Wheat Samples Research Articles

Extremophilic bacteria as biofertilizer for agricultural wheat

Wheat (Triticum L.) is a strategically important agricultural crop because its quality and yield provide food security for the population. Biological fertilizers improve the growth and development of agricultural crops. Unlike chemical ones, they have no toxic effect on people and the environment. This research assessed the positive effect of extremophilic microorganisms isolated from coal dump soils of the Kemerovo Region (Russia) on the growth and development of wheat.
 The study featured bacterial isolates of Achromobacter denitrificans, Klebsiella oxytoca, and Rhizobium radiobacter, as well as their consortia in four different ratios: 1:1:1 (Consortium A), 2:1:1 (Consortium B), 1:2:1 (Consortium C), 1:1:2 (Consortium D), respectively. The beneficial effect was assessed by determining such factors as nitrogen fixation, solubilization of phosphates, potassium, and zinc, and production of gibberellic acid, siderophores, and hydrogen cyanide. The wheat samples were checked for germination, root length, and stem length.
 R. radiobacter demonstrated the best nitrogen fixation properties. Consortium D, with two shares of R. radiobacter, yielded the best results for zinc solubilization. R. radiobacter proved to be the most efficient potassium solubilizer while the isolate of A. denitrificans was the best phosphate solubilizer. The largest amount of gibberellic acid belonged to K. oxytoca. Consortium C, which included two shares of this isolate, appeared to be the most effective siderophore producer. All samples but A. denitrificans were able to produce hydrogen cyanide. The best seed germination rate (84%) belonged to Consortium C, which contained a double share of K. oxytoca. Consortia C and B (two shares of A. denitrificans) had the greatest positive effect on the root length. 
 Treatment with Consortium B resulted in the longest average stem length. Extremophilic microorganisms isolated from coal dump soils of the Kemerovo Region (Russia) had a good potential as biofertilizers that could improve wheat quality and local food security.

Synthesis of a dual-emission fluorescent probe using graphitic carbon nitride as a carrier for the rapid detection of mesosulfuron-methyl

Pesticides play an irreplaceable role in ensuring increased food production and income, but the overuse of pesticides can also pose a threat to food and environmental safety. A novel dual-emission fluorescent probe was developed for the facile and accurate detection of sulfonylurea herbicides. A Förster resonance energy transfer system, based on N-doped carbon dots (N-CDs) and thioglycolic acid-capped cadmium telluride quantum dots (TGA-CdTe QDs) as energy donor–acceptor pairs, was established using graphitic carbon nitride (g-C3N4) as a substrate and successfully applied for the micro-detection of mesosulfuron-methyl (Mes). The CDs-CdTe/C3N4 probe exhibits emission peaks at 445 and 593 nm with strong fluorescence intensity under single-wavelength excitation. Mes was shown to significantly decrease the fluorescence intensity of each emission peak via different quenching mechanisms, and the degree of quenching was proportional to Mes concentration. The linear range of fluorescence measurement was 0–90 µM, with limits of detection at 1.3 µM (445 nm) and 0.8 µM (593 nm). The dual-emission fluorescent probe exhibited excellent selectivity for Mes compared with the other eleven herbicides. The fluorescent probe has a satisfying detection performance in environmental water samples and wheat samples, and has potential application in the portable detection of pesticide residues.

Determination of seven mycotoxins in cereals by ultra performance liquid chromatography-quadrupole-time of flight mass spectrometry based on the self-built database

A method for the determination of seven mycotoxins in rice and wheat by ultra performance liquid chromatography-quadrupole-time of flight mass spectrometry (UPLC-Q-TOF/MS) based on self-built database was established. Samples were extracted with 0.2% formic acid aqueous solution-acetonitrile (50∶50, v/v), dehydrated and salted according to the QuEChERS method (4 g of magnesium sulfate, 1 g of sodium chloride, 1 g of sodium citrate, 0.5 g of citrate disodium salt), and separated on an HSS T3 column (100 mm×2.1 mm, 1.8 μm). UPLC-Q-TOF/MS with MSE screening was performed, and the positive and negative ions of the screened mycotoxins were calibrated and quantified using matrix-matched standard curves with time of flight multiple reaction monitoring (TOF-MRM). The results showed that aflatoxin G1 (AFG1), aflatoxin G2 (AFG2), aflatoxin B1 (AFB1), aflatoxin B2 (AFB2), and ochratoxin A (OTA) exhibited moderate matrix effects in rice, while OTA and zearalenone (ZEN) exhibited moderate matrix effects in wheat. The seven mycotoxins showed good linearities in their respective concentration ranges, with correlation coefficients (r) of 0.9900-0.9998. The limits of detection (LODs) for rice and wheat were 0.50-400 and 0.50-200 μg/kg, respectively, and the limits of quantification (LOQs) for both cereals were 1.00-800 μg/kg. In rice, the average recoveries at three spiked levels of low, medium, and high were 88.1%-123.9%, with relative standard deviations (RSDs) of 0.2%-13.6%. In wheat, the average recoveries at three spiked levels of low, medium, and high were 102.0%-123.4%, with RSDs of 0.8%-14.8%. As a result, one batch of 46 batches of rice was screened out for AFB1 and AFB2, with a screening rate of 2.2%, of which the measured values were 10.8 μg/kg and 1.2 μg/kg, respectively. According to GB 2761-2017, the maximum allowable level of AFB1 in rice is 10 μg/kg; thus, the exceeding rate for AFB1 is 2.2%. Deoxynivalenol (DON) was screened out in 9 out of 24 batches of wheat (screening rate, 37.5%), while ZEN was screened out in 19 batches (screening rate, 79.2%). According to GB 2761-2017, the maximum allowable levels of DON and ZEN in wheat are 1000 and 60 μg/kg, respectively. The levels of DON and ZEN detected in the wheat samples did not exceed these limits. The proposed method uses MSE for qualitative screening to avoid the occurrence of false positives caused by interfering compounds with mass numbers and retention times similar to those of the analytes. TOF-MRM mode is then used to quantify the positively screened mycotoxins. The method is fast, accurate, sensitive, and suitable for the isolation and quantitative detection of mycotoxin residues in rice and wheat samples. The findings provide powerful technical support for mycotoxin contamination monitoring in rice and wheat and early risk-warning efforts.

Characterization of the Northwestern Population of <i>Puccinia striiformis</i> f. sp. <i>tritici</i> on the Basis of Virulence and Representation of Invasive <i>PstS1</i> and <i>PstS2</i> Races

The expansion of the area of significance of yellow rust was observed in the last years. Until recently, in the conditions of the North-West, the disease occurred sporadically. However, in recent years, its strong development has been observed on wheat samples studied on the collection fields of scientific research institutes and State variety plots, as well as on some commercial fields in the Leningrad region. The aim of this work is to study the virulence and racial composition of the yellow rust pathogen in the Northwest and to conduct a molecular analysis of population samples for the presence of invasive races PstS1 and PstS2. Leaves of common wheat samples with of Puccinia striiformis urediniopustules were collected on commercial fields, State variety plots and experimental fields of the Research Institutes in 2020–2022. Near isogenic Avocet lines (Av NIL) with genes Yr1, Yr5, Yr6, Yr7, Yr8, Yr9, Yr10, Yr15, Yr17, Yr18, Yr24, Yr26, YrSp, Yr27 and differential varieties from international [Chinese 166 (Yr1), Lee (Yr7, Yr+), Heines Kolben (Yr6, Yr+), Vilmorin 23 (Yr3), Moro (Yr10, YrMor), Strubes Dickkopf (YrSD, Yr25, Yr+), Suwon 92/Omar) (YrSu, Yr+)] and European [Hybrid 46 (Yr4, Yr+), Reichersberg 42 (Yr7, Yr+), Heines Peko (Yr2, Yr6, Yr25, Yr+), Nord Desprez (Yr3, YrND, Yr+), Compair (Yr8, Yr19), Carstens V (Yr32, Yr25, Yr+), Spaldings Prolific (YrSP, Yr+), Heines VII (Yr2, Yr25, Yr+)] sets used for characteristic of pathogen virulence. Set of SCAR markers (SCP19M24a1, SCP19M24a2, SCP19M26a1, SCP19M26a2) used for identification of invasive races. A total 92 isolates were studied. High effectiveness at the seedling stage had genes Yr5, Yr10, Yr15, Yr24, Yr26. Isolates virulent to differential varieties Moro (Yr10, YrMor) and Nord Desprez (Yr3, YrND, Yr+) was not determined. Virulence to wheat genotypes with Yr17 gene was rare. Twenty-four virulence phenotypes identified using 29 virulence testers. The number of virulence alleles varied from 7 to 21. At the same time, differences between the phenotypes of P. striiformis on the studied common wheat varieties were insignificant. Most of them have united in a common group. Two groups of isolates slightly differentiated from them. The first included isolates from varieties characterized by a smaller number of virulence alleles, the second – with the maximum number of virulence alleles. Molecular analysis of the northwestern po-pulation revealed isolates belonging to the invasive PstS2 group in 2020 and 2022. Their virulence did not differ significantly from other northwestern phenotypes. The high evolutionary potential predetermines the need for annual monitoring of pathogen populations based on virulence and representation of invasive races.

Control of Aspergillus and Fusarium In Vitro and in Wheat Using Sodium Bisulfate Acidulant

We evaluated the efficacy of an acidulant, sodium bisulfate (SBS) against Aspergillus flavus and Fusarium graminearum in a simulated wheat storage model. The broth microdilution method was used to determine the MIC of SBS against the molds. Sterile wheat samples were inoculated with mold culture, followed by a 30-min attachment and the application of SBS treatment (0, 0.5, 1.0, and 1.5%, w/v). Positive and negative controls were maintained. The final moisture in wheat was consistent with the tempering process (16%). The treatments were incubated at 25°C, and microbiological analyses were performed at predetermined times (0, 6, 12, 18, 24, and 48 h). The MIC of SBS against A. flavus and F. graminearum was 0.31 and 0.16%, respectively. In wheat, the highest concentration of SBS used (1.5%) reduced (P ≤ 0.05) ~1.0 and 1.3 log of A. flavus after 18 and 48 h, respectively, whereas all three concentrations of SBS lowered (P ≤ 0.05) F. graminearum to a nondetectable level within 18 h. Overall, the addition of SBS in tempering water during the wheat tempering process seemed effective in controlling F. graminearum and partly effective against A. flavus.

Variability and interrelation of breeding-valuable traits of varieties and lines of spring soft wheat in the conditions of the Middle Volga region

The article presents the results of a three-year study (2020-2022) of 16 varieties and 17 breeding lines of spring soft wheat bred by the Federal Scientific Center for Bast Fiber Crops in the soil and climatic conditions of the Penza region. The crop productivity in the experiment varied between 1.77-4.15 t/ha. Seven samples demonstrated the highest productivity: Nastavnik, Eritrospermum 70/04-3, Irvita, Sensei, Eritrospermum 20/08-7, Lutestsens 1/12-19, Eritrospermum 15/08-4, which exceeded the standard variety Arkhat by 0.27-0.71 t/ha. During the studies the yield was related to the average variable trait (CV =11.9-19.5 %). The variation of the duration of the growing season of the studied spring wheat samples averaged 81-93 days. It was shorter in 2021 (from 67 to 80 days), the longest in 2022 (from 91 to 100 days). The height of spring soft wheat plants in the studies was a low-variable feature (CV = 3.4-8.5 %) and averaged 82.1-100.2 cm over the years. The ear grain content varied from 18 pieces in the Erythrospermum 25/08-11-18 in 2022 up to 40 pieces in the Nastavnik variety in 2021. The trait was medium-variable (CV = 11.3-18.5 %). The highest average productivity of an ear was noted in 2022 – 1.08 g, and the lowest in 2020 – 0.92 g. The high mass of grain per ear was noted in Nastavnik variety – 1.40 g, Eritrospermum 70/04-3 – 1,38 g, Irvita – 1.35 g, which were characterized by high yield. Eritrospermum 70/04-3, Eritrospermum 20/08-7 and Irvita selected by the genotype productivity were characterized by bulky grains of 40.6-43.2 g. A significant correlation was observed between the yield and the grain weight per plant (r = 0.908...0.924, P≤0.001). The studied patterns can be used in ecological breeding of soft spring wheat.

Mycotoxin Occurrence in Milk and Durum Wheat Samples from Tunisia Using Dispersive Liquid-Liquid Microextraction and Liquid Chromatography with Fluorescence Detection.

Food and feed contamination with mycotoxins is a major public health concern. Humans and animals are exposed to these toxins by consuming contaminated products throughout their lives. In this study, a method based on dispersive liquid-liquid microextraction (DLLME), followed by liquid chromatography with fluorescence detection (LC-FLD), was validated for the determination of aflatoxins (AFs) M1, B1, B2, G1, G2, zearalenone (ZEN), and ochratoxin A (OTA). The method was applied to 150 raw cow milk samples and 90 market durum wheat samples from two Tunisian climatic regions: the littoral region (Mahdia) and the continental region (Béja). This work was carried out to obtain more surveillance data to support rapid initiatives to assure safe foods and protect consumer health and to estimate the daily exposure of the Tunisian population consuming those products. AFG2 and OTA were found in wheat with incidences of 54.4 and 11.1%, respectively. On the other side, milk samples were contaminated by AFG2, AFB1, and AFB2 with incidences of 8.7%, 2.0%, and 0.67%, respectively. Some of the samples showed OTA concentrations above the maximum limit allowed by the European Union, which represents a health risk for consumers in Tunisia, where no legislation exists about the maximum content of mycotoxins in food.

KNN Algoritması Uzaklık Metrik Yöntemlerinin Buğday Tohumları Veri Seti Üzerinde Sınıflandırma Başarısının Tespit Edilmesi

Machine learning algorithms are widely used in product sorting processes in the food industry. The 
 attributes of the products are used in the classification process. Attributes vary for each product. In this 
 study, using the k nearest neighbor (KNN) algorithm, the classification of the wheat groups of Kama, 
 Rosa and Canada was performed. The Seeds dataset provided in UCI (University of California, Irvine) 
 machine learning open source data storage was used. There are 70 examples of each wheat class in the 
 data set. In addition, the classification estimation success of distance metrics and the number of training 
 data was measured. Each of the wheat samples was randomly selected and a soft X-ray technique was 
 used to visualize the inner core structure of the wheat in the experimental environment with high 
 quality. According to the training rates ranging from 50% to 90% of the data set, the classification 
 success of the KNN algorithm was tested. In the KNN algorithm, the neighborhood values 1, 3 and 5 
 were selected to affect the classification success. The successes of the Euclidean, Chebyshev, 
 Manhattan and Mahalanobis distance metric methods of the KNN algorithm were tested according to 
 each k neighborhood value. According to the results obtained, with the Mahalanobis metric method, a 
 classification success rate of 0.9924 accuracy was obtained according to the AUC (Area Under the Curve) 
 success metric by using the neighborhood value of k = 3. In the literature, there is no study comparing 
 the KNN algorithm, neighborhood values and distance vectors together on food data sets using varying 
 training and test data. Therefore, it is thought that the study will make an important contribution to 
 the literature.

Türkiye'nin Farklı İllerinde Yetiştirilen Yerel Karakılçık Buğday Çeşitlerinin Bazı Fiziksel ve Fizikokimyasal Özellikleri

Türkiye, one of the first places where wheat was cultivated, is the gene source of ancient wheat varieties that have attracted great interest in recent years. In this study, Karakılçık wheat varieties (KWV) grown by local producers in different provinces of Türkiye for the production of "Karakılçık Bread" were collected. Some physical (foreign matter, hectoliter and thousand kernel weight, grain hardness, kernel size distribution and homojenity, and colour) and physicochemical (wet and dry gluten, gluten index, falling number, zeleny sedimentation, and delayed sedimentation) characteristics of these KWV were determined and compared with a modern bread wheat variety (MBWV). The hectoliter and thousand kernel weights of KWV varied between 26.0-44.74 g and 60.43-70.80 kg hl-1, respectively. It was determined that the KWV of İzmir, Çanakkale, and Konya provinces had the largest and most homogeneous grain structure, while the Antalya KWV had the lightest and the Samsun KWV had the darkest grain color. The highest wet and dry gluten values were measured in the KWV of Antalya province, followed by MBWV and Konya province KWV. Significant differences were determined between MBW and KWV in terms of sedimentation and delayed sedimentation values (p

Survey and risk assessment of aflatoxins and sterigmatocystin in Japanese staple food items and the evaluation of an in-house ELISA technique for rapid screening

Aflatoxins and sterigmatocystin (STC) are carcinogenic mycotoxins frequently detected in many kinds of agricultural products. An analytical method for the simultaneous detection of these mycotoxins was developed using immunoaffinity chromatography clean-up and LC–MS/MS techniques to assess the health risks associated with the exposure to aflatoxins and STC present in staple Japanese food items. A survey targeting Japanese staple food items, including rice and wheat, was conducted after validating the analytical method by conducting a single-laboratory test. A total of 550 samples were analyzed. Aflatoxins were not detected in all samples, whereas STC was detected in 22.4% of the tested samples. The dietary exposure to STC was estimated based on the results of the survey, and the amount of food intake ranged from 0.11 to 0.67 ng/kg body weight/day. The results obtained following the margin of exposure (MOE) approach revealed that STC in staple food items posed little risk to the general Japanese population. In addition, an ELISA technique for detecting STC in brown rice and wheat samples was developed, as high levels of contamination were observed in these food items. The performance of the developed ELISA technique was evaluated using STC-spiked samples, and the average recoveries were in the ranges of 94.6–121.2% for brown rice and 91.5–117.9% for wheat. The developed two analytical methods based on LC-MS/MS and ELISA techniques were efficiently utilized for assessing the health risks associated with exposure to these carcinogenic mycotoxins.

Identification of Puccinia striiformis races from the spring wheat crop in Xinjiang, China.

Stripe rust, caused by Puccinia striiformis f. sp. tritici (Pst), is a foliar disease that affects both winter and spring wheat crops in Xinjiang, China, which is linked to Central Asia. Race identification of Pst from spring wheat in Xinjiang was not done before. In this study, a total of 216 isolates were recovered from stripe rust samples of spring wheat in the region in 2021 and multiplied using the susceptible cultivar Mingxian 169. These isolates were tested on the Chinese set of 19 wheat differential lines for identifying Pst races. A total of 46 races were identified. Races Suwon-11-1, Suwon11-12, and CYR32 had high frequencies in the spring wheat region. The frequencies of virulence factors on differentials "Fulhard" and "Early Premium" were high (>95%), whereas the virulence factor to differential "Triticum spelta var. Album" (Yr5) was not detected, while virulence to other differentials showed variable frequency within different counties. The predominant races in winter wheat in the same season were also detected from spring wheat cultivars, indicating Pst spreading from winter wheat to spring wheat crops. Deploying resistance genes in spring and winter wheat cultivars is critical for control stripe rust.

Optimization and validation of an oxidation and solid-phase extraction procedure for analysis of imidacloprid and its metabolites in cereals using ultra-performance liquid chromatography tandem mass spectrometry

A simple and reliable ultraperformance liquid chromatography tandem mass spectrometry (UPLC-MS/MS) method was proposed for analysis of the total residues of imidacloprid and its 6-chloropyridinyl metabolites in cereals. The method consisted of extraction with acidic acetonitrile, conversion of the analytes into 6-chloronicotinic acid by oxidation, cleanup with C18 cartridges, and UPLC-MS/MS detection. The validation results met the requirements of the guidelines for the detection of pesticide residues in EU and China, including the linearity (R2 = 0.998), matrix effect (−0.5∼-7.1%), accuracy (75.1–109.6%), precision (3.5–13.0%), metabolite conversion efficiency (81.6–102.3%), and sensitivity (limit of detection (LOD) of 0.0015 mg/kg and limit of quantification (LOQ) of 0.0050 mg/kg). The established method met the requirements of the residue definition and the maximum residue levels (MRLs) of imidacloprid in cereals, and was further applied to investigate the residues and dissipation of imidacloprid and its metabolites in wheat samples after field application.

First report of cereal yellow dwarf virus RPS infecting wheat in Australia.

Yellow dwarf viruses (YDVs) reduce grain yield in a wide range of cereal hosts worldwide. Cereal yellow dwarf virus RPV (CYDV RPV) and cereal yellow dwarf virus RPS (CYDV RPS) are members of the Polerovirus genus within the Solemoviridae family (Scheets et al. 2020; Sõmera et al. 2021). Along with barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV) (genus Luteovirus, family Tombusviridae), CYDV RPV is found worldwide and has mostly been identified as being present in Australia based on serological detection (Waterhouse and Helms 1985; Sward and Lister 1988). However, CYDV RPS has not previously been reported in Australia. In October 2020, a plant sample (226W) was collected from a volunteer wheat (Triticum aestivum) plant located near Douglas, Victoria, Australia that displayed yellow-reddish leaf symptoms typical of YDV infection. The sample tested positive for CYDV RPV and negative for BYDV PAV and BYDV MAV by tissue blot immunoassay (TBIA) (Trębicki et al. 2017). Given that CYDV RPV and CYDV RPS can both be detected using serological tests for CYDV RPV (Miller et al. 2002), total RNA was extracted from stored leaf tissue of plant sample 226W for further testing using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) with modified lysis buffer (Constable et al. 2007; MacKenzie et al. 1997). The sample was then tested by RT-PCR using three sets of primers that were designed to detect CYDV RPS, targeting three distinct overlapping regions (each approximately 750 bp in length) of the 5' end of the genome where CYDV RPV and CYDV RPS differ most (Miller et al. 2002). The primers CYDV RPS1L (GAGGAATCCAGATTCGCAGCTT)/ CYDV RPS1R (GCGTACCAAAAGTCCACCTCAA) targeted the P0 gene, while CYDV RPS2L (TTCGAACTGCGCGTATTGTTTG)/ CYDV RPS2R (TACTTGGGAGAGGTTAGTCCGG) and CYDV RPS3L (GGTAAGACTCTGCTTGGCGTAC)/ CYDV RPS3R (TGAGGGGAGAGTTTTCCAACCT) targeted two different regions of the RdRp gene. Sample 226W tested positive using all three sets of primers and the amplicons were directly sequenced. NCBI BLASTn and BLASTx analyses showed that the CYDV RPS1 amplicon (Accession No. OQ417707) shared 97% nucleotide (nt) identity and 98% amino acid (aa) identity similarity with the CYDV RPS isolate SW (Accession No. LC589964) from South Korea, while the CYDV RPS2 amplicon (Accession No. OQ417708) shared 96% nt identity and 98% aa identity similarity with the same CYDV RPS isolate SW. The CYDV RPS3 amplicon (Accession No. OQ417709) shared 96% nt identity and 97% aa identity similarity with the CYDV RPS isolate Olustvere1-O (Accession No. MK012664) from Estonia, confirming that isolate 226W is CYDV RPS. In addition, total RNA extracted from 13 plant samples that had previously tested positive for CYDV RPV by TBIA were tested for CYDV RPS using the primers CYDV RPS1 L/R and CYDV RPS3 L/R. The additional samples, consisting of wheat (n=8), wild oat (Avena fatua, n=3) and brome grass (Bromus sp., n=2), were collected at the same time as sample 226W from seven fields within the same region. Five of the wheat samples were collected from the same field as sample 226W, one of which tested positive for CYDV RPS while the remaining 12 samples were negative. To the best of our knowledge, this is the first report of CYDV RPS in Australia. It is not known if CYDV RPS is a recent introduction to Australia, and its incidence and distribution in cereals and grasses in Australia, while currently unknown, is being investigated.

ANTIMICROBIAL ACTIVITY OF SOIL BACILLI AGAINST PHYTOPATHOGENIC MICROORGANISMS ISOLATED FROM AFFECTED CEREAL PLANTS

Aim of this study was to investigate the antagonistic effect of bacilli isolated from the surface of plants and the rhizosphere zone of the soil against pathogens of barley and wheat diseases. Materials and methods. The material for the study was affected barley and wheat samples used to isolate phytopathogenic microorganisms, as well as samples of healthy plants and the rhizosphere soil zone used to isolate bacteria of the genus Bacillus. Manipulations for the isolation and investigation the biological properties of both phytopathogens and bacilli were carried out by traditional microbiological methods. The antagonistic activity of the isolated strains of bacilli against phytopathogens was studied by the block method. Results. From samples of affected wheat and barley were isolated microorganisms identified on the basis of the studied biological properties as Fusarium oxysporum, Sclerotinia sclerotiorum, Xanthomonas arboricola and Pectobacterium carotovorum. The largest proportion of strains was represented by the micromycete Fusarium oxysporum – 53.9%. From samples of the rhizosphere soil zone and leaf-stem mass of healthy wheat and barley plants, 86 strains of bacteria of the genus Bacillus were isolated by microbiological methods. Antagonistic activity was inherent in 54 strains of bacilli against 25% of phytopathogens. All pathogenic microorganisms were inhibited with different intensity by 14 strains of bacilli. Conclusion. The most active bacillus strains (Bacillus spp. 6, 9, 13, 21, 50) were selected for further research.

Investigation of Fusarium damage in wheat using hyperspectral imaging: An independent component analysis approach

With the continuously growing world population in the 21st century, the agri-food industry is in dire need of adopting rapid, eco-friendly, and reliable technologies to improve the quantity, quality, and safety of agri-food products to fulfill the world's future food needs. Hyperspectral imaging (HSI), a technique to glean a sample's spectral and spatial information, is an emerging non-destructive technique that can characterize the quality parameters of agri-food products such as Fusarium damage. Despite its vast potential, HSI systems suffer from enormous data sizes, requiring high computational time and power. One potential solution to overcome the aforementioned challenge is to reduce the data size by removing redundant information. However, detecting small optimum features from a large dataset is not trivial. To this end, an exploratory novel HSI data reduction and analysis technique was investigated and validated to identify Fusarium damage in wheat kernels. Wheat samples at three moisture contents (19, 27, and 35%, wet basis) and seven infection levels (ranging from 0 to 56 days after infection) were imaged at 256 equally spaced wavelengths from 820 to 1666 nm. Firstly, complete HSI data was utilized to successfully characterize sound and Fusarium-damaged wheat kernels using independent component analysis (ICA) algorithm. Then, a genetic algorithm optimization approach was used to reduce the data to ten wavelengths for ICA-based analysis. This data reduction approach reduced the computation time to approximately 1.31% of the original time taken for analyzing the full HSI data without compromising the performance of the system. This preliminary study suggests that such wavelength tailoring could reduce the complexity and price of the imaging hardware, e.g., the use of inexpensive non-tunable filters, and less expensive computational hardware, thereby enabling fast and affordable real-time exploration and sorting of grains. This study, while exploratory, fosters advancements in HSI data processing and identifies certain limitations that open new avenues for future research.

Effects of region, genotype, harvest year and their interactions on volatile organic compounds in wheat kernels

The effects of region, genotype, harvest year, and their interaction were evaluated in relation to volatile organic compounds (VOCs) in wheat kernels. The study provides a theoretical basis for wheat authentication. A total of 148 wheat samples with 10 genotypes (G) from three regions (R) across 2011/2012, 2012/2013, 2013/2014, 2014/2015, 2015/2016 (Y) were collected, and the VOCs were analyzed by gas chromatography-ion mobility spectrometry (GC-IMS). The results showed that R, G, and Y all significantly affected the VOCs of wheat. Y significantly influenced 23 VOCs such as Dihydro-2(3h)-furanone (78.41%) and Pentan-1-ol (66.06%), and G significantly influenced Butanal (23.59%). Additionally, the linear discriminant analysis (LDA) analysis method results showed that the overall correct classification of the five harvest years was 98%, whereas the correct rate of distinguishing ten genotypes was only 27.00%. Under the interaction effects of multiple factors, the overall correct classification rate for identifying wheat from three regions was 54.10%.

Alternatives to incandescent bulbs in Berlese funnels for detecting stored-product beetles in grain

We conducted a study to find alternative bulbs to use with Berlese funnels as a replacement for incandescent bulbs following widespread bans on their production and use. To do this, we measured the mean percent-recovery of adults and larvae of common stored-product beetles from 1-kg samples of wheat (12.5–14.5% moisture content) after 6 h using A19-style halogen bulbs and ceramic heat lamps, and compared them to recoveries using incandescent bulbs. We found that the 72W halogen bulb performed similarly to the incandescent bulb for all four species tested. Using this bulb, we recovered, on average, >85% of adult Cryptolestes ferrugineus, Rhyzopertha dominica, and adult and larval Tribolium castaneum, as well as >70% of adult Sitophilus oryzae. Recovery of adult beetles using the heat lamp was similar to the incandescent bulb, but recovery of larval T. castaneum was significantly lower. The 43W and 53W halogens had significantly lower recovery rates compared to the incandescent bulb for adult C. ferrugineus (both bulbs) and adult and larval T. castaneum (43W halogen). Average recovery of larval C. ferrugineus was low for all bulbs (<70%). Grain moisture content did not influence average recovery across species or life stages. We also investigated whether an operating time shorter than 6 h could be used with an alternative bulb, but found that 6 h was still the minimum time required to maximize adult and larval recovery. We recommend using 72W A19 style halogen bulbs in place of incandescent bulbs because they have similar recovery rates as the incandescent bulb, and are cost-effective compared to ceramic heat lamps. However, some systems may not be able to handle the increase in power consumption and so we suggest assessing the system before running a full bank of lights.

Incidence of Aflatoxins and Ochratoxin A in Wheat and Corn from Albania.

In this study, aflatoxins (AFs) and ochratoxin A (OTA) were analyzed in grains, specifically wheat and corn, from Albania. To summarize, 71 wheat and 45 corn samples from different growing areas were collected. The multi-toxin analytical procedure involved sample extraction and liquid chromatography-tandem mass spectrometry (LC-MS/MS). The incidence of AF was 18% in the analyzed wheat and 71% in the corn samples. The concentration of AFs was much higher in the corn samples than in the wheat samples. The maximum permitted levels for aflatoxin B1 (AFB1) and total AFs were not exceeded in the wheat samples, while they were exceeded in 36% of the corn samples. In the wheat samples, the AFB1 concentration varied between 0.2 and 0.4 µg kg-1. However, the highest concentrations in the corn samples were 2057, 2944, and 3550 µg kg-1. OTA was present in only three corn samples and one wheat sample. However, all contaminated samples exceeded the maximum permitted levels. This report reveals the presence of AFs and OTA in grain commodities, specifically wheat and corn, grown in Albania.

Estimation of grain resistance of various wheat types to corn bug Eurygaster L. (Hemiptera, Scutelleridae)

In Russia wheat is a strategically important food and export grain crop, but despite the expansion of sown areas and the growth of gross yields, yield quality remains low. A significant decrease in the quantitative and qualitative characteristics of the wheat grain productivity is caused by corn bug Eurygaster L. Planting resistant varieties is one of the most environmentally friendly and effective ways to reduce the number and harmfulness of corn bug. Unfortunately, modern wheat varieties are often not characterized by corn bug resistance, although this is of paramount importance for grain production and breeding programs. The purpose of the current study was to compare the damage caused by corn bugs to grain of different wheat types and varieties. In accordance with GOST 33538-2015 “Plant protection. Methods for identifying and accounting for damaged grains by corn bug”, there has been conducted an estimation of wheat samples for their damage by corn bug. There has been shown that corn bug Eurygaster L. equally damages grain of different wheat types, varieties, and forms. Among the 108 studied wheat varieties, only 16 varieties were characterized by a low degree of grain damage. Absolutely resistant varieties to damage by corn bug have not been identified. The least mean grain damage by corn bug was found in such varieties (up to 5.0 %) as ‘Utrish’, ‘Yunion’, ‘Altaiskaya zhnitsa’. There has been established that the largest number of grain samples slightly damaged by corn bug was found among spring durum wheat varieties (up to 50.0 %). There has been determined that under different agroclimatic conditions of cultivation, the most studied wheat samples had the same level of grain damage by corn bug.

Suspect and nontarget screening of mycotoxins and their modified forms in wheat products based on ultrahigh-performance liquid chromatography-high resolution mass spectrometry

Various forms of mycotoxins commonly exist in food and pose a significant risk to human health. Here a comprehensive suspect and nontarget screening strategy for both parent and modified mycotoxins was developed using ultrahigh-performance liquid chromatography-high resolution mass spectrometry (UHPLCHRMS). We constructed an in-house MS/MS database containing 82 mycotoxins in 8 categories. Then fragmentation characteristics of different classes of mycotoxins were rapidly extracted by a Python program “Fragmentation pattern screener (FPScreener)” and nontarget screening rules were determined by analyzing the frequencies and average intensities of fragmentation characteristics. Using the suspect and nontarget screening strategy, we successfully identified six parent mycotoxins and eight modified mycotoxins with different confidence levels in contaminated wheat and flour samples. This strategy enables screening of unknown parents and modified mycotoxins in food matrices with corresponding fragmentation characteristics.