Whole-transcriptome Analysis Research Articles

Alterations in Protein Phosphorylation and Arginine Biosynthesis Metabolism Confer β-Phenylethanol Tolerance in Saccharomyces cerevisiae.

The aromatic compound β-phenylethanol (2-PE) is inherently toxic and can inhibit cell activity in Saccharomyces cerevisiae, making it highly challenging to enhance strain tolerance through rational design due to the lack of reliable connections between tolerance phenotype and genetic loci. This study employed adaptive laboratory evolution strategy to investigate the tolerance characteristics of S. cerevisiae S288C under inhibitory concentrations of 2-PE. The tolerant mutant SEC4.0 was characterized through comprehensive analysis of whole genome sequence, transcriptome, and phosphoproteome. The findings revealed that the high resistance of SEC4.0 was not primarily due to large-scale transcriptional upregulation of stress response genes, but rather through alterations in the phosphorylation levels of lipid-related pathways. PKC1 mutations that affect stress signal transduction and SPT3 mutations that affect arginine biosynthesis have been shown to significantly enhance 2-PE resistance. This study also investigated the effects of exogenous amino acid addition and synergistic effects with two key mutanted genes on 2-PE resistance. This study provides a foundation for enhancing yeast tolerance to this aromatic compound through rational design strategies.

Whole-transcriptome analysis reveals the profiles and roles of coding and non-coding RNAs during hair follicle cycling in Rex rabbits

BackgroundRex rabbit is famous for its silky and soft fur coat, a characteristic predominantly attributed to its hair follicles. Numerous studies have confirmed the crucial roles of mRNAs and non-coding RNAs (ncRNAs) in regulating key cellular processes such as cell proliferation, differentiation, apoptosis and immunity. However, their involvement in the regulation of the hair cycle in Rex rabbits remains unknown.ResultsIn this study, we identified the hair follicle stages of Rex rabbits aged 3 to 5.5 months. Skin samples collected at 4, 5 and 5.5 months, representing the morphological features of the anagen, catagen and telogen stage separately, were finally selected for whole-transcriptome analysis. 25,736 mRNA, 8280 lncRNA, 24,885 circRNA and 1138 miRNA transcripts were identified. 6027 differently expressed mRNAs (DEGs), 2381 differently expressed lncRNAs (DELs), 438 differently expressed circRNAs (DECs) and 167 differently expressed miRNAs (DEMs) were detected in the anagen vs. catagen (AvC) comparison. 4092 DEGs, 1540 DELs, 356 DECs and 141 DEMs were detected in the anagen vs. telogen (AvT) comparison. 2290 DEGs, 779 DELs, 249 DECs and 92 DEMs were detected in the catagen vs. telogen (CvT) comparison. DEGs were primarily enriched in GO items including plasma membrane, integral component of plasma membrane and extracellular space. KEGG enrichment analysis revealed that DEGs were mainly enriched in PI3K-Akt signaling pathway, cell cycle and Wnt signaling pathway (p < 0.05). KEGG analysis showed trans-acting genes of DELs were significantly enriched in Hippo signaling pathway, PI3K-Akt signaling pathway and Melanogenesis. Target genes of DEMs were mainly enriched in MAPK signaling pathway, Wnt signaling pathway, ECM-receptor interaction and Signaling pathways regulating pluripotency of stem cells. Based on the ceRNA mechanism, lncRNA/circRNA-miRNA-mRNA networks were constructed involving 9 DECs, 437 DELs, 50 DEMs and 416 DEGs.ConclusionsTotally, this study provides comprehensive insights into the expression patterns of protein-coding genes and non-coding transcripts throughout the HF cycle, and enhancing the understanding of the regulatory mechanisms underlying mammalian hair fiber development.

Analysis of whole transcriptome reveals the immune response to porcine reproductive and respiratory syndrome virus infection and tylvalosin tartrate treatment in the porcine alveolar macrophages.

Porcine reproductive and respiratory syndrome virus (PRRSV) is a major pathogen that has caused severe economic losses in the swine industry. Screening key host immune-related genetic factors in the porcine alveolar macrophages (PAMs) is critical to improve the anti-virial ability in pigs. In this study, an in vivo model was set to evaluate the anti-PRRSV effect of tylvalosin tartrates. Then, strand-specific RNA-sequencing (ssRNA-seq) and miRNA-sequencing (miRNA-seq) were carried out to profile the whole transcriptome of PAMs in the negative control, PRRSV-infected, and tylvalosin tartrates-treatment group. The ssRNA-seq identified 11740 long non-coding RNAs in PAMs. Based on our attention mechanism-improved graph convolutional network, 41.07% and 28.59% lncRNAs were predicted to be located in the nucleus and cytoplasm, respectively. The miRNA-seq revealed that tylvalosin tartrates-enhanced miRNAs might play roles in regulating angiogenesis and innate immune-related functions, and it rescued the expression of three anti-inflammation miRNAs (ssc-miR-30a-5p, ssc-miR-218-5p, and ssc-miR-218) that were downregulated due to PRRSV infection. The cytoplasmic lncRNAs enhanced by tylvalosin tartrates might form ceRNA networks with miRNAs to regulate PAM chemotaxis. While cytoplasmic lncRNAs that were rescued by tylvalosin tartrates might protect PAMs via efferocytosis-related ceRNA networks. On the other hand, the tylvalosin tartrates-rescued nuclear lncRNAs might negatively regulate T cell apoptosis and bind to key anti-inflammation factor IL37 to protect the lungs by cis- and trans-regulation. Our data provides a catalog of key non-coding RNAs in response to PRRSV and tylvalosin tartrates and might enrich the genetic basis for future PRRSV prevention and control.

Identification of Novel 58-5p and SREBF1 Interaction and Effects on Apoptosis of Ovine Ovarian Granulosa Cell.

High concentrations of prolactin (PRL)-induced ovine ovarian granulosa cell (GCs) apoptosis and MAPK12 could aggravate the induced effect. However, the molecular mechanisms that MAPK12-induced GC apoptosis and repressed steroid hormone secretion remain unclear. In this study, GCs in the P group (GCs with high PRL concentration: 500 ng/mL PRL) and P-10 group (GCs with 500 ng/mL PRL infected by lentiviruses carrying overexpressed sequences of MAPK12) were collected for whole-transcriptome analysis. Then, we applied the miRNA mimics combined with a dual-luciferase reporter gene assay to explore the molecular mechanisms through which MAPK12 affected GC apoptosis and steroid hormones secretion. The whole-transcriptome analysis indicated that MAPK12 regulated high PRL concentration GC apoptosis and steroid hormone secretion mainly through novel 58. The expression of pro-apoptotic proteins Caspase 3 and Bax was increased, while the expression of anti-apoptotic protein BCL-2 declined by novel 58-5p in high PRL concentration GCs (p < 0.05); The secretion of steroid hormones and genes associated with steroid secretion (CYP11A1, 3β-HSD and CYP19A1) decreased (p < 0.05), while the protein expression of the target gene, SREBF1 of novel 58, was repressed by novel 58-5p in high PRL concentration GCs (p < 0.05). Dual-luciferase reporter gene analysis showed that SREBF1 was confirmed as a target gene of novel 58-5p and the negative feedback interaction was established between novel 58-5p and SREBF1. The ggccggctgggggattgccg sequence may be the target site of SREBF1, targeted by novel 58-5p. In addition, steroid hormone secretion was reduced and GC apoptosis was suppressed after the interference of SREBF1 in ovine ovarian GCs with high PRL concentration. In conclusion, novel 58-5p regulated ovine ovarian GC apoptosis and steroid hormone secretion by targeting SREBF1.

Non-coding RNAs and regulatory networks involved in the Ameson portunus (Microsporidia)-Portunus trituberculatus interaction.

Ameson portunus, the causative agent of "toothpaste disease" in Portunus trituberculatus and "slurry-like syndrome" in Scylla paramamosain, has resulted in considerable economic losses in the marine crab aquaculture industry in China. Practical control strategies are yet unavailable. Non-coding RNAs (ncRNAs) are crucial components of gene regulation of intracellular parasites, however, their roles in regulating the microsporidia-host interaction remain limited. Here we conducted a whole-transcriptome RNA-seq analysis to identify ncRNAs and to establish the interaction regulatory networks to get further insights into the A. portunus-P. trituberculatus interaction. Totally, 2805 mRNAs, 484 lncRNAs, 5 circRNAs, and 496 miRNAs were identified from A. portunus. These ncRNAs are possibly important regulators for its own energy and substrate metabolism, thereby supporting the intracellular survival and proliferation of A. portunus. DNA replication-associated mRNAs were significantly up-regulated after P. trituberculatus infection with A. portunus. It can be hypothesized that up-regulated lncRNAs may be responsible for the up-regulation of these DNA replication-related genes by miRNAs in P. trituberculatus. The downregulation of metabolic pathways is one of possible strategies of P. trituberculatus to respond the infection of A. portunus. Cross-species miRNAs were suggested to play important roles in the cross-talk of P. trituberculatus-A. portunus, e.g. the disruption of the cytoskeletal organization and normal cell function of host by this microsporidian. The results enrich the knowledge of ncRNAs in microsporidia and offer new insights into microsporidia-host interactions.

Whole-transcriptome analysis reveals the characteristics of intramuscular fat circRNA expression and its associated network in grazing yaks of different months of age under cold stress

Whole-transcriptome analysis reveals the characteristics of intramuscular fat circRNA expression and its associated network in grazing yaks of different months of age under cold stress

Genomic and transcriptional analysis of genes involved in new isolated hexadecane and naphthalene utilization Acinetobacter calcoaceticus Aca13 strain

ABSTRACT In this report, Acinetobacter calcoaceticus Aca13 was isolated from crude oil-polluted soil. The optimization of growth conditions showed that Acinetobacter calcoaceticus Aca13 can tolerate a wide range of temperatures (14–42°C). The whole-genome sequence showed that the circular chromosome of Acinetobacter calcoaceticus Aca13 was 3,966,524 bp in size, with an average GC content of 38.78%. Whole-genome analysis revealed that 39 cytochrome proteins, 49 monooxygenases and 46 dioxygenases might be related to hexadecane and naphthalene degradation. Whole-transcriptome analysis revealed that six dioxygenases could be induced by naphthalene and that one monooxygenase could be significantly induced by hexadecane. Both genomic and transcriptional results showed that alkane 1-monooxygenase is the key enzyme for hexadecane degradation and that aromatic ring-hydroxylating dioxygenase is the key enzyme for naphthalene degradation. The present study contributes to the genomic and transcriptomic databases of crude oil-degrading microorganisms.

Circadian Regulation of the Rice Immune Response during Rice Blast Infection via Metabolic and Calcium Signaling.

The circadian clock is crucial in plant immunity and metabolism, yet the coordinating mechanisms remain elusive. In the present study, transcriptome analysis of M. oryzae-infected rice leaves and rhythmic analysis showed reduced amplitudes of circadian and phytochrome genes, impacting immune response, metabolic pathways, and calcium signaling. The amplitudes of pattern-triggered immunity (PTI)-related genes declined, while the rhythmicity of effector-triggered immunity (ETI)-related genes disappeared. Moreover, alterations in the phases of metabolic pathways were observed, potentially involved in immune response regulation like phytohormone biosynthesis. Calcium signaling exhibited a circadian pattern similar to that of the whole-transcriptome analysis. The administration of CaCl2 alleviated, whereas the calcium ion chelator EGTA aggravated, the phenotypes of rice blasts, suggesting their role in regulating the circadian clock-mediated immune response in rice. Our study highlighted the significance of circadian regulation in rice blast-induced immune modulation, which may contribute to developing immunomodulators and the formulation of chronobiology-based precise therapeutic regimens.

Whole-Transcriptome Analysis Reveals the Regulatory Network of Immune Response in Dapulian Pig.

There is a consensus that indigenous pigs in China are more resistant than modern commercial pigs in terms of disease resistance. Generally, the immune response is an important part of anti-disease capability; however, the related mechanism in pigs is largely puzzling. Here, the public transcriptome data of peripheral blood mononuclear cells (PBMCs) from Dapulian (Chinese local breed) and Landrace (Commercial breed) pigs after stimulation with polyinosinic-polycytidylic acid (poly I:C, a conventional reagent used for simulation of the viral infection) were reanalyzed, and the immune response mechanism in different pig breeds was investigated from a transcriptomic perspective. Of note, through comparative analyses of Dapulian and Landrace pigs, the candidate genes involved in swine broad-spectrum resistance were identified, such as TIMD4, RNF128 and VCAM1. In addition, after differential gene expression, target gene identification and functional enrichment analyses, a potential regulatory network of miRNA genes associated with immune response was obtained in Dapulian pigs, including five miRNAs and 12 genes (such as ssc-miR-181a, ssc-miR-486, IL1R1 and NFKB2). This work provides new insights into the immune response regulation of antiviral responses in indigenous and modern commercial pigs.

Is pT0 a Reliable End Point for Biomarker Discovery for Preoperative Chemotherapy Response in Patients With Bladder Cancer?

Purpose: Traditional biomarker investigation schemas for chemotherapy response prediction in patients with bladder cancer relying on the pT0 status at radical surgery are confounded by the therapeutic effect of transurethral resection of bladder tumor (TURBT). Studying cN+ patients and assessing pN0 status presents a unique opportunity for overcoming this bias. Materials and Methods: We studied 26 patients with biopsy-proven cTanyN1-3M0 bladder cancer (2005-2016) who underwent induction chemotherapy and radical cystectomy with pelvic lymphadenectomy. Metastasis and overall survival (OS) outcomes were examined using Kaplan-Meier method and compared using log-rank test. Paired pretherapy primary bladder and nodal tissues were available for 10 patients. In these patients, whole-transcriptome RNA-seq analysis was performed on bladder tumor (for pT0 and pN0 prediction) and lymph-nodal metastasis (for pN0 prediction) tissues to identify differentially expressed genes (DEGs) with a false discovery rate &lt; 0.1. Results: pN0 pathologic responders, but not pT0 responders, had significantly improved freedom from metastasis (5-year: pN0 88.9% vs pN+ 27.4%, log-rank P = .018) and OS (5-year: pN0 76.2% vs pN+ 12.2%, log-rank P = .024). Using RNA-seq data, we identified a significant discordance rate of 87.5% between DEG-based predictive signatures for pT0 and pN0 response to cisplatin-based chemotherapy. This datum, combined with the knowledge that ∼40% of patients who achieve pT0 status at radical surgery, achieve it simply through the therapeutic effect of TURBT (SWOG S8710), underscores a substantial bias in the current biomarker discovery initiatives that use pT0 as an end point. Conclusions: Our findings suggest a need for devising novel study designs to aid in the discovery of reliable biomarkers for preoperative chemo/immunotherapy response in bladder cancer. Clinical node-positive patients may be ideally situated but remain understudied.

Spatial Transcriptomic Profiling to Characterize the Nature of Peripheral- Versus Transition-zone Prostate Cancer

Background and objectiveProstate cancer (PC) in the transition zone (TZ) has better prognosis than peripheral-zone (PZ) PC despite higher prostate-specific antigen (PSA) in patients with TZ tumors. Our aim was to characterize molecular differences between TZ and PZ tumors and their clinical implications. MethodsWe performed spatial whole-transcriptome analyses of 50 regions of interest (ROIs) from three patients with PZ and/or TZ PC. ROIs were selected on the basis of SYTO13, pan-cytokeratin, smooth muscle actin, and CD45 markers. Downstream analyses of the transcriptomics data included differential gene expression and Molecular Signatures Database cancer hallmark analysis for pathway enrichment. Survival analyses were performed in The Cancer Genome Atlas (TCGA) prostate data set. Key findings and limitationsWe analyzed Gleason grade 4 (10 ROIs) and grade 5 (10 ROIs) tumors from the PZ, and grade 3 (10 ROIs), grade 4 (11 ROIs), and grade 5 (1 ROI) tumors from the TZ. We observed distinct gene expression profiles between PZ (n = 20) and TZ (n = 22) tumors. TZ ROIs exhibited enrichment of androgen response signaling (ARS; false discovery rate <5%) and a higher androgen subscore of the genomic prostate score (p < 0.001), regardless of grade and the epithelial, stromal, or immune component of the region. Genes underexpressed in PZ tumors, including ARS genes, were associated with poorer progression-free survival in the TCGA data set (n = 451; p < 0.05). Conclusions and clinical implicationsOur results demonstrate higher ARS in TZ tumors than in PZ tumors, explaining the higher PSA and better prognosis for TZ tumors. Further studies are needed to integrate zonal location in diagnostic and treatment algorithms for PC. Patient summaryWe looked at the biological explanation for higher PSA (prostate-specific antigen) levels in blood for cancers found in different zones of the prostate. We found that genes involved in androgen response signaling may explain the higher PSA often seen for tumors in the transition zone than for tumors in the peripheral zone of the prostate. These findings may inform how we diagnose and treat prostate cancer.

Androgen-targeted hsa_circ_0085121 encodes a novel protein and improves the development of prostate cancer through facilitating the activity of PI3K/Akt/mTOR pathway and enhancing AR-V7 alternative splicing

Prostate cancer (PCa) is the most prevalent type of cancer and the second leading cause of mortality in males, with a marked increase in incidence observed across the globe. In the present study, whole-transcriptome analysis was conducted to identify differentially expressed circular RNAs (DE-circRNAs). The coding abilities of the DE-circRNAs were analyses, and it was found that hsa_circ_0085121 (circRNF19A) not only exhibited overexpression in PCa cells and tumor samples, but also encoded a 490 amino acid polypeptide designated circRNF19A-490aa. The knockdown of circRNF19A was observed to notably inhibit the proliferation, invasion, migration and docetaxel resistance of PCa cells. In contrast, mutation of the IRES significantly impaired the tumor-promoting function of circRNF19A, indicating that circRNF19A-490aa is the primary form that regulates the malignant behaviors of PCa cells. Mechanistically, circRNF19A-490aa was demonstrated to interact with HSP90AA1, thereby enhancing AR activity and facilitating the activation of the Akt/mTOR and PLK1 pathways. Furthermore, circRNF19A-490aa was observed to interact with HNRNPF, facilitating the recruitment of HNRNPF to the splicing site of AR-V7 and enhancing its alternative splicing. Finally, the androgen receptor (AR) was observed to bind to the promoter region of the RNF19A gene, subsequently regulating the expression of circRNF19A and circRNF19A-490aa. These data indicate that circRNF19A plays a pivotal role in AR activation and AR-V7 generation by encoding a novel protein, circRNF19A-490aa, and targeting circRNF19A may prove an effective strategy for impeding the progression of CRPC.

QLTI-06. NEXT GENERATION SEQUENCING SIGNIFICANTLY IMPROVES THE DIAGNOSTIC ACCURACY IN GLIOBLASTOMAS

Abstract The 2021 WHO Classification of CNS Tumours recognizes the presence of TERT promoter (pTERT) mutations, combined +7/-10 chromosome copy-number alterations, or EGFR amplification as a defining molecular feature(s) of glioblastoma, independent of histology. We evaluated these biomarkers in a cohort of Indian patients using a single-run next-generation sequencing (NGS) platform at a relatively low depth of 100. Seventy-four adult diffuse gliomas were selected from the Exsegen Genomics Research Pvt Ltd Biobank established during the trial CTRI/2021/09/036861 after reviewing their clinical and pathological data. Paired surgical tissue and blood samples underwent whole-exome sequencing on an Illumina NovaSeq-6000 (Illumina, San Diego, USA). Single-nucleotide variations (SNVs) were processed using the DRAGEN pipeline to generate Mutation Annotation Format (MAF) files. Copy number variations (CNVs) analysis was performed using GATK and GISTIC2.0. Thirty-nine glioma samples with IDH1R132H mutations were excluded. A total of 32/35 (91.4%) IDH-wildtype tumours met the 2021 WHO criteria for glioblastoma, IDH-wildtype and were included. Twenty-four glioblastomas also underwent whole-transcriptome analysis. Microvascular proliferation (n=24, 75%) and necrosis (n=30, 93.9%) were present in the majority. pTERT mutations were identified in 23 (71.9%) samples, with C228T mutations (n=15/23, 65.2%) being more common than C250T mutations (n=8/23, 34.8%). EGFR amplification, defined as ≥5 copies by NGS CNV, was seen in 15 (46.9%) samples, with a strong correlation between EGFR CNV and logEGFR expression (r=0.79; p=0.017). Whole-arm +7/-10 genotype was evident in 17 (53.1%) tumours, and another 5 (15.6%) showed partial copy-number alterations. Notably, two gliomas without necrosis and proliferation initially diagnosed as oligodendrogliomas due to misinterpretation of the IDH immunostain, were reclassified as glioblastoma, IDH-wildtype. The data was validated using Sanger Sequencing and targeted panel sequencing to a depth of 500. Even low depth NGS sequencing, that is cost effective and time efficient offers significant improvements in diagnostic molecular neuropathology.

The importin FocKap119 is required for fungal growth and pathogenicity of the Fusarium oxysporum f. sp. cubense via interaction with FocCks1

Fusarium oxysporum f. sp. cubense (Foc), the causal agent of banana wilt disease, is one of the most devastating pathogens of bananas (Musa spp.). The nucleocytoplasmic trafficking of proteins and RNAs, mediated by karyopherins (Kaps), is essential for eukaryotes. However, little is known about how Kaps regulate fungal growth and pathogenicity. Here, a Kap119 homolog (FocKap119) was identified in the Foc tropical race 4 strain Foc302. Deletion of FocKap119 led to impaired vegetative growth, conidiation, cell wall integrity, and pathogenicity. Compared to the wild type, the ΔFocKap119 mutant showed increased sensitivity to oxidative stress but greater tolerant to osmotic stress. FocKap119 was found to interact with FocCks1 (cell cycle-dependent kinase subunit 1) in a yeast two-hybrid system, and deletion of FocCks1 showed similar phenotypes as ΔFocKap119. Moreover, whole-transcriptome analysis and qRT-PCR results indicated that deletion of FocKap119 resulted in down-regulation of genes related to key virulence factor biosynthesis, including fusaric acid and beauvericin biosynthetic gene clusters. The ΔFocKap119 mutant also triggered stronger plant defense responses during the early infection compared to the wild type. This study provides insights into how FocKap119 regulated growth, abiotic stress response, and pathogenicity in Foc.

Transcriptomic evidence of black soybean ethanolic extract and 2-aminobutyric acid in suppressing neuroinflammation and enhancing synaptic transmission

IntroductionRecently, the awareness of the beneficial utilization of natural bioactive compounds in treating neuroinflammation has gained particular attention. We aimed to understand the anti-neuroinflammatory effect of black soybeans (Glycine max (L.) Merr) ethanolic extract (BBEE) and its bioactive compound, 2-aminobutyric acid (2-AB), against LPS-induced SH-SY5Y cells. MethodCell viability and the optimum therapeutic dose were confirmed by MTT assay. We conducted a whole-transcriptomic analysis of BBEE and 2-AB in LPS-induced SH-SY5Y cells using microarray normalized with SST-RMA. DEGs were selected based on p-value < 0.05 and fold change > 2, and validated by RT-qPCR and immunocytochemical analyses. ResultsWe found that both BBEE and 2-AB down-regulated the expression of inflammatory cytokines IL6 and TNFA under LPS-induced conditions. This was also observed in the microarray data, showing downregulation of several inflammatory pathways, such as NF-kB, and IL6-JAK/STAT3-signaling pathways. In contrast, it upregulated the expression of CALML3, GRIN2, and GRIA2 gene expressions, which influence the AMPK and CAMK2 signaling pathways, indicating the potential of BBEE in neurotransmission and synaptic function. Also, immunofluorescence analysis revealed that 2-AB treatment significantly increased PSD-95 and Ca2+ levels, suggesting its effect on synaptic transmission essential for brain function. ConclusionOur findings suggest the potential anti-neuroinflammatory effects of BBEE and 2-AB, which may offer therapeutic and preventive benefits in mitigating neurological disorders. Given that BB is widely consumed in many Asian countries, our study may encourage its incorporation into the daily diet to slow inflammation-induced neurodegenerative disorders, reduce age-related cognitive decline, and enhance overall brain function.

A new LNC89/LNC60-Col11a2 axis revealed by whole-transcriptome analysis may be associated with goiters related to excess iodine nutrition.

Goiter related to excessive iodine nutrition remains a significant public health issue in some countries. There has been no reported study on long noncoding RNAs (lncRNAs) related to goiters. In this study, goiter was induced by drinking water with excess iodine for 10 or 20 weeks in Kunming mice. Whole transcriptome sequencing results showed that LNC89 expression increased in mice goiter tissues compared to normal thyroid tissues and higher in 20 weeks goiter tissues than in 10 weeks goiter tissues, which were identified by qRT-PCR. Cooperate with human-mouse homologous gene conversion, a new LNC89/LNC60-Col11a2 axis was predicted by LncTar and expression correlation analysis based on whole transcriptome sequencing results. Increased Col11a2 expression was also identified by qRT-PCR and Western blot in the mice goiter tissues. In the human normal thyroid cell line Nthy-ori-3 treated with KI03, LNC60 and Col11a2 expression increased with promoted cell viability, which were reversed by siLNC60 treatment. Furthermore, LNC60 and Col11a2 mRNA levels were found increased in peripheral blood of nodular goiter patients from high water iodine areas of China and have high diagnostic values for nodular goiter while AUC of LNC60 and Col11a2 are 89.97% and 84.85%, respectively. In conclusion, the novel LNC89/LNC60-Col11a2 axis may be involved in the progression of goiter related to iodine excess, providing potential biomarkers and therapeutic targets in the future.

Transcriptional variation and RNA polymorphism among different Lentinula edodes (Berk.) Pegler strains.

Lentinula edodes is a commercially important mushroom known for its nutritional and therapeutic values. However, the molecular mechanisms underlying the distinct nutritional and physiological attributes of various L. edodes strains are not well understood. This study focused on three Lentinula strains (DMRO-356, DMRO-623, and DMRO-388s) with different nutritional and productivity profiles. Illumina sequencing was used to perform a whole-transcriptome analysis, conducting 100-base pair paired-end sequencing of total messenger RNA (mRNA) in duplicate, resulting in 28-48 million sequencing reads per strain. After rigorous data filtering, over 99% of high-quality reads were retained, and more than 95% were aligned to the Lentinula genome. Differential gene expression analyses identified 2210 differentially expressed genes between DMRO-356 and DMRO-623, 862 between DMRO-356 and DMRO-388s, and 2212 between DMRO-623 and DMRO-388s. Significant genetic variations were found among the strains, including 7753 single nucleotide polymorphisms (SNPs) in DMRO-356 versus DMRO-623 and 4080 SNPs in DMRO-356 versus DMRO-388s. Additionally, 349 insertions/deletions (InDels) were found in DMRO-356/DMRO-623 and 218 in DMRO-356/DMRO-388 s. Non-synonymous SNPs, which alter amino acid compositions, were analyzed, showing a preference for polar over charged amino acids. These differentially expressed genes were associated with various nutritional and developmental processes, highlighting the importance of genetic variations in shaping amino acid composition and potentially affecting protein function. This study is the first comprehensive exploration of transcriptional differences among Lentinula strains available for its cultivation, providing valuable insights to enhance mushroom quality and productivity. © 2024 Society of Chemical Industry.

A Map of Transcriptomic Signatures of Different Brain Areas in Alzheimer's Disease.

Alzheimer's disease (AD) is a neurodegenerative disorder that progressively involves brain regions with an often-predictable pattern. Damage to the brain appears to spread and worsen with time, but the molecular mechanisms underlying the region-specific distribution of AD pathology at different stages of the disease are still under-investigated. In this study, a whole-transcriptome analysis was carried out on brain samples from the hippocampus (HI), temporal and parietal cortices (TC and PC, respectively), cingulate cortex (CG), and substantia nigra (SN) of six subjects with a definite AD diagnosis and three healthy age-matched controls in duplicate. The transcriptomic results showed a greater number of differentially expressed genes (DEGs) in the TC (1571) and CG (1210) and a smaller number of DEGs in the HI (206), PC (109), and SN (60). Furthermore, the GSEA showed a difference between the group of brain areas affected early (HI and TC) and the group of areas that were subsequently involved (PC, CG, and SN). Notably, in the HI and TC, there was a significant downregulation of shared DEGs primarily involved in synaptic transmission, while in the PC, CG, and SN, there was a significant downregulation of genes primarily involved in protein folding and trafficking. The course of AD could follow a definite time- and severity-related pattern that arises from protein misfolding, as observed in the PC, CG, and SN, and leads to synaptic impairment, as observed in the HI and TC. Therefore, a map of the molecular and biological processes involved in AD pathogenesis may be traced. This could aid in the discovery of novel biological targets in order to develop effective and well-timed therapeutic approaches.

Whole-transcriptome analysis reveals the effect of retinoic acid on small intestinal mucosal injury in cage-stressed young laying ducks

Retinoic acid (RA) is an active derivative of vitamin A and is involved in a variety of physiological processes, including cell growth, antioxidant, and inflammation. However, the role of RA in intestinal oxidative stress injury in caged-stressed laying ducks is unknown. In this study, we analyzed the effect and underlying mechanism of RA supplementation on intestinal damage in cage-stressed young laying ducks. One hundred and sixty laying ducks were divided into 5 treatment groups, including a control group (CR) and 4 treatment groups exposed to different RA concentrations (2,500, 5,000, 7,500 and 10,000 IU/kg, TG1 to TG4). The experimental period comprised a 7-d prefeeding period and a 10-d experimental feeding period, for a total of 17 d. Phenotypic analysis revealed that compared with the control group, RA addition increased the intestinal villus height and the villus-to-crypt ratio; decreased the crypt depth (P < 0.01); decreased the serum diamine oxidase and D-lactate concentrations (P < 0.05); increased the serum antioxidant capacity and intestinal antioxidant gene expression levels (P < 0.05); and increased the expression levels of tight junction-related genes, with the greatest effect observed in TG2 group. Our further whole-transcriptome analysis of duodenum tissues from CR and TG2 ducks revealed 706 differentially expressed mRNAs (DEmRNAs), 357 differentially expressed lncRNAs (DElncRNAs), 14 differentially expressed circRNAs (DEcircRNAs), and 4 differentially expressed miRNAs (DEmiRNAs). These DEGs are involved in calcium signaling, NOD-like receptor signaling, pyruvate metabolism, Jak-STAT signaling, Wnt signaling, riboflavin metabolism, and the adherens junction and tight junction pathways. The results of omics and marker gene expression analysis suggested that RA treatment may play a role in endoplasmic reticulum stress (ERS) and apoptosis. In conclusion, the addition of RA to the diet improved intestinal injury by improving the redox homeostasis of intestinal cells associated with ERS, enhancing the intestinal tight junction structure and alleviating the apoptosis of intestinal epithelial cells; moreover, 5,000 IU/kg RA was determined to be the most appropriate concentration for supplementation.

Inhibition of the FOXO1–ROCK1 axis mitigates cardiomyocyte injury under chronic hypoxia in Tetralogy of Fallot by maintaining mitochondrial quality control

IntroductionPersistent chronic myocardial hypoxia causes disturbances in mitochondrial quality control (MQC), ultimately leading to increased cardiomyocyte injury in patients with Tetralogy of Fallot (TOF). The present study aimed to identify the key effector molecules of cardiomyocyte injury under chronic hypoxia in TOF. MethodsClinical data from TOF patients were collected and whole transcriptome sequencing was performed on myocardial samples. Chronic hypoxia models were established in cardiac-specific knockout mice and cardiomyocytes, and a series of molecular experiments were used to determine the specific mechanisms involved. ResultsClinical cohort data and whole-transcriptome sequencing analysis of myocardial samples from TOF patients revealed that forkhead box O1 (FOXO1) plays an important role in chronic hypoxic cardiomyocyte injury. In a model of chronic hypoxia established in FOXO1 cardiac-specific knockout mice and FOXO1 gene-deficient cardiomyocytes, the AMPK signaling pathway regulates the expression of FOXO1, which in turn disrupts MQC by regulating the transcriptional activation of Rho-associated protein kinase 1 (ROCK1), and increasing the production of mitochondrial ROS, thereby exacerbating damage to cardiomyocytes. Excessive reactive oxygen species (ROS) production during MQC dysfunction further activates Cox7a2L to increase the assembly of the respiratory chain supercomplex. In addition, we found that miR-27b-3p partially binds to the 3′ untranslated region of FOXO1 to exert a protective effect. ConclusionsMaintenance of MQC under chronic hypoxia is achieved through a series of injury-protection mechanisms, suggesting that FOXO1 inhibition may be crucial for future mitigation of chronic hypoxic cardiomyocyte injury in TOF.