Waxy Gene Research Articles

The Zea mays mutants opaque2 and opaque16 disclose lysine change in waxy maize as revealed by RNA-Seq

In maize, opaque2 (o2) and opaque16 (o16) alleles can increase lysine content, while the waxy (wx) gene can enhance the amylopectin content of grains. In our study, o2 and o16 alleles were backcrossed into waxy maize line (wxwx). The o2o2o16o16wxwx lines had amylopectin contents similar to those of waxy line. Their nutritional value was better than waxy line, but the mechanism by which the o2 and o16 alleles increased the lysine content of waxy maize remained unclear. The o2o2o16o16wxwx lines and their parents on kernels (18th day after pollination) were subjected to RNA sequencing (RNA-Seq). The RNA-Seq analysis revealed 272 differentially expressed genes (DEGs). Functional analyses revealed that these DEGs were mainly related to biomass metabolism. Among them, in o2o2o16o16wxwx lines, 15 genes encoding α-zein were down-regulated, which resulted in the reduction of α-zein synthesis and increased lysine content; lkr/sdh1 and Zm00001d020984.1 genes involved in the lysine degradation pathway were down-regulated, thereby inhibited lysine degradation; sh2, bt2 and ae1 genes involved in starch metabolism were upregulated, leaded to wrinkling kernel and farinaceous endosperm. Our transcriptional-level identification of key genes responsible for increased grain lysine content and farinaceous endosperm formation following introgression of o2 and o16 alleles should promote molecular breeding for maize quality.

Mapping quantitative traits for grain physical and textural quality in Cambodian Jasmine rice PRD

Grain physical and textural traits are key parameters that are assessed in rice quality improvement programs. In order to dissect the genetic basis of the premium Cambodian quality rice Phka Rumduol (PRD), a population including more than 300 recombinant inbred lines derived from PRD and Thmar Krem was used to map quantitative trait loci (QTLs) for grain length (GL), grain width (GW), degree of chalkiness, grain translucency and texture-associated traits including amylose content (AC), gelatinisation temperature (GT), gel consistency and pasting properties derived from a rapid visco analyser. QTL analysis revealed large-effect QTLs and minor QTLs for these traits of quality, indicating a complex interplay between major and minor genes. The QTL located on chromosome 3 is the major locus for GL, and the one on chromosome 5 plays a major role in determining GW. A novel QTL for GL was identified on the short arm of chromosome 6 and explained about 20% of the phenotypic variation in GL. Grain translucency and chalkiness were largely controlled by QTLs on chromosome 5 and 6. Putative genes for texture-associated traits relate back to the starch biosynthesis pathways. Major QTLs for AC and GT colocalised to the Waxy and starch synthase IIa genes on chromosome 6, respectively. Minor QTLs on chromosomes 3 and 8 were identified for AC, setback, peak viscosity and hot-paste consistency, and on chromosomes 4 and 7 for GT and pasting temperature. This is the first QTL mapping study for the quality of Cambodian rice.

The qSAC3 locus from indica rice effectively increases amylose content under a variety of conditions

BackgroundAmylose content (AC) is a critical factor for the quality of rice. It is determined by the biosynthesis gene Waxy (Wx) and a variety of quantitative trait loci (QTLs). Although many QTLs have been reported to affect rice AC, few of them have been investigated under varying growth conditions, especially various temperatures, which are known to greatly influence the AC.ResultsWe analyzed the AC at different temperatures and planting seasons in a set of chromosome segment substitution lines (CSSLs) which were derived from a cross between the indica variety 9311 and the japonica variety Nipponbare carrying the same Wxb allele. A joint analysis detected a single locus, qSAC3, with a high logarithm of odds (LOD) score in four different conditions. The qSAC3 from indica 9311 (qSAC3ind) substantially increased the AC in japonica Nipponbare under all tested growth conditions. Furthermore, introducing the qSAC3ind into the soft rice variety Nangeng9108 with Wxmq, a mutant allele of Wxb, also moderately increased its AC and improved its appearance quality significantly by reducing the chalkiness of the polished rice.ConclusionsOur results indicate that the qSAC3ind could increase the AC of japonica rice in different environments as well as in the background of different Wx alleles and that qSAC3 is a valuable locus for fine-tuning the rice AC and ameliorating the dull endosperm in rice varieties with the Wxmq allele.

Wxlv, the Ancestral Allele of Rice Waxy Gene

In rice grains, the Waxy (Wx) gene is responsible for the synthesis of amylose, the most important determinant for eating and cooking quality. The effects of several Wx alleles on amylose content and the taste of cooked rice have been elucidated. However, the relationship between artificial selection and the evolution of various Wx alleles as well as their distribution remain unclear. Here we report the identification of an ancestral allele, Wxlv, which dramatically affects the mouthfeel of rice grains by modulating the size of amylose molecules. We demonstrated that Wxlv originated directly from wild rice, and the three major Wx alleles in cultivated rice (Wxb, Wxa, and Wxin) differentiated after the substitution of one base pair at the functional sites. These data indicate that the Wxlv allele played an important role in artificial selection and domestication. The findings also shed light on the evolution of various Wx alleles, which have greatly contributed to improving the eating and cooking quality of rice.

A single-base change at a splice site in Wx-A1 caused incorrect RNA splicing and gene inactivation in a wheat EMS mutant line.

An EMS-induced single-base mutation at a splice site caused abnormal RNA splicing and resulted in the gene inactivation and the lack of Wx-A1 protein in a wheat EMS mutant line. An EMS-mutagenized population was generated using common wheat cv. SM126 consisting of 10,600 M2 plants. One Wx-A1 null mutant was identified through analyses of 390 grains produced from 130 M2 plants using electrophoresis analyses. The Wx-A1 sequences of parental line SM126 and M2-31 mutant were determined as 2781bp, and there was only one SNP mutation between them. The SNP was a mutation from G to A at nucleotide sequence position 2168bp (G2168A) downstream of the start codon which was located at the splicing site within the eighth intron. All 52 cDNA transcripts were found to be incorrectly spliced and can be summarized as five types of variations. The deletion of the exon and the exclusion of intron were structural features in abnormal splicing RNA. Together with the prediction of potential splice regulatory motifs, the mutation G2168A happened within the 5' splice site of the eighth intron and destroyed the splice donor site from GU to AU, which may have brought about a barrier against correct RNA splice, and generated abnormal mRNA, which was the mechanism of the inactivation of Wx-A1 in M2-31. The lack of Wx-A1 has resulted in changes in starch properties in the M2-31 mutant, with the reduction in amylose and starch contents. The increased grains hardness was observed in M2-31, which may be related to the lower expression level of Pinb-D1 gene. As the waxy wheat foods have a lot of advantages, the null waxy genes will be widely applied in breeding waxy wheat for varied amylose contents.

A mutation in Waxy gene affects amylose content, starch granules and kernel characteristics of barley (Hordeum vulgare)

AbstractWaxy barley referred to as low‐amylose or amylose‐free has special advantages in nutrition composition and food processing. Waxy gene encoding granule–bound starch synthase I (GBSSI) is responsible for amylose synthesis in barley. The G3935‐to‐T in Waxy gene has been previously found in amylose–free barley. In this study, G3935‐to‐T was proved to co‐segregate with the waxy phenotype of barley, but has no obvious effect on GBSSI catalytic activity and starch chain length distribution. However, recombinant inbred lines with G3935‐to‐T in Waxy gene are of significant modification in starch granules morphology and pasting properties, increase of grain β‐glucan content, and decrease of thousand kernel weight along with lower kernel width. A polymerase chain reaction with confronting two–pair primers marker was developed for economic and efficient screening of G3935‐to‐T. This study provides the basis for cultivar improvement of waxy barley then fully developing its potential value and utility in food processing.

New Waxy allele wx-Reina found in Chinese waxy maize

Waxy gene mutations cause the stickiness of maize grains. China is rich in waxy maize landraces and is considered to be the origin of waxy maize. At present, the Waxy alleles found in Chinese waxy maize include wx-D7, wx-D10, wx-Cin4, and wx-124, of which wx-Cin4 and wx-124 are characterized as transposon insertion mutations. The Yunnan area has the most abundant Chinese waxy maize; however, there are still a large number of waxy maize landraces with unknown Waxy alleles. In this study, 20 waxy maize landraces from Yunnan Province of China were used as research materials for waxy gene analysis, and a new Waxy allele was detected. Molecularly, this allele is characterized by an ~ 5.4-Kb retrotransposon Reina inserted in the tenth intron of the Waxy gene, and we named this allele wx-Reina. Reina is a member of the long terminal repeat (LTR) retrotransposon family. This Reina transposon has the same LTR sequence at both ends, so this mutation is a newly formed mutation. Through reverse transcription PCR (RT-PCR) analysis, we found that Reina insertion results in the deletion of exons 10 and 11 in the transcript of wx-Reina, so its original gene function is lost. The discovery of wx-Reina further enriches the knowledge of types of waxy alleles in Chinese waxy maize. Combined with our previous studies, we believe that transposon activity is one of the main driving forces for the formation of Waxy gene alleles in Chinese waxy maize.

Production of Two Elite Glutinous Rice Varieties by Editing Wx Gene

The waxy gene (Wx) in rice, which encodes the granule bound starch synthase enzyme, is responsible for amylose synthesis. Glutinous (sticky) rice has little or no amylose that can be used in various applications, such as brewing. In this study, knockout of the Wx gene with CRISPR/Cas9 technology was conducted in two elite japonica rice lines, Huaidao 5 (HD5) and Suken 118 (SK118), aiming to develop elite sticky rice varieties. We achieved six homozygous T0 plants with more than 200bp deletion in the Wx gene, as well as 36 wx-HD5 and 18 wx-SK118 homozygous transgene-free plants in the T1 generation. The seeds of all the mutants were white and opaque, similar to those of sticky rice, and contained only 2.6%–3.2% amylose. Results of scanning electron microscopy showed that the quality of rice did not change. In conclusion, we successfully developed two elite sticky rice varieties.

Three Major Nucleotide Polymorphisms in the Waxy Gene Correlated with the Amounts of Extra-long Chains of Amylopectin in Rice Cultivars with S or L-type Amylopectin.

Extra-long chains (ELC) of amylopectin in rice endosperm are synthesized by granule-bound starch synthase I encoded by the Waxy (Wx) gene, which primarily synthesizes amylose. Previous studies showed that single nucleotide polymorphisms (SNP) in intron 1 and exon 6 of the Wx gene influences ELC amount. However, whether these SNPs are conserved among rice cultivars and if any other SNPs are present in the Wx gene remained unknown. Here, we sequenced the Wx gene from 17 rice cultivars with S or L-type amylopectin, including those with known ELC content and those originating in China with unique starch properties, as well as typical japonica and indica cultivars. In addition to the two SNPs described above, an additional SNP correlating with ELC content was found in exon 10. Low ELC cultivars (<3.0 %) had thymine at the splicing donor site of intron 1, Tyr224 in exon 6, and Pro415 in exon 10. Cultivars with moderate ELC content (4.1–6.9 %) had guanine at the splicing donor site of intron 1, Ser224 in exon 6, and Pro415 in exon 10. Cultivars with high ELC content (7.7–13.9 %) had guanine at the splicing donor site of intron 1, Tyr224 in exon 6, and Ser415 in exon 10. The chain length distribution pattern of amylopectin was correlated with the amounts of SSIIa found in starch granules and gelatinization temperature, but not with ELC content. The combinations of SNPs in the Wx gene found in this study may provide useful information for screening specific cultivars with different ELC content.

Screening of the genotypes of bread wheat (Triticum aestivum L.) by the allelic variants of Waxy genes and HMW glutenin subunits

Screening genotypes of wheat by allelic variants of &lt;em&gt;Waxy&lt;/em&gt; and &lt;em&gt;HMW-GS&lt;/em&gt; genes is a constitutional unit of marker-assisted selection of varieties with high values of desirable properties for flour-baking and technological attributes of the grain. The aim of the study was to produce a molecular screening of samples of spring soft wheat of local selection lines for the detection of genotypes of &lt;em&gt;Triticum aestivum&lt;/em&gt; L. with valuable alleles of &lt;em&gt;Waxy&lt;/em&gt; and &lt;em&gt;HMW-GS&lt;/em&gt; genes. Seventy samples of wheat were subjected to DNA testing for the identification of genotypes with alleles of &lt;em&gt;Waxy&lt;/em&gt; and &lt;em&gt;HMW-GS&lt;/em&gt; genes. Molecular screening of wheat samples with the selected systems of molecular marking of the allelic variants of the analyzed genes made it possible to detect three partially Waxy lines with a combination of two null-alleles (&lt;em&gt;Wx-A1b&lt;/em&gt; and &lt;em&gt;Wx-B1b&lt;/em&gt;) in the study collection, as well as 33 plants with an economically-valuable combination of Ax2*/5+10 subunits of &lt;em&gt;HMW-GS&lt;/em&gt;, the genotypes of which are considered as starting material for further selection work on the creation of spring soft wheat cultivars with high quality indicators of grain. The approaches applied in the study to identify &lt;em&gt;Waxy&lt;/em&gt; and &lt;em&gt;HMW-GS&lt;/em&gt; alleles are effective methods of evaluating their allelic polymorphism.

TILL-D: An Aegilops tauschii TILLING Resource for Wheat Improvement.

Aegilops tauschii (2n = 2x = 14, genome DD), also known as Tausch’s goatgrass, is the D genome donor of bread or hexaploid wheat Triticum aestivum (2n = 2x = 42, AABBDD genome). It is a rich reservoir of useful genes for biotic and abiotic stress tolerance for wheat improvement. We developed a TILLING (Targeting Induced Local Lesions In Genomes) resource for Ae. tauschii for discovery and validation of useful genes in the D genome of wheat. The population, referred to as TILL-D, was developed with ethyl methanesulfonate (EMS) mutagen. The survival rate in M1 generation was 73%, out of which 22% plants were sterile. In the M2 generation 25% of the planted seeds showed phenotypic mutations such as albinos, chlorinas, no germination, variegated, sterile and partially fertile events, and 2,656 produced fertile M2 plants. The waxy gene was used to calculate the mutation frequency (1/70 kb) of the developed population, which was found to be higher than known mutation frequencies for diploid plants (1/89–1/1000 kb), but lower than that for a polyploid species (1/24–1/51 kb). The TILL-D resource, together with the newly published Ae. tauschii reference genome sequence, will facilitate gene discoveries and validations of agronomically important traits and their eventual fine transfer in bread wheat.

Rice Soluble Starch Synthase I: Allelic Variation, Expression, Function, and Interaction With Waxy.

Starch, which is composed of amylose and amylopectin, is the key determinant of rice quality. Amylose is regulated by the Waxy (Wx) gene, whereas amylopectin is coordinated by various enzymes including eight soluble starch synthases (SSSs), of which SSSI accounts for ∼70% of the total SSS activity in cereal endosperm. Although great progress has been made in understanding SSSI gene expression and function, allelic variation and its effects on gene expression, rice physicochemical properties and qualities, and interactions with the Wx gene remain unclear. Herein, SSSI nucleotide polymorphisms were analyzed in 165 rice varieties using five distinct molecular markers, three of which reside in an SSSI promoter and might account for a higher expression of the SSSIi allele in indica ssp. than of the SSSIj allele in japonica ssp. The results of SSSI promoter-Beta-Glucuronidase (β-GUS) analysis were consistent with the expression results. Moreover, analysis of near isogenic lines (NILs) in the Nipponbare (Nip) background showed that Nip (SSSIi) and Nip (SSSIj) differed in their thermal properties, gel consistency (GC), and granule crystal structure. Knockdown of SSSI expression using the SSSI-RNA interference (RNAi) construct in both japonica and indica backgrounds caused consistent changes in most tested physicochemical characteristics except GC. Moreover, taste value analysis (TVA) showed that introduction of the SSSI allele in indica or knockdown of SSSI expression in japonica cultivars significantly reduced the comprehensive taste value, which was consistent with the superior taste of japonica against indica. Furthermore, to test the potential interaction between SSSI and different Wx alleles, three NILs within the Wx locus were generated in the indica cv. Longtefu (LTF) background, which were designated as LTF (Wxa), LTF (Wxb), and LTF (wx). The SSSI-RNAi construct was also introduced into these three NILs, and physiochemical analysis confirmed that the knockdown of SSSI significantly increased the rice apparent amylose content (AAC) only in the Wxa and Wxb background and caused different changes in GC in the NILs. Therefore, the effect of SSSI variation on rice quality also depends on its crosstalk with other factors, especially the Wx gene. These findings provide fundamental knowledge for future breeding of rice with premium eating and cooking qualities.

Identification of some nucleotide mutations in Waxy gene (BGIOSGA022241) of a mutant rice line

Waxy genes of the original variety and its mutant type were sequenced by Sanger method and compared through Nucleotide Basic Local Alignment Search Tool (BLASTN) to clarify differences. BLASTN result showed four nucleotide mutations in coding regions and 59 nucleotide mutations in noncoding regions. Four point mutations in coding regions were: the deletion of T/- at position 34 and the insertion of -/T between positions 70 and 71 in exon 3; the substitution of C/T at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9. In 59 mutant nucleotides in non-coding regions, some significant alterations were list: the deletion of nucleotide G at the first of intron 6 and the addition of 32 nucleotides “GGGCCTGCGAAGAACTGGGAGAATGTGCTCCT” at the end of intron 12. For the first trial, a new DNA marker was developed based on the mutation C/T at at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9 to improve efficiency of rice breeding relevant to Waxy gene.

SSR loci potentially associated with high amylopectine content in maize kernel endosperm

As a component of functional nutrition, maize cultivars with “non-traditional” kernel composition (waxy, oilbearing, sugar, opaque, etc. phenotypic variants) are promising. Mutations in the waxy gene, which break down the structure and function of the enzyme for amylose biosynthesis, lead to a waxy (with a high content of amylopectin) endosperm formation. High variability of the waxy gene limits the use of microsatellite loci in marker associated selection of waxy maize genotypes. The increased frequency of gene rearrangements within the waxy locus facilitated the origination of many high-amylopectin corn lines carrying different SSR allelic variants. The purpose of this study was to evaluate the effectiveness of using waxy locus microsatellite sequences for identification and labeling of waxy maize genotypes. To this end, a complex of biochemical (calorimetry, bichromate method), molecular-genetic (SSR-PCR, capillary gel electrophoresis with fluorescent detection of fragments) and statistical (descriptive statistics, cluster analysis, χ2) analysis methods was used. Plant material used were 33 samples of corn kernels including mutant forms with a high content of amylose, amylopectin, short-chain starches, were kindly provided by VIR genetic collection (Russian Federation) and Maize Genetics Cooperation Stock Center (USA). The contents of starch, short-chain soluble carbohydrates, amylose, amylopectin in the grain of 33 maize samples were evaluated. Compositionally similar (to endosperm carbohydrates content) groups of samples were identified. They include 13 high-amylopectin samples carriers of waxy (wx) gene mutations and 20 samples with wild-type character (Wx). Molecular genetic screening of the collection included an analysis of the polymorphism of the microsatellite loci phi022, phi027, phi061 associated with the waxy gene sequence. Allelic composition of individual loci and their combinations were analyzed in relation to the accumulation of reserve carbohydrates in the kernel endosperm. Only the analysis of the phi022/phi027 combination or all three markers in the complex allows differentiating the wild Wx and mutant wx phenotypes of maize. It was shown that not the individual allelic polymorphisms of the phi022, phi027, phi061 loci are efficient for the markerassociated selection of high-amylopectin maize, but their unique combinations.

Cover Image: Glutinous rice generated by CRISPR/Cas9

Glutinous rice provides a unique characteristic for numerous food and non‐food applications. In this issue, Zhang et al. (pp. 369–375) show that CRISPR/Cas9‐mediated mutations in the Waxy gene convert normal rice to glutinous one without affecting other agronomic traits, offering an effective and easy way to expand genetic resources in crops.

Waxy allelic diversity in common millet (Panicum miliaceum L.) in China

A set of 132 accessions of common millet, Panicum miliaceum L., from 12 provinces of China were assessed for endosperm starch type (waxy or non-waxy) using I2-KI staining, amylose and amylopectin contents using the dual-wavelength colorimetric method, and genotype of Waxy genes conditioning amylose content by gene sequencing. Endosperm starch content varied from 57.69% to 74.70%, while the amylose and amylopectin contents of the starch ranged from 0 to 23.29% and from 41.99% to 70.24%, respectively. Sequencing two Wx genes, including Wx-L (intron 5-exon 7 and intron 8–9) and Wx-S (exon 9–intron 10) revealed several polymorphisms (S0, S−15, LC, LF, LY). Marker M5-R11 linking to the Wx-S gene may be used to discriminate waxy common millet accessions from non-waxy ones. Among the 132 accessions, 68 with the S−15 allele had waxy endosperm starch with the amylose content range 0–2.58% and 64 accessions with the S0 allele had non-waxy endosperm starch with amylose content range 3.94%–23.29%. Five genotypes including S−15/LF (45% of the accessions), S0/LF (25%), S0/LY (12%), S0/LC (11%), and S−15/LY (7%) were identified. Six new SNPs were detected at the Wx-L locus. These results will facilitate common millet breeding, especially of cultivars free of amylose.

A perfect functional marker for the gene of intermediate amylose content Wx-in in rice (Oryza sativa L.)

Abstract The amylose content (AC) of rice is a key determinant of the grain cooking and eating quality. The Waxy (Wx) gene, which encodes granule-bound starch synthase I (GBSSI), is the major gene controlling AC in rice. The A - C substitution in exon 6 (Ex6A/C) alters the amino acid codon from serine to tyrosine and is associated with intermediate-AC rice (Wx-in). In this paper, we reported a perfect functional marker for the SNP Ex6A/C of Wx-in based on polymerase chain reaction with confronting two-pair primers (PCR-CTPP) in a single-tube PCR assay. Specificity and applicability of the PCR assay were verified in a Chinese mini core collection (MCC) of Oryza sativa L. and a breeding population. Were commend the use of the simple, inexpensive assay for routine genotyping for intermediate AC in the breeding population or discrimination of Wx-in genotypes in rice germplasm.

&lt;i&gt;In silico&lt;/i&gt; promoter analysis reveals rice &lt;i&gt;Wx&lt;/i&gt; promoter could be a TATA-less promoter with a putative pyrimidine rich region

Rice waxy gene is one of the major genes, which determines the amylose content of a rice grain. The expression of this gene is regulated by various stimuli such as temperature, light, drought and diseases. Promoter region of a gene is responsible for changing the level of expression with the help of transcription factors and their binding sites, cis-acting regulatory elements found in the promoter region ranging from 2000 bp upstream and 500 bp downstream relative to the transcription start site. Present study investigated the putative transcription factor binding sites in the promoter region and possible expression regulation stimuli using five Sri Lankan rice varieties, two glutinous rice varieties, Arabidopsis thaliana and potato. The promoter regions of the plants were extracted either after mapping selected varieties from rice 3000 genome project or from promoter databases. Signal scan was carried out to capture putative signal sequences, and kappa incidence of coincidence vs guanine cytosine content, guanine cytosine skew, and multiple sequence alignment were also performed. The results revealed that rice Wx promoter could be a TATA-less promoter with a putative pyrimidine patch, and categorized under ATCG middle class of promoters. The possible transcription regulation stimuli of waxy gene include dehydration, light, temperature, and hormones. There were signal sequences related to mesophyll, root nodule, seed and root specific regulation of expression.

In-Silico Identification of EST Based Microsatellite Markers and Snps, and Comparative Genomic Analysis of Ests in Barnyard Millet for their Omics Applications

Barnyard millet belongs to the family poaceae, having good nutritional properties and is also effective for diabetic patients because of its ability to reduce the blood glucose levels. The research on genomics in barnyard millet lagging behind other millets and cereals, where there is a need of more focus towards identification of microsatellite markers. The availability of EST sequences given possibility to develop and explore the EST based SSRs and SNPs. Hence, the present study was conducted at ICAR-Vivekananda Parvateeya Krishi Anusanthan Sansthan, Almora, Uttarakhand in the year 2014-2015. In the present study, the barnyard millet EST sequences (41) were downloaded in FASTA format to find the microsatellite type, distribution, frequency and developed a total of 22 primer pairs from the ESTs. The most frequent SSR repeats found to be tetra- nucleotide repeats (50 percent) followed by the penta- and hexa- nucleotide repeats. Among the dimeric SSRs, GT was found to be the most common repeat motif, AGG was the most common repeat motif in trimeric repeat motifs. The most common tetra-, penta- and hexa nucleotide repeat motifs were AGA, CAAA, TGTTT, AGACGA respectively. The SNP mining of barnyard millet ESTs found to have 1 potential SNP and 1 reliable SNP and two haplotypes. Comparative analysis of barnyard millet EST sequences with the rice genome database showed that they were homology to the rice chromosomal regions of 2, 5, 6, 8, 9 and 12, however with maize genome showed homology with respect to Zea mays Waxy gene. Thus the identified twenty two microsatellite markers and SNPs can be effectively used for barnyard millet genomics applications to study diversity, and mapping aspects.

The genetic architecture of amylose biosynthesis in maize kernel.

SummaryStarch is the most abundant storage carbohydrate in maize kernel. The content of amylose and amylopectin confers unique properties in food processing and industrial application. Thus, the resurgent interest has been switched to the study of individual amylose or amylopectin rather than total starch, whereas the enzymatic machinery for amylose synthesis remains elusive. We took advantage of the phenotype of amylose content and the genotype of 9,007,194 single nucleotide polymorphisms from 464 inbred maize lines. The genome‐wide association study identified 27 associated loci involving 39 candidate genes that were linked to amylose content including transcription factors, glycosyltransferases, glycosidases, as well as hydrolases. Except the waxy gene that encodes the granule‐bound starch synthase, the remaining candidate genes were located in the upstream pathway of amylose synthesis, while the downstream members were already known from prior studies. The linked candidate genes could be transferred to manipulate amylose content and thus add value to maize kernel in the breeding programme.