Xylose Operon Research Articles

Xylooligosaccharide interferes with the cell cycle and reduces the antibiotic tolerance of avian pathogenic Escherichia coli by associating with its potential antimetabolic actions

This study aimed to probe if xylooligosaccharide (XOS) could act as an antimetabolite to impact the cell cycle and antibiotic tolerance of avian pathogenic Escherichia coli (APEC). We firstly measured the bacteriostasis of XOS against APEC O78 and its effect on the growth of APEC O78 growing on different medium. Afterwards, the effects of XOS on xylose operon activation along with the cell cycle and antibiotic tolerance of APEC O78 were analyzed. The results showed that XOS caused no inhibitory circle against APEC O78 and did not affect (P > 0.05) the growth of APEC O78 growing on LB medium. Besides, APEC O78 was unable to grow on M9 medium (carbon-free) added with XOS. However, XOS exerted a similar role as xylose in increasing (P < 0.05) the expression of certain xylose operon genes including xylose isomerase (XylA)-encoding gene (xylA) and xylose-binding periplasmic protein (XylF)-encoding gene (xylF) in APEC O78. The molecular docking simulation revealed that the major monomer components (xylobiose, xylotriose and xylotetraose) of XOS had stable binding potentials to both XylA and XylF proteins of E. coli, as supported by the low binding free energy and the formation of considerable hydrogen bonds between them. The subsequent analysis showed that XOS altered certain cell cycle-related genes expression, especially elevated (P < 0.05) nrdB expression and decreased ihfB expression to a degree. Moreover, XOS played a similar role as 2-deoxy-glucose (a glucose analogue serving as a typical antimetabolite) in lowering (P < 0.05) the number of ampicillin-tolerant APEC O78. Collectively, XOS had no direct bacteriostasis against APEC and could not be metabolized/utilized by APEC O78. However, it might become an analogue of xylose and then activate xylose transport- and metabolism-related proteins in APEC O78, thus functioning as a potential antimetabolite and exerting anti-metabolic actions. This could at least partially interpret the observed roles of XOS in interfering with the cell cycle and diminishing the antibiotic tolerance of APEC O78. The above findings expand the knowledges about the functions of XOS and provide a basis for exploring novel strategies to reduce the antibiotic tolerance of APEC.

Engineering xylose induction in Vibrio natriegens for biomanufacturing applications.

Xylose is an abundant, inexpensive and readily available carbohydrate common in minimally processed feedstocks such as seaweed and algae. While a wide variety of marine microbes have evolved to utilize seaweed and algae, only a few currently have the requisite characteristics and genetic engineering tools necessary to entertain the use of these underutilized feedstocks. The rapidly growing Gram-negative halophilic bacterium Vibrio natriegens is one such chassis. In this study, we engineered and tested xylose induction in V. natriegens as a tool for scalable bioproduction applications. First, we created a sensing construct based on the xylose operon from Escherichia coli MG1665 and measured its activity using a fluorescent reporter and identified that cellular import plays a key role in induction strength and that expression required the XylR transcription factor. Next, we identified that select deletions of the promoter region enhance gene expression, limiting the effect of carbohydrate repression when xylose is used as an inducer in the presence of industrially relevant carbon sources. Lastly, we used the optimized constructs to produce the biopolymer melanin using seawater mimetic media. One of these formulations utilized a nori-based seaweed extract as an inducer and demonstrated melanin yields comparable to previously optimized methods using a more traditional and costly inducer. Together, the results demonstrate that engineering xylose induction in V. natriegens can provide an effective and lower cost option for timed biosynthesis in scalable biomanufacturing applications using renewable feedstocks.

New Target Gene Screening Using Shortened and Random sgRNA Libraries in Microbial CRISPR Interference.

CRISPR interference (CRISPRi) screening has been used for identification of target genes related to specific phenotypes using single-molecular guide RNA (sgRNA) libraries. In CRISPRi screening, the sizes of random sgRNA libraries contained with the original target recognition sequences are large (∼1012). Here, we demonstrated that the length of the target recognition sequence (TRS) can be shortened in sgRNAs from the original 20 nucleotides (N20) to 9 nucleotides (N9) that is still sufficient for dCas9 to repress target genes in the xylose operon of Escherichia coli, regardless of binding to a promoter or open reading frame region. Based on the results, we constructed random sgRNA plasmid libraries with 5'-shortened TRS lengths, and identified xylose metabolic target genes by Sanger sequencing of sgRNA plasmids purified from Xyl- phenotypic cells. Next, the random sgRNA libraries were harnessed to screen for target genes to enhance violacein pigment production in synthetic E. coli cells. Seventeen target genes were selected by analyzing the redundancy of the TRS in sgRNA plasmids in dark purple colonies. Among them, seven genes (tyrR, pykF, cra, ptsG, pykA, sdaA, and tnaA) have been known to increase the intracellular l-tryptophan pool, the precursor of a violacein. Seventeen cells with a single deletion of each target gene exhibited a significant increase in violacein production. These results indicate that using shortened random TRS libraries for CRISPRi can be simple and cost-effective for phenotype-based target gene screening.

Analysis of Xylose Operon from Paenibacillus polymyxa ATCC842 and Development of Tools for Gene Expression.

With numerous industrial applications, Paenibacillus polymyxa has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression elements in P. polymyxa have not been systematically investigated, genetic modification on account of a specific metabolism pathway for the strain is limited. In this study, a xylose-inducible operon in the xylan-utilizing bacterium ATCC842 was identified, and the relative operon transcription was increased to 186-fold in the presence of xylose, while the relative enhanced green fluorescent protein (eGFP) fluorescence intensity was promoted by over four-fold. By contrast, glucose downregulated the operon to 0.5-fold that of the control. The binding site of the operon was “ACTTAGTTTAAGCAATAGACAAAGT”, and this can be degenerated to “ACTTWGTTTAWSSNATAVACAAAGT” in Paenibacillus spp., which differs from that in the Bacillus spp. xylose operon. The xylose operon binding site was transplanted to the constitutive promoter Pshuttle-09. The eGFP fluorescence intensity assay indicated that both the modified and original Pshuttle-09 had similar expression levels after induction, and the expression level of the modified promoter was decreased to 19.8% without induction. This research indicates that the operon has great potential as an ideal synthetic biology tool in Paenibacillus spp. that can dynamically regulate its gene circuit strength through xylose.

Transcriptome profile of carbon catabolite repression in an efficient l-(+)-lactic acid-producing bacterium Enterococcus mundtii QU25 grown in media with combinations of cellobiose, xylose, and glucose.

Enterococcus mundtii QU25, a non-dairy lactic acid bacterium of the phylum Firmicutes, is capable of simultaneously fermenting cellobiose and xylose, and is described as a promising strain for the industrial production of optically pure l-lactic acid (≥ 99.9%) via homo-fermentation of lignocellulosic hydrolysates. Generally, Firmicutes bacteria show preferential consumption of sugar (usually glucose), termed carbon catabolite repression (CCR), while hampering the catabolism of other sugars. In our previous study, QU25 exhibited apparent CCR in a glucose-xylose mixture phenotypically, and transcriptional repression of the xylose operon encoding initial xylose metabolism genes, likely occurred in a CcpA-dependent manner. QU25 did not exhibit CCR phenotypically in a cellobiose-xylose mixture. The aim of the current study is to elucidate the transcriptional change associated with the simultaneous utilization of cellobiose and xylose. To this end, we performed RNA-seq analysis in the exponential growth phase of E. mundtii QU25 cells grown in glucose, cellobiose, and/or xylose as either sole or co-carbon sources. Our transcriptomic data showed that the xylose operon was weakly repressed in cells grown in a cellobiose-xylose mixture compared with that in cells grown in a glucose-xylose mixture. Furthermore, the gene expression of talC, the sole gene encoding transaldolase, is expected to be repressed by CcpA-mediated CCR. QU25 metabolized xylose without using transaldolase, which is necessary for homolactic fermentation from pentoses using the pentose-phosphate pathway. Hence, the metabolism of xylose in the presence of cellobiose by QU25 may have been due to 1) sufficient amounts of proteins encoded by the xylose operon genes for xylose metabolism despite of the slight repression of the operon, and 2) bypassing of the pentose-phosphate pathway without the TalC activity. Accordingly, we have determined the targets of genetic modification in QU25 to metabolize cellobiose, xylose and glucose simultaneously for application of the lactic fermentation from lignocellulosic hydrolysates.

Transcriptional Changes in the Xylose Operon in Bacillus licheniformis and Their Use in Fermentation Optimization.

The xylose operon is an efficient biological element used for the regulation of gene expression in Bacillus licheniformis. Although the mechanism underlying the xylose-mediated regulation of this operon has been elucidated, the transcriptional changes that occur under various fermentation conditions remain unclear. In this study, the effects of different conditions on xylose operon expression were investigated. Significant upregulation was observed during the transition from the logarithmic phase to the stationary phase (2.5-fold, n = 3, p < 0.01). Glucose suppressed transcription over 168-fold (n = 3, p < 0.01). Meanwhile, the inhibitory effect of glucose hardly strengthened at concentrations from 20 to 180 g/L. Furthermore, the transcription of the xylose operon increased at elevated temperatures (25–42 °C) and was optimal at a neutral pH (pH 6.5–7.0). Based on these findings, relevant fermentation strategies (delaying the induction time, using dextrin as a carbon source, increasing the fermentation temperature, and maintaining a neutral pH) were proposed. Subsequently, these strategies were validated through the use of maltogenic amylase as a reporter protein, as an 8-fold (n = 3, p < 0.01) increase in recombinant enzyme activity compared to that under unoptimized conditions was observed. This work contributes to the development of fermentation optimization and furthers the use of the xylose operon as an efficient expression element.

Development of a strictly regulated xylose-induced expression system in Streptomyces

BackgroundGenetic tools including constitutive and inducible promoters have been developed over the last few decades for strain engineering in Streptomyces. Inducible promoters are useful for controlling gene expression, however only a limited number are applicable to Streptomyces. The aim of this study is to develop a controllable protein expression system based on an inducible promoter using sugar inducer, which has not yet been widely applied in Streptomyces.ResultsTo determine a candidate promoter, inducible protein expression was first examined in Streptomyces avermitilis MA-4680 using various carbon sources. Xylose isomerase (xylA) promoter derived from xylose (xyl) operon was selected due to strong expression of xylose isomerase (XylA) in the presence of d-xylose. Next, a xylose-inducible protein expression system was constructed by investigating heterologous protein expression (chitobiase as a model protein) driven by the xylA promoter in Streptomyces lividans. Chitobiase activity was detected at high levels in S. lividans strain harboring an expression vector with xylA promoter (pXC), under both xylose-induced and non-induced conditions. Thus, S. avermitilis xylR gene, which encodes a putative repressor of xyl operon, was introduced into constructed vectors in order to control protein expression by d-xylose. Among strains constructed in the study, XCPR strain harboring pXCPR vector exhibited strict regulation of protein expression. Chitobiase activity in the XCPR strain was observed to be 24 times higher under xylose-induced conditions than that under non-induced conditions.ConclusionIn this study, a strictly regulated protein expression system was developed based on a xylose-induced system. As far as we could ascertain, this is the first report of engineered inducible protein expression in Streptomyces by means of a xylose-induced system. This system might be applicable for controllable expression of toxic products or in the field of synthetic biology using Streptomyces strains.

Development of an Inducible Secretory Expression System in Bacillus licheniformis Based on an Engineered Xylose Operon.

The xylose operon can be an efficient biological component for regulatory expression uses in Bacillus licheniformis. However, its characteristic susceptibility to carbon catabolite repression (CCR) makes its application inconvenient. In this study, plasmids harboring the wild-type operons from three Bacillus species were constructed and introduced into B. licheniformis. These plasmids ensured secretory expression of maltogenic α-amylase (BLMA) in B. licheniformis under strict regulation. The glucose-mediated CCR was then alleviated by engineering the xylose operon of the expression system. Evidence showed that mutations in the highly conserved nucleotides of the identified catabolite responsive element (cre) consensus sequence prevented association of the regulator CcpA with DNA, thus resulting in an increase in BLMA activity of up to 12-fold. Furthermore, features of this engineered system for inducible expression were investigated. Induction in mid-log phase using 10 g/L xylose at 37 °C was found to be beneficial for promoting the accumulation of recombinant product, and the maximum yield of BlmMA reached 715.4 U/mL. This study contributes to the industrial application of the generally recognized as safe (GRAS) workhorse B. licheniformis.

Genomic analysis of a xylose operon and characterization of novel xylose isomerase and xylulokinase from Bacillus coagulans NL01.

To investigate the xylose operon and properties of xylose isomerase and xylulokinase in Bacillus coagulans that can effectively ferment xylose to lactic acid. The xylose operon is widely present in B. coagulans. It is composed of four putative ORFs. Novel xylA and xylB from B. coagulans NL01 were cloned and expressed in Escherichia coli. Sequence of xylose isomerase was more conserved than that of xylulokinase. Both the enzymes exhibited maximum activities at pH 7-8 but with a high temperature maximum of 80-85°C, divalent metal ion was prerequisite for their activation. Xylose isomerase and xylulokinase were most effectively activated by Ni(2+) and Co(2+), respectively. Genomic analysis of xylose operon has contributed to understanding xylose metabolism in B. coagulans and the novel xylose isomerase and xylulokinase might provide new alternatives for metabolic engineering of other strains to improve their fermentation performance on xylose.

Seamless GFP and GFP-Amylase Cloning in Gateway Shuttle Vector, Expression of the Recombinant Proteins in E. Coli and Bacillus Megaterium and Assessment of the GFP-Amylase Thermostability

ABSTRACTA Gateway shuttle vector pMMC for gene cloning and expression in E. coli and Bacillus megaterium hosts was constructed using pMM1525. Together with the application of a PCR fusion/Gateway cloning procedure established earlier, the constructed vector makes possible efficient and very flexible seamless gene cloning in a sequence-independent manner A Gateway entry clone pXZ containing the XylR/pXylA' cassette of the XylR-xylose-dependent repressor gene and the pXylA'-promoter region of the xylose isomerase gene from the xylose operon of B. megaterium, was constructed. The XylR/pXylA '-mediated gene cloning in the constructed vector provides tight regulation of the gene expression in B. megaterium host cells upon xylose induction and constitutive expression in E.coli host cells. The efficiency of the seamless gene cloning was demonstrated through cloning in pMMC of the XylR/pXylA'-GFP and (XylR/pXylA'-GFP)-BLA expression cassettes, where GFP is the GFPuv variant of the green fluorescent protein gene and BLA is the Bacillus licheniformis α-amylase A gene. A mild and efficient thermolysis procedure for extraction of thermostable recombinant proteins expressed in E. coli was designed. It includes heating of lysozyme-treated E. coli cells at 50 °C and precipitation of the thermally denatured proteins. The comparative characterization of protein preps from E. coli cells expressing the GFP-BLA fusion protein and GFP alone revealed that GFP-BLA shows fluorescent ability with high thermal stability and has α-amylase activity similar to those of BLA proteins. The possible applications of the constructed pMMC Gateway shuttle vector and different protocols of the PCR fusion/Gateway cloning procedure for accomplishment of various gene cloning and expression tasks are discussed in details. The observed functionality and high thermal stability of the GFP-BLA fusion protein could serve to propose an integrated approach for characterization of the functionality and thermal stability of the GH13 and GH57 glycosyl hydrolase genes cloned from environmental DNA samples, fused with a GFP reporter gene and expressed in E. coli and/or B. megaterium hosts.

Construction and characterization of Lactobacillus pentosus expressing the D antigenic site of the spike protein of Transmissible gastroenteritis virus

This study explored the feasibility of Lactobacillus pentosus as a live vehicle to deliver and express antigen. First of all, L.pentosus transformed by electroporation with the plasmids pg611-6D (anchored) and pg612-6D (secretory) based on the xylose operon generated the recombinant strains rLppg611-6D and rLppg612-6D, respectively, expressing the D antigenic site of the spike (S) protein of Transmissible gastroenteritis virus (TGEV), for intragastric administration in mice. Secondly, we collected serum, fecal, nasal, ophthalmic, and vaginal samples from pre-immune mice and after the first immunization (on days 7, 14, 21, 28, 35, and 42) that were used to analyze the levels of immunoglobulins G and A against TGEV by using ELISA. In addition, a plaque reduction assay was performed using sera from groups pg611, pg612-6D, pg11-6D, and phosphate-buffered saline (blank control) to analyze TGEV-neutralizing antibody activity in vitro. A statistically significant difference in serum tests between groups demonstrated that rLppg612-6D induced better immunogenicity than rLppg611-6D, making rLppg612-6D the better candidate for oral vaccine. Taken together, L. pentosus possessed the potential to become a novel vector for mucosal vaccine in the future.

대장균 xylA 프로모터를 이용한 xylose 유도성 발현벡터의 구축

xylA promoter is a major promoter in xylose operon of Escherichia coli. xylA promoter is sufficient as the promoter for the construction of new expression vector because this promoter was tightly controlled and induced by the addition of xylose. For the construction of xylose-inducible expression vector, 600 bp of xylA promoter was ligated between AatII and HindIII of pUC18, named pXA600. In order to investigate the effect of XylR protein encoded by xylR gene on the xylA promoter, 1,988 bp of xylR gene including its promoter was ligated into downstream of multiple cloning site to the opposite direction of xylA promoter in pXA600, named pXAR600. For the measurement of expression level, 3,048 bp of lacZ structural gene was fused into xylA promoter in both plasmids pXA600 and pXAR600 as a reporter gene, named pXA600-lacZ and pXAR600-lacZ, respectively. The -galactosidase activity of pXA600-lacZ and pXAR600-lacZ in E. coli JM109 was determined to be 1,641 and 2,304 unit by the induction with xylose in LB medium, respectively. The -galactosidase activity of pXAR600-lacZ/JM109 was about 1.4 times higher by the induction with xylose than that of pXA600-lacZ/JM109. The -galactosidase activity of pXA600-lacZ and pXAR600-lacZ in E.coli JM109 showed 6,282 and 9,320 unit by the induction with xylose in DM minimal medium, respectively. A regulator, xylR protein works as an activator for the gene expression by the addition of xylose in the xylose-inducible vectors because the level of gene expression in pXA600 is increased by the insertion of xylR gene into the same vector. The xynA gene of Streptomyces thermocyaneoviolaceus cloned in pXA600 and pXAR600 was successfully expressed in E. coli BLR(DE3). As a result, plasmids pXA600 and pXAR600 using xylA promoter are sufficient as new expression system to produce a foreign protein in E. coli.

Construction of recombinant Lactobacillus casei efficiently surface displayed and secreted porcine parvovirus VP2 protein and comparison of the immune responses induced by oral immunization

Lactobacillus casei ATCC 393 was selected as a bacterial carrier for the development of mucosal vaccine against porcine parvovirus (PPV) infection. The PPV major structural polypeptide VP2 was used as the model parvovirus antigen. Two inducible expression systems, namely pPG611.1 of the cell-surface expression system and pPG612.1 of the secretion expression system based on the xylose operon promoter were used to express the VP2 protein. The immunogenicity of recombinant strains producing VP2 protein in two cellular locations, cell-surface exposed and secreted, was compared to each other by immunizing mice through the intragastric administration. The two types of constructs were able to induce strong specific immune responses against VP2 via intragastric administration and maximum titres of IgA and IgG were attained on days 46 post oral immunization, while the highest antibody levels were obtained with the strain producing the VP2 protein in extracellular milieu. The induced antibodies demonstrated neutralizing effects on PPV infection.

Test systems to study transcriptional regulation and promoter activity in Bacillus megaterium

Plasmid-located (multi-copy) and chromosomally located (single-copy) promoter test systems were developed for Bacillus megaterium by making use of the homologous beta-galactosidase-encoding bgaM gene. The multi-copy system facilitates rapid promoter analyses and promoter trapping, whereas the single-copy system, integrated into the chromosome, allows investigation of tightly regulated promoters. As a prerequisite for both the multi- and the single-copy systems, a beta-galactosidase-deficient B. megaterium strain was generated by deletion mutagenesis. Both test systems were verified using the promoter of the xylose operon (P( xylA )) from B. megaterium along with its repressor (XylR). As expected, expression levels in the two systems differed significantly, although expression of the bgaM reporter gene was induced by xylose in both cases, thereby proving the functionality of both the multi- and the single-copy system.

Genetic evidence for a defective xylan degradation pathway in Lactococcus lactis.

Genetic and biochemical evidence for a defective xylan degradation pathway was found linked to the xylose operon in three lactococcal strains, Lactococcus lactis 210, L. lactis IO-1, and L. lactis NRRL B-4449. Immediately downstream of the xylulose kinase gene (xylB) (K. A. Erlandson, J.-H. Park, W. El Khal, H.-H. Kao, P. Basaran, S. Brydges, and C. A. Batt, Appl. Environ. Microbiol. 66:3974-3980, 1999) are two open reading frames encoding a mutarotase (xylM) and a xyloside transporter (xynT) and a partial open reading frame encoding a beta-xylosidase (xynB). These are functions previously unreported for lactococci or lactobacilli. The mutarotase activity of the putative xylM gene product was confirmed by overexpression of the L. lactis enzyme in Escherichia coli and purification of recombinant XylM. We hypothesize that the mutarotase links xylan degradation to xylose metabolism due to the anomeric preference of xylose isomerase. In addition, Northern hybridization experiments suggested that the xylM and xynTB genes are cotranscribed with the xylRAB genes, responsible for xylose metabolism. Although none of the three strains appeared to metabolize xylan or xylobiose, they exhibited xylosidase activity, and L. lactis IO-1 and L. lactis NRRL B-4449 had functional mutarotases.

CcpB, a novel transcription factor implicated in catabolite repression in Bacillus subtilis.

Recent work has shown that in Bacillus subtilis catabolite repression of several operons is mediated by a mechanism dependent on DNA-binding protein CcpA complexed to a seryl-phosphorylated derivative of HPr [HPr(Ser-P)], the small phosphocarrier protein of the phosphoenolpyruvate-sugar phosphotransferase system. In this study, it was found that a transposon insertional mutation resulted in the partial loss of gluconate (gnt) and xylose (xyl) operon catabolite repression by glucose, mannitol, and sucrose. The transposon insertion was localized to a gene, designated ccpB, encoding a protein 30% identical to CcpA, and relief from catabolite repression was shown to be due to the absence of CcpB rather than to the absence of a protein encoded by a downstream gene within the same operon. The relative intensities of CcpA- and CcpB-mediated catabolite repression depended on growth conditions. On solid media, and when cells were grown in liquid media with little agitation, CcpB and CcpA both proved to function in catabolite repression. However, when cells were grown in liquid media with much agitation, CcpA alone mediated catabolite repression. Like CcpA, CcpB appears to exert its catabolite-repressing effect by a mechanism dependent on the presence of HPr(Ser-P).

Analysis of xylose operon regulation by Mud (Apr, lac) fusion: trans effect of plasmid coded xylose operon

The regulation of the Escherichia coli xylose operon was investigated by Mud (Apr, lac) fusion. β-Galactosidase activity from the xyl::Mud (Apr, lac) fusion was induced by xylose but not by arabinose and repressed by glucose. The chromosomal fusion was used to analyze the trans effect of plasmid borne xyl genes. The xylA gene repressed the expression of the xyl::Mud (Apr, lac) but xylose isomerase activity was not required for this repression. The results suggest that the regulation of the xylose operon may not be exclusively by a separate regulatory element but that the xylA gene may control the expression of the operon.

Selective cloning of Bacillus subtilis xylose isomerase and xylulokinase in Escherichia coli genes by IS5-mediated expression.

A fragment of Bacillus subtilis DNA coding for xylose isomerase and xylulokinase was isolated from a BamHI restriction pool by complementation of an isomerase-defective Escherichia coli strain. The spontaneous insertion of IS5, which occurred during the very slow growth of the E. coli xyl- cells on xylose, allowed the expression of the cloned Bacillus genes in E. coli. Without IS5 insertion, the xylose genes were inactive in E. coli. Deletion experiments indicated that the control of the expression resides within a 270-bp long region at the right end of IS5. Deletion of this region led to a loss of expression, which could be restored by insertion of the lacUV5 promoter fragment at the deletion site. Sequence analysis showed that the site of IS5 insertion is 195 bp upstream from the putative ATG initiation codon of the xylose isomerase structural gene. This ATG is preceded by a ribosome binding sequence and two hexamers also found in promoter regions of other Bacillus genes. Deletion and mutagenesis analysis led to a preliminary map of the Bacillus xylose operon.