites, and a betasatellite were found to be associated with leaf curl disease of hollyhock. These begomoviruses and satellites were found to be recombinants. By harboring diverse begomoviruses and satellite DNAs, hollyhock may serve as a potential source of virus inoculum.

The studies on the morphological variability and biochemical changes induced by Mungbean Yellow Mosaic Virus (MYMV) in mungbean [Vigna radiata (L.) Wilczek

In the present investigation eighteen mungbean [Vigna radiata (L.) Wilczek] genotypes were screened against MYMV disease under field conditions and identified that the three genotypes as resistant, six as moderately resistant, four genotypes as moderately susceptible, three as susceptible and two as highly susceptible genotypes based on modified MULLaRP disease incidence scale (0–9). Morphological characters viz., leaf thickness and trichome density was evaluated among the genotypes having different degree of resistance. It was observed that leaves of MYMV resistant genotypes were thicker when compared to highly susceptible genotypes. Similarly, trichome density in resistant genotypes were comparatively high to that of highly susceptible genotypes. The biochemical contents viz., total phenol content, total sugar content and chlorophyll content and enzyme activity of peroxidase (PO), polyphenol oxidase (PPO) and Phenylnine ammonia lyase (PAL) enzyme activity was studied both at 30 and 60 Days after sowing (DAS). The phenol content was found higher in resistant genotypes followed by moderately resistant, moderately susceptible, susceptible and highly susceptible at 30 and 60 DAS. The similar trend was also observed in case of total phenol, chlorophyll content and peroxidase, polyphenol oxidase and Phenylnine ammonia lyase enzyme activity.

Evaluation of genetic variability between yellow vein mosaic disease resistant gamma-irradiated okra mutant and parent

Okra (Abelmoschus esculentus L. Moench) is a member of the Malvaceae family. It has been cultivated as one of the most important fruit vegetables in various tropical countries. In okra, the Yellow Vein Mosaic Disease (YVMD) is caused by more than ten different viruses and the widespread incidence of disease transmitted by the vector Bemisia tabaci (Genn.) has highly affected the successful cultivation and production of the crop. Mutation breeding using radiations is one of the promising methods to get disease resistant elite cultivars of various crops. In this study, attempts were made to evaluate the genetic variability of gamma-ray irradiated mutant of okra. Four ISSR primers generated 26 amplified fragments. Of the 26 fragments, the lowest number of fragments (5) was produced by the primer ISSR12. Between the parent (P) and mutant (M4; mutant from fourth-generation) varieties of okra, primer ISSR07, primer ISSR16 and primer ISSR21 produced two monomorphic bands and three polymorphic bands (60% polymorphism) whereas primer ISSR12 produced one monomorphic band and three polymorphic bands (75% polymorphism). The mean percentage of polymorphism generated by four primers was 63.75%. Although the level of polymorphism exhibited by different primers varied from intermediate (60%) to high (75%), all primers could distinguish parent and gamma-irradiated mutant varieties of okra.

First Report of Chayote Yellow Mosaic Virus (ChaYMV) and Its Associated Betasatellite Infecting Papaya (Carica papaya) in Cameroon

First Report of Chayote Yellow Mosaic Virus (ChaYMV) and Its Associated Betasatellite Infecting Papaya (<i>Carica papaya</i>) in Cameroon

Exogenous Application of Elicitors Induces Biochemical Alterations and Develops Tolerance against Yellow Mosaic Disease in Mungbean

Mungbean (Vigna radiata) is seriously affected by mungbean yellow mosaic disease (MYMD) caused by Mungbean yellow mosaic India virus (MYMIV) in the Indian subcontinent. The present study was conducted to evaluate the effectiveness of salicylic acid (SA) and benzothiadiazole (BTH) for the management of MYMD and to find their role in inducing alteration in different biochemical parameters in susceptible mungbean genotype VC3061A. Exogenous application of the elicitors resulted in delayed symptom development and reduced disease severity (DS). The severity index (SI) was higher on positive control plants while the minimum was observed in post combined application of BTH+SA, followed by BTH and SA application. Total phenolic contents (TPC) and malondialdehyde (MDA) increased significantly in virus inoculated plants of all treatments as compared to their healthy controls. SOD activity was increased significantly in BTH+SA treated plants but decreased in disease control and BTH treated virus inoculated plants. A significant decrease in catalase (CAT) activity, while an increase in peroxidase (POD) was observed in BTH+SA, treated virus inoculated plants. Protease and esterase activity were significantly increased in SA treated virus inoculated plants. Plant pigments exhibited decreased concentration in virus inoculated plants compared to non-inoculated plants under all the treatments except SA treated plants. Enhanced or suppressed levels of antioxidants suggest an association between constitutive induced levels of these enzymes. In this study, we also report for the first time the protein profiling of mungbean genotype VC3061A after the exogenous application of different combinations of elicitors. Proteomic analyses revealed the expression of two proteins phosphatase 2C 16-like isoform and capsid protein after MYMIV inoculation in SA and BTH+SA treated plants which may trigger signal transduction pathway and consequently induces resistance against MYMIV in V. radiata by activating PR protein.

First Report of Tomato leaf curl New Delhi virus in Physalis minima in Pakistan

Tomato leaf curl New Delhi virus (ToLCNDV), a bipartite begomovirus, is an emerging problem for agricultural crops in Pakistan (Zaidi et al. 2016). In 2017, severe symptoms and high incidence of yellow mosaic and leaf curl disease attributable to infection by ToLCNDV (Sohrab et al. 2003) was observed in luffa (Luffa acutangula) grown in the Malakand region (Khyber Pakhtunkhwa province). Several plants of Physalis minima, a common weed plant in and around luffa fields, also exhibited severe mottling and leaf curling symptoms. Leaves from three symptomatic plants of luffa and P. minima tested positive for ToLCNDV using polyclonal antibodies (DSMZ, Germany) in double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). To further confirm the identity of the virus, DNA was extracted from all the collected leaf samples using a CTAB-based DNA extraction method (Doyle and Doyle 1990). Polymerase chain reaction (PCR) was conducted using ToLCNDV-specific primers ToLCNDV-up (GAACTATGG TGAAGCGACCAGCAGA) and ToLCNDV-do (ACACAGGTCCTTAGGTACCTGG) as described by Alfaro-Fernandez et al. (2016). One ToLCNDV-positive control (accession no. EF620534 obtained from NWFP Agriculture University Peshawar, Pakistan) was also included in PCR, and a healthy plant was used as a negative control. A single amplicon of expected size (∼914 bp) was amplified by PCR from all the ELISA-positive samples of luffa and P. minima including the positive control, whereas no amplicon was amplified from healthy samples. One amplicon each from luffa and P. minima was sequenced in both directions, and the consensus sequences were deposited in GenBank under accession numbers MK560176 and MK560177, respectively. BLASTn analyses of the sequence from luffa (MK560176) and P. minima (MK560177) showed the highest identity (99%) with a ToLCNDV isolate (AF448058) reported on tomato in Malakand region (Shih et al. 2003). Infection of luffa by ToLCNDV was recently reported in Pakistan (Anwar et al. 2020). This is the first report of this virus naturally infecting P. minima. Based on our findings, further targeted surveys must be undertaken to advance our knowledge on alternative hosts of this virus in the region.

Natural infection of squash fruits (Cucurbita pepo) by Zucchini Yellow Mosaic potyvirus (ZYMV) in Alexandria governorate

Natural infection of squash fruits (Cucurbita pepo) by Zucchini Yellow Mosaic potyvirus (ZYMV) in Alexandria governorate

Biological and Molecular Characterization of Watermelon mosaic virus Affecting Squash Plants Yield and Quality in Egypt

Survey of vegetable crops in different regions Ismailia Governorate in Egypt conducted detection of Watermelon mosaic virus. The virus detected using DAS-ELISA form naturally infected watermelon and squash plants, exhibiting severe yellow mosaic, vein clearing, blistering and distortion of leaves. Isolation and identification of WMV was carried out by studying host range, symptomatology, modes of transmission, serological reaction and electron microscopic examination. The molecular detection of WMV done using RT-PCR with specific primers designed for coat protein gene. RT-PCR products 825bp of coat protein gene of WMV cloned and then sequenced. The coat protein gene of the Egyptian isolate of WMV showed nucleotide sequences similarity ranged from 95%-99% with different isolates available in Gene Bank. The experiments carried out under greenhouse condition, (HRI) - (VRD) from2014 to 2017. Five squash inbred lines used making half diallel to produce 10 hybrids to determine performance some variables under WMV infection condition. A complete block design was used. The evaluation process performed through two experiments. First experience, cultivation the genotypes with a commercial hybrid after infection to evaluate the performance of genotypes for yield and some characteristics. Therefore the percentage of reduction in yield estimated. The second experiment without infection and evaluate the performance for the same variable. The study found that, there were significant differences between all the genotypes that were inoculated and noninoculated. The reducing in yield ranged 14.6: 30%. Therefore, the study recommended attention to the hybrid that achieved a decrease of 14.6% by continuing to work on it.

Fragaria vesca-associated virus 1: a new virus related to negeviruses.

In this study, the complete genomic sequence of a novel virus was determined by next-generation sequencing of a sample from a symptomatic strawberry plant with severe yellow spots and mosaic on its leaves. Its genomic organization and sequence showed that this virus is related to members of the proposed insect-specific genus "Negevirus". The sample also contained sequences from the geranium aphid Acyrthosiphon malvae. Although the virus was detected repeatedly in the same plant during the three following years, no other positive samples were obtained from the surroundings or more-distant locations. Reverse transcription qPCR analysis revealed the presence of both genomic positive and complementary negative strands of the viral genome in the sample, with a 3- to 30-fold excess of the positive strand, indicating active viral replication. As the virus was not detected in any insect species collected at this location, the virus was provisionally named "Fragaria vesca-associated virus 1" (FVaV-1).

Biochemical Alterations in the Leaves of Resistant and Susceptible Mungbean Genotypes Infected with Mungbean Yellow Mosaic India Virus

Mungbean (Vigna radiata), an important leguminous crop, is highly susceptible to yellow mosaic disease (YMD) caused by Mungbean yellow mosaic India virus (MYMIV), resulting in high yield penalty. Previously, different varieties of mungbean have been reported possessing resistance/ tolerance against MYMIV. However, the molecular events occurring during compatible and incompatible interactions between mungbean and MYMIV are yet to be explored. Therefore, in this study using MYMIV-resistant (NM-2016), moderately resistant (NM-2011) and susceptible genotype (VC-1647C), alterations in various biochemical attributes due to MYMIV infection were analysed and compared with healthy non-inoculated control plants for understanding the resistance mechanism. After MYMIV inoculation, the level of total phenolic contents (TPC) and total soluble proteins (TSP) increased significantly in the susceptible genotype. However, the level of Malondialdehyde (MDA) and Ascorbate peroxidase (APX) remained same in all the genotypes. Level of superoxide dismutase (SOD) and catalase (CAT) decreased in the susceptible genotype but CAT level increased in the moderately resistant genotype. Protease level decreased significantly in all the genotypes while esterase level increased in moderately resistant and susceptible genotype. Peroxidase (POD) increased only in moderately resistant genotype and Total Oxidant Status (TOS) increased significantly in the susceptible genotype. Due to MYMIV infection the level of all plant pigments decreased in all the genotypes tested. The comparative proteome analysis using SDS-PAGE resolved 22 peptides with molecular weight from 12.5 to 163 kDa. Differential expression of protein phosphatase 2C (PP2C) and Cytochrome b6 (Photosynthesis) in resistant and moderately resistant genotypes; Pectin acetyl esterase and Resistant specific protein-1(4) in resistant genotype and up-regulation of superoxide dismutase [Cu-Zn] and RuBisco by MYMIV may have triggered signal transduction pathway and consequently induced a resistance response against MYMIV in V. radiata by activating PR proteins.

SYMPTOMS VARIATION OF VIRAL INFECTIONS IN YARDLONG BEAN

Yardlong bean (Vigna unguiculata subsp. sesquipedalis L.) is an important horticultural commodity in Indonesia. During the last ten years, yardlong bean planting areas in Indonesia especially in Java often suffered from epidemics of viral disease showing typical symptoms of yellow mosaic on their leaves. Some researchers have separately reported that the symptoms associated with some viral infections. This research aimed to examine viruses associated with the symptoms of yellow mosaic on yardlong bean in endemic areas in Sukoharjo, Central Java, Indonesia. Yardlong bean leaves were taken from the district by purposive sampling method, then the virus was detected by nucleic acid amplification using specific primers for Begomovirus, Bean common mosaic virus (BCMV) and Cucumber mosaic virus (CMV). The results showed that one sample of yardlong bean could be infected by more than one virus. Infection of two kind of virus in a yardlong bean showed symptoms of each virus plus a synergistic effect where the symptoms become more severe.