Year-round Crop Research Articles

Iris yellow spot virus(IYSV) infecting lisianthus (Eustoma grandiflorum) in the UK: first finding and detection by real-time PCR

In June 2007, a sample of leaves was received from a year-round crop of lisianthus (Eustoma grandiflorum) growing under glass in Suffolk, UK. The sample exhibited necrosis, mainly observed as pale, necrotic lesions. In the worst affected block up to 20% of plants were reported as showing similar symptoms. A test performed by another laboratory had previously detected Iris yellow spot virus (IYSV) in the affected plants. To confirm this diagnosis officially, an ELISA test was performed using an IYSV polyclonal DAS-ELISA kit (Loewe). This test was positive. The result was confirmed using a new real-time PCR (TaqMan®) assay (forward primer (DQ658242-524F): TCCAGAATGTGAAAAAAGAAGCACT; reverse primer (DQ658242-524R): TGCCATGACTCTTGCAACTTTG; MGB Probe (DQ658242-552T): TATAAGCAGATTCTCAA CTTA). This new assay was designed using an available IYSV nucleocapsid (NC) protein gene sequence (GenBank Accession No. DQ658242) and further alignments against 45 other IYSV sequences available on public databases. It was validated with 4 known IYSV isolates; one purchased from Loewe and three kindly supplied by Ko Verhoeven, PPS, The Netherlands. Total RNA extraction (CTAB method) and real-time PCR assay conditions were essentially as described previously (Mumford et al., 2004). For further confirmation, conventional RT-PCR was performed using IYSV-specific primers (Pappu et al., 2006), on extracts made from leaf material with symptoms. A product of the correct predicted size (822 bp) was obtained and sequenced. The deduced NC gene sequence obtained (Accession No. AM900393) was analysed and shown to share at least 84% nt identity with all other IYSV NC sequences; the highest homology (98%) being with a Dutch isolate from Iris hollandica (Accession No. AF001387). Widely distributed around the world in onion and leek crops (Jones, 2005; EPPO, http://www.eppo.org/QUARANTINE/Alert_List/viruses/IYSV00.htm), IYSV has been identified in various ornamental crops, including lisianthus (Kritzman et al., 2000). However, this is the first finding of IYSV in the UK. The infected crop has now been removed and measures taken to eradicate the infection.

Sub-pixel Area Calculation Methods for Estimating Irrigated Areas.

The goal of this paper was to develop and demonstrate practical methods forcomputing sub-pixel areas (SPAs) from coarse-resolution satellite sensor data. Themethods were tested and verified using: (a) global irrigated area map (GIAM) at 10-kmresolution based, primarily, on AVHRR data, and (b) irrigated area map for India at 500-mbased, primarily, on MODIS data. The sub-pixel irrigated areas (SPIAs) from coarse-resolution satellite sensor data were estimated by multiplying the full pixel irrigated areas(FPIAs) with irrigated area fractions (IAFs). Three methods were presented for IAFcomputation: (a) Google Earth Estimate (IAF-GEE); (b) High resolution imagery (IAF-HRI); and (c) Sub-pixel de-composition technique (IAF-SPDT). The IAF-GEE involvedthe use of "zoom-in-views" of sub-meter to 4-meter very high resolution imagery (VHRI)from Google Earth and helped determine total area available for irrigation (TAAI) or netirrigated areas that does not consider intensity or seasonality of irrigation. The IAF-HRI isa well known method that uses finer-resolution data to determine SPAs of the coarser-resolution imagery. The IAF-SPDT is a unique and innovative method wherein SPAs aredetermined based on the precise location of every pixel of a class in 2-dimensionalbrightness-greenness-wetness (BGW) feature-space plot of red band versus near-infraredband spectral reflectivity. The SPIAs computed using IAF-SPDT for the GIAM was within2 % of the SPIA computed using well known IAF-HRI. Further the fractions from the 2 methods were significantly correlated. The IAF-HRI and IAF-SPDT help to determine annualized or gross irrigated areas (AIA) that does consider intensity or seasonality (e.g., sum of areas from season 1, season 2, and continuous year-round crops). The national census based irrigated areas for the top 40 irrigated nations (which covers about 90% of global irrigation) was significantly better related (and had lesser uncertainties and errors) when compared to SPIAs than FPIAs derived using 10-km and 500-m data. The SPIAs were closer to actual areas whereas FPIAs grossly over-estimate areas. The research clearly demonstrated the value and the importance of sub-pixel areas as opposed to full pixel areas and presented 3 innovative methods for computing the same.

Growing Environment and Nutrient Availability Affect the Content of Some Phenolic Compounds in Echinacea purpurea and Echinacea angustifolia

Medicinal plant production is different from other agricultural production systems in that the plants are grown for the production of specific phytochemical(s) for human use. To address this need, a Good Manufacturing Practice (GMP)-compliant, controlled-environment production system was developed for production of Echinacea purpurea and Echinacea angustifolia. Within the prototype facility, the growing systems, nutrient availability, water and physical environment were highly controlled. The current study was designed to evaluate the effects of different hydroponic systems, nutrient solution NO (3)(-)/NH (4)(+) ratios and mild water stress on the content of some phenolic compounds in Echinacea plants. The deep-flow solution culture system in which the plant roots were continuously immersed in the nutrient solutions was optimum for the growth of E. purpurea. Higher concentrations of caftaric acid, cynarin and echinacoside were produced in E. angustifolia plants grown in the soil-based growing media while the plants grown in the deep-flow solution system had higher levels of cichoric acid. Altering the NO (3)(-)/NH (4)(+) ratio or limited water stress did not have any significant effect on the phytochemical content of Echinacea plants. Echinacea plants grown in the controlled environment systems had higher or similar amounts of cynarin, caftaric acid, echinacoside and cichoric acid as previously reported in the literature for both field-cultivated and wild-harvested Echinacea plants. This growing system offers the advantages of year-round crop production with minimal contamination by environmental pollutants and common microbes.

トマトの1段密植栽培に関する研究

Our reseach on the single truss tomato culture was begun in an attempt to find out some means to increase the efficiency of tomato production. The results are summarized as follows1. Seeds of tomato cultivars FTVNR-3 and Dantobi-Yozu (self-topping variety) were sown nine times monthly on the 10th of each month from July 1974 to March 1975.The planting density was approximately 11, 000 plants per 10 a and the plants were all pinched at three leaves above the first inflorescence.2. Days from sowing to harvesting were about 170-188 in September, October, November and December sowings, about 140-155 in August, January and Feburuary sowings, and about 120 in March and July sowings respectively.Days after planting to harvesting were about 120 in September and October sowings, 85-100 in August, November and December sowings and about 65-75 in July, January, February and March sowings.3. The length and width of the uppermost leaf varied with sowing dates and these were affected principally by temperature. The stem length below the first inflorescence was determined by the temperature during propagation. Thus, it was much shorter in November, December and January sowings than in the other sowings.4. Total yields from each sowing over the year were in excess of 7 tons per 10 a, except for cultivar FTVNR-3 sown in October and cultivar Dantobi-Yozu sown in September.Percentage marketable fruits was, in both cultivars, as high as 85%, except for cultivar FTVNR-3 sown in October. Cultivar Dantobi-Yozu proved to be more suitable for single truss culture than cultivar FTVNR-3 since it produced stable yield throughout the year.5. The daily mean of solar radiation during the growth period and especially that during 30 days after anthesis were found to be highly correlated with the yield; the correlation coefficients being 0.758 (p<0.05) and 0.906 (p<0.001) to total yield and 0.774 (p<0.02) and 0.923 (p<0.001) to yield of marketable fruits, respectively.6. For a year-round cropping system of single truss tomatoes, however, seedlings should be planted at the stage just before the first anthesis to shorten the growing period of each crop, which is difficult to practice.Performance of three crops over the year is rather feasible by planting seedlings at five or six leaf stage and yet annual yield about 25 tons per 10 a can be obtained.7. Year-round culture of single truss tomatoes may increase the efficiency of tomato production and may bring profits to commercial growers, because 1) these plants give an annual yield higher than multi truss plants and their fruit quality is good, 2) the optimal environments are necessary to be kept only for the period of growth and development of the first inflorescence, which will simplify the cultivation and 3) the plants are supported by bar, thus the labour requirement for training is avoided.Furthermore, this cropping system makes it possible to make a planting programme over the year with flexibility from a viewpoint of the distribution of labor, and to regulate the production or shipping of tomato fruits taking aim at high price.