Vesca Plants Research Articles

Mitigation strategy of saline stress in Fragaria vesca using natural and synthetic brassinosteroids as biostimulants.

Bassinosteroids (BRs) can induce plant defence responses and promote plant growth. In this work, we evaluated the effect of a natural (EP24) and a synthetic (BB16) brassinosteroid on strawberry (Fragaria vesca ) plants exposed to saline stress. Treated plants showed higher shoot dry weight and root growth compared to untreated control plants. In BR-treated plants, crown diameters increased 66% and 40%, leaf area 148% and 112%, relative water content in leaves 84% and 61%, and SPAD values 24% and 26%, in response to BB16 and EP24, respectively. A marked stomatal closure, increased leaflet lignification, and a decrease in cortex thickness, root diameter and stele radius were also observed in treated plants. Treatments also reduces stress-induced damage, as plants showed a 34% decrease in malondialdehyde content and a lower proline content compared to control plants. A 22% and 15% increase in ascorbate peroxidase and total phenolic compound activities was observed in response to BB16, and a 24% increase in total flavonoid compound in response to both BRs, under stress conditions. These results allow us to propose the use of BRs as an environmentally safe crop management strategy to overcome salinity situations that severely affect crop yield.

Transcriptional profiling of defense responses to Botrytis cinerea infection in leaves of Fragaria vesca plants soil-drenched with β-aminobutyric acid.

Grey mold caused by the necrotrophic fungal pathogen Botrytis cinerea can affect leaves, flowers, and berries of strawberry, causing severe pre- and postharvest damage. The defense elicitor β-aminobutyric acid (BABA) is reported to induce resistance against B. cinerea and many other pathogens in several crop plants. Surprisingly, BABA soil drench of woodland strawberry (Fragaria vesca) plants two days before B. cinerea inoculation caused increased infection in leaf tissues, suggesting that BABA induce systemic susceptibility in F. vesca. To understand the molecular mechanisms involved in B. cinerea susceptibility in leaves of F. vesca plants soil drenched with BABA, we used RNA sequencing to characterize the transcriptional reprogramming 24 h post-inoculation. The number of differentially expressed genes (DEGs) in infected vs. uninfected leaf tissue in BABA-treated plants was 5205 (2237 upregulated and 2968 downregulated). Upregulated genes were involved in pathogen recognition, defense response signaling, and biosynthesis of secondary metabolites (terpenoid and phenylpropanoid pathways), while downregulated genes were involved in photosynthesis and response to auxin. In control plants not treated with BABA, we found a total of 5300 DEGs (2461 upregulated and 2839 downregulated) after infection. Most of these corresponded to those in infected leaves of BABA-treated plants but a small subset of DEGs, including genes involved in 'response to biologic stimulus', 'photosynthesis' and 'chlorophyll biosynthesis and metabolism', differed significantly between treatments and could play a role in the induced susceptibility of BABA-treated plants.

Using transects to disentangle the environmental drivers of plant-microbiome assembly.

Environmental heterogeneity is a major driver of plant‐microbiome assembly, but the specific climate and soil conditions that are involved remain poorly understood. To better understand plant microbiome formation, we examined the bacteria and fungi that colonize wild strawberry (Fragaria vesca) plants in North American and European populations. Using transects as replicates, we found strong overlap among the environmental conditions that best predict the overall similarity and richness of the plant microbiome, including soil nutrients that replicate across continents. Temperature is also among the main predictors of diversity for both bacteria and fungi in both the leaf and, unexpectedly, the root microbiome. Our results indicate that a small number of environmental factors, and their interactions, consistently contribute to plant microbiome formation, which has implications for predicting the contributions of microbes to plant productivity in ever‐changing environments.

Ecological divergence of wild strawberry DNA methylation patterns at distinct spatial scales.

Epigenetic change is considered relatively unstable and short-lived, raising questions of its contribution to long-term adaptive potential. However, epigenetic modifications can accumulate in the presence of environmental stress, resulting in beneficial epigenetic memories where environments are challenging. Diverging epigenetic memories have been observed across large spatial scales, and can persist through multiple generations. It is unknown, however, to what extent epigenetic variation contributes to fine-scale population structure and evolution. We compared DNA methylation patterns between a steep, altitudinal gradient (<2km) and a wide spatial gradient (>500km) using whole genome bisulphite sequencing data from 30 Fragaria vesca plants germinated and grown in controlled conditions. To assess the stability of spatial epigenetic variation in the presence of an environmental stressor, we applied acute drought stress to part of the plants and quantified drought-induced changes in DNA methylation signatures. We find that epigenetic memories and genomic islands of epigenetic divergence arise even at fine spatial scale, and that distinct spatial scales are featured by distinct epigenetic patterns. For example, demethylation of transposable elements consistently occurred at the large but not the fine spatial scale, while methylation differentiation for most biological processes were shared between spatial scales. Acute drought stress did not result in significant epigenetic differentiation. Our results indicate that population history, rather than short-term environmental stress, plays a dominant role in shaping epigenetic signatures. Specifically, repeated historical stress levels associated with heterogeneous environmental conditions may be required for acquiring a stable epigenetic memory and for coping with future environmental change.

In vivo adaptation of regenerant plants of Fragaria vesca L. cultivars

Purpose. The adaptation of regenerant plants to environmental conditions is the final stage of micropropagation. According to a number of authors, when in vitro plants are transferred to in vivo non-sterile conditions, a significant percentage of mortality is recorded. In a previous publication, the regenerative capacity of strawberry (Fragaria vesca L.) in vitro tissues on MS culture medium (Murashige &amp; Skoog, 1962) and a regenerants was obtained (Chornobrov O. Yu., 2019).The objective of the study is to develop an optimal protocol of acclimation of in vitro F. vesca plants to in vivo conditions.Methods. Biotechnological and statistical methods of research were applied. For the research ‘Ruiana’ and ‘Zhovte Dyvo’ cultivars were used with in vitro cultivation cycle of 30–35 days. Prepared plants were planted in 0.33 L plastic contai ners, one piece in a mixture of coconut substrate and perlite (3:1). Plants were kept under high relative humidity (85–90%) conditions for 3–5 days, 6–8 days and 10–14 days. The studies were carried out in the Plant Biotechnology Laboratory of SS of NULES of Ukraine “BFRS” during 2019–2020. Results. The duration of Fragaria vesca regenerant plants exposure in conditions of high relative humidity significantly affected adaptation efficiency. The proportion of ‘Ruiana’ and ‘Zhovte Dyvo’ plants adapted to the greenhouse conditions were 47.6 ± 2.5% and 60.0 ± 1.7%, respectively, when the plants were kept for 10–14 days. A significant efficiency of plant adaptation (more than 70%) was obtained under condition of preliminarily exposure the roots of the plants in an auxin solution for 25–30 minutes with daily application of 30% solution of glycerine as foliar spray. The plants adapted to the greenhouse conditions had pigmentation characteristic of the variety, without signs of chlorosis and vitrification.Conclusions. An optimal protocol for in vitro adaptation of F. vesca cultivars to in vivo conditions was developed and viable plants were obtained. Further research will be aimed at studying the growth and development of F. vesca regenerant plants in open ground.

Molecular and Biological Characterization of a New Strawberry Cytorhabdovirus.

Virus diseases of strawberry present several complex problems. More than 25 viruses have been described in the genus Fragaria thus far. Here, we describe a novel rhabdovirus, tentatively named strawberry virus 1 (StrV-1), that infects F. ananassa and F. vesca plants. Genomic sequences of three distinct StrV-1 genotypes co-infecting a single F. ananassa host were obtained using combined Illumina and Ion Proton high-throughput sequencing. StrV-1 was transmitted to herbaceous plants via Aphis fabae and A. ruborum, further mechanically transmitted to Nicotiana occidentalis 37B and sub-inoculated to N. benthamiana, N. benthamiana DCL2/4i, N. occidentalis 37B, and Physalis floridana plants. Irregular chlorotic sectors on leaf blades and the multiplication of calyx leaves seem to be the diagnostic symptoms for StrV-1 on indexed F. vesca clones. StrV-1 was detected in asymptomatic grafted plants and in 49 out of 159 field strawberry samples via RT-PCR followed by Sanger sequencing. The bacilliform shape of the virions, which have a cytoplasm-limited distribution, their size, and phylogenetic relationships support the assignment of StrV-1 to a distinct species of the genus Cytorhabdovirus. Acyrthosiphon malvae, A. fabae, and A. ruborum were shown to transmit StrV-1 under experimental conditions.

The Arabidopsis ELP3/ELO3 and ELP4/ELO1 genes enhance disease resistance in Fragaria vesca L.

BackgroundPlant immune response is associated with a large-scale transcriptional reprogramming, which is regulated by numerous transcription regulators such as the Elongator complex. Elongator is a multitasking protein complex involved in diverse cellular processes, including histone modification, DNA methylation, and tRNA modification. In recent years, Elongator is emerging as a key regulator of plant immune responses. However, characterization of Elongator’s function in plant immunity has been conducted only in the model plant Arabidopsis thaliana. It is thus unclear whether Elongator’s role in plant immunity is conserved in higher plants. The objective of this study is to characterize transgenic woodland strawberry (Fragaria vesca L.) overexpressing the Arabidopsis Elongator (AtELP) genes, AtELP3 and AtELP4, and to determine whether F. vesca carries a functional Elongator complex.MethodsTransgenic F. vesca and Arabidopsis plants were produced via Agrobacterium-mediated genetic transformation and characterized by morphology, PCR, real-time quantitative PCR, and disease resistance test. The Student’s t test was used to analyze the data.ResultsOverexpression of AtELP3 and AtELP4 in F. vesca impacts plant growth and development and confers enhanced resistance to anthracnose crown rot, powdery mildew, and angular leaf spot, which are caused by the hemibiotrophic fungal pathogen Colletotrichum gloeosporioides, the obligate biotrophic fungal pathogen Podosphaera aphanis, and the hemibiotrophic bacterial pathogen Xanthomonas fragariae, respectively. Moreover, the F. vesca genome encodes all six Elongator subunits by single-copy genes with the exception of FvELP4, which is encoded by two homologous genes, FvELP4–1 and FvELP4–2. We show that FvELP4–1 complemented the Arabidopsis Atelp4/elo1–1 mutant, indicating that FvELP4 is biologically functional.ConclusionsThis is the first report on overexpression of Elongator genes in plants. Our results indicate that the function of Elongator in plant immunity is most likely conserved in F. vesca and suggest that Elongator genes may hold potential for helping mitigate disease severity and reduce the use of fungicides in strawberry industry.

Population genetic analysis of a global collection of Fragaria vesca using microsatellite markers.

The woodland strawberry, Fragaria vesca, holds great promise as a model organism. It not only represents the important Rosaceae family that includes economically important species such as apples, pears, peaches and roses, but it also complements the well-known model organism Arabidopsis thaliana in key areas such as perennial life cycle and the development of fleshy fruit. Analysis of wild populations of A. thaliana has shed light on several important developmental pathways controlling, for example, flowering time and plant growth, suggesting that a similar approach using F. vesca might add to our understanding on the development of rosaceous species and perennials in general. As a first step, 298 F. vesca plants were analyzed using microsatellite markers with the primary aim of analyzing population structure and distribution of genetic diversity. Of the 68 markers tested, 56 were polymorphic, with an average of 4.46 alleles per locus. Our analysis partly confirms previous classification of F. vesca subspecies in North America and suggests two groups within the subsp. bracteata. In addition, F. vesca subsp. vesca forms a single global population with evidence that the Icelandic group is a separate cluster from the main Eurasian population.

Genetic control of day-neutral habit in Fragaria vesca L. (Rosaceae) populations in Western Siberia

In Western Siberia, the Fragaria vesca active flowering occurs in the first ten days of June, while fruiting occurs at the end of June–beginning of July. During the expeditionary surveys of natural Fragaria vesca L. populations in Western Siberia in 2002–2013, we detected cases of re-flowering plant in August–October. The aim of the present work was to study the genetic control of re-flowering emergence in woodland Fragaria vesca populations. The F. vesca specimen from expeditionary collections and seedlings grown from the seeds collected in August–October in natural places of growth of the woodland strawberry were used as the research material. In addition, the genetic analysis of seedlings obtained from the seeds from the self-pollination of specimens of expeditionary collections was carried out. The re-flowering and fruiting was studied in 1486 seedlings obtained from plants with a seasonal fruiting. Representatives of 32 populations from Western Siberia and 856 seedlings from 10 populations were involved in the analysis. The genetic analysis of reflowering Fragaria vesca plants (growing under natural conditions) demonstrated that they are usually homozygous for the dominant allele (seasonal flowering). Demonstration of the F. vesca re-flowering in Western Siberia is considered as a temporary reaction of the plant genotype to the specific growth conditions for the vegetation season. Heterozygous plants for the type of fruiting plants were detected only in a single woodland strawberry population located in the foothills of Kuznetsk Alatau. The type of segregation in the progeny from the self-pollination of the plants from this population indicates that the day neutrality is monofactorially controlled with a recessive type of inheritance and has the same nature of origin as in Alpine F. vesca populations.

Development of an efficient transformation method by Agrobacterium tumefaciens and high throughput spray assay to identify transgenic plants for woodland strawberry (Fragaria vesca) using NPTII selection

KEY MESSAGE : We developed an efficient Agrobacterium -mediated transformation method using an Ac/Ds transposon tagging construct for F. vesca and high throughput paromomycin spray assay to identify its transformants for strawberry functional genomics. Genomic resources for Rosaceae species are now readily available, including the Fragaria vesca genome, EST sequences, markers, linkage maps, and physical maps. The Rosaceae Genomic Executive Committee has promoted strawberry as a translational genomics model due to its unique biological features and transformability for fruit trait improvement. Our overall research goal is to use functional genomic and metabolic approaches to pursue high throughput gene discovery in the diploid woodland strawberry. F. vesca offers several advantages of a fleshy fruit typical of most fruit crops, short life cycle (seed to seed in 12-16weeks), small genome size (206Mbb/C), small plant size, self-compatibility, and many seeds per plant. We have developed an efficient Agrobacterium tumefaciens-mediated strawberry transformation method using kanamycin selection, and high throughput paromomycin spray assay to efficiently identify transgenic strawberry plants. Using our kanamycin transformation method, we were able to produce up to 98 independent kanamycin resistant insertional mutant lines using a T-DNA construct carrying an Ac/Ds transposon Launchpad system from a single transformation experiment involving inoculation of 22 leaf explants of F. vesca accession 551572 within approx. 11weeks (from inoculation to soil). Transgenic plants with 1-2 copies of a transgene were confirmed by Southern blot analysis. Using our paromomycin spray assay, transgenic F. vesca plants were rapidly identified within 10days after spraying.

Reduced clonal reproduction indicates low potential for establishment of hybrids between wild and cultivated strawberries (Fragaria vesca × F. × ananassa)

AbstractThe genus Fragaria (Rosaceae) contains 24 species, including hybrid species such as the garden strawberry (Fragaria × ananassa Duch.). Natural hybridization between Fragaria species has repeatedly been reported, and studies on the hybridization potential between F. × ananassa and its wild relatives have become increasingly important with the outlook for genetically modified garden strawberries. In Europe, a candidate species for hybridization with garden strawberries is the common woodland strawberry (Fragaria vesca L.). Although a previous field survey indicated that the potential for hybridization between F. vesca and F. × ananassa is low, it is not clear whether the lack of natural hybrids is caused by known pre‐ and postzygotic barriers, or whether hybrid plants lack the fitness to establish in natural F. vesca populations. We grew different F. vesca and F. vesca × F. × ananassa hybrid clones with and without competition in a greenhouse and assessed biomass production, clonal reproduction, and sexual reproduction of plants. While some hybrid clones exceeded F. vesca in biomass production, general clonal reproduction was much lower and delayed in hybrids. Furthermore, hybrids were sterile. These results demonstrate a mechanism by which the general lack of F. vesca × F. × ananassa hybrids in natural habitats can be explained, in addition to the known low hybridization potential between garden and woodland strawberries. We conclude that hybrids have a competitive disadvantage against co‐occurring F. vesca plants due to inferior and delayed clonal reproduction, and that the potential for hybrid establishment under natural conditions is low.

Searching for gene flow from cultivated to wild strawberries in Central Europe

Experimental crosses between the diploid woodland strawberry (Fragaria vesca L.) and the octoploid garden strawberry (F. × ananassa Duch.) can lead to the formation of viable hybrids. However, the extent of such hybrid formation under natural conditions is unknown, but is of fundamental interest and importance in the light of the potential future cultivation of transgenic strawberries. A hybrid survey was therefore conducted in the surroundings of ten farms in Switzerland and southern Germany, where strawberries have been cultivated for at least 10 years and where wild strawberries occur in the close vicinity. In 2007 and 2008, 370 wild F. vesca plants were sampled at natural populations around farms and analysed with microsatellite markers. In 2010, natural populations were revisited and morphological traits of 3050 F. vesca plants were inspected. DNA contents of cell nuclei of morphologically deviating plants were estimated by flow cytometry to identify hybrids. As controls, 50 hybrid plants from interspecific hand-crosses were analysed using microsatellite analysis and DNA contents of cell nuclei were estimated by flow cytometry. None of the wild samples collected in 2007 and 2008 contained F. × ananassa microsatellite markers, while all hybrids from hand-crosses clearly contained markers of both parent species. Morphological inspection of wild populations carried out in 2010 and subsequent flow cytometry of ten morphologically deviating plants revealed no hybrids. Hybrid formation or hybrid establishment in natural populations in the survey area is at best a rare event.

EVALUATION OF WOOD STRAWBERRY (FRAGARIA VESCA) PRODUCTIVITY

Information about a suitable cropping system and environmental conditions is necessary to grow Fragaria vesca plants for commercial production. This research was conducted to evaluate the growth and productivity of everbearing F. vesca cultivars grown under a forcing culture, semi-forcing culture, and late semi-forcing culture. Results showed that the mean growth rate of the cultivars in the forcing culture was the lowest among these cropping systems. Significant differences were found in the number of harvested fruits, the fruit weight per plant, and the total soluble solids (TSS) among the cultivars in all cropping systems. The number of harvested fruits, the fruit weight per plant, and the total soluble solids were highest for 'Alba' in all cropping systems. Furthermore, significant correlation was identified between the inflorescences per plant and branch numbers per plant (r=0.77) and between the number of harvested fruits per plant and the fruit weight per plant (r=0.977).

First Report of Beet pseudo yellows virus in Strawberry in the United States: A Second Crinivirus Able to Cause Pallidosis Disease.

During efforts to characterize strawberry pallidosis disease, we identified a single strawberry plant that indexed positive for pallidosis disease by grafting but it was not infected with the Strawberry pallidosis associated virus (SPaV) based on reverse transcription-polymerase chain reaction (1). Leaves of this plant were grafted onto Fragaria vesca UC-4 and UC-5 and F. virginiana UC-10 and UC-11 indicator plants. The F. vesca plants remained asymptomatic, while the F. virginiana plants gave typical pallidosis symptoms that included marginal leaf chlorosis and epinasty. The combination of these symptoms on F. virginiana and lack of symptoms on F. vesca is used to define pallidosis disease (1). We extracted dsRNA from the original plant, and synthesized and cloned cDNA as previously described (2). Sequence analysis revealed several clones that corresponded to the published sequence of the Beet pseudo yellows virus (BPYV) heat shock protein 70 homolog gene (HSP70h). We transferred the isolate to Nicotiana benthamiana by using the whitefly vector, Trialeuroides vaporariorum, and then reisolated and cloned dsRNA from the infected N. benthamiana. Here we present the complete sequence of the HSP70h and minor coat protein (CPm) genes of the strawberry isolate of BPYV (GenBank Accession Nos. AY 267369 and AY 268107, respectively). Oligonucleotide primers BP CPm F (5' TTCATATTAAGGATGCGCAGA 3') and BP CPm R (5' TGAAAG- ATGTCCACTAATGATA 3') were designed to amplify a 334-nucleotide fragment of the CPm gene of the strawberry isolate of BPYV. Using this primer set, we were able to verify the presence of BPYV in 1- to 3-year-old plants from the major strawberry producing areas of the United States, including California, Oregon, and the Mid-Atlantic States. Infection rates were highest near Watsonville, CA where more than 20% of plants tested were infected with BPYV. To our knowledge, this is the first report of BPYV infecting strawberry. BPYV and the closely related SPaV (2) pose new concerns for the U.S. strawberry industry. Studies are currently underway to determine the effects of these two viruses on strawberry vigor and productivity.

Lytic enzyme activity in peat is increased by substrate amendment with chitin: Implications for the control ofPhytophthora fragariae inFragaria vesca

Chitin is reported to stimulate mycorrhizas and antagonistic, lytic-enzyme producing soil microorganisms. Here mycorrhizal and non-mycorrhizal strawberry (Fragaria vesca) plants were grown in peat growth-substrate and in peat amended with chitin (Suppressor™). Chitinase and cellulase activity was determined and the plants were challenged by inoculation withPhytophthora fragariae, the causal agent of redcore disease. Disease resistance was only found in the mycorrhizal strawberry-chitin amendment treatment and depended on the duration of the mycorrhiza’s growth in the amended substrate before potting on to a chitin-free growth substrate. The practical application of chitin substrate amendment in the exploitation of mycorrhizal biological control is discussed.

Phosphorus translocation by saprotrophic basidiomycete mycelial cord systems on the floor of a mixed deciduous woodland

Translocation of 32 P was examined in seven mycelial cord systems of Hypholoma fasciculare, Phanerochaete velutina and Phallus impudicus which had developed from wood block inocula placed on the floor of a mixed deciduous woodland. Five days after addition of radiotracer to the central inoculum activity was detected at the margins of cord systems, demonstrating translocation 32 P over distances up to 75 cm. Destructive sampling showed that radioactivity was present in cords and a range of wood and leaf litter components colonized by cord systems. Radioactivity was also detected in live Fragaria vesca plants and shoots of the moss Hypnum cupressiforme .

Double‐stranded RNA analysis of strawberry plants affected by June yellows

SUMMARYUsing an improved method for extraction of dsRNA from strawberry leaf tissue, small quantities of several dsRNA species with mol. wt greater than 1.0 × 106were detected in strawberry plants free from known strawberry viruses but affected by June yellows (JY). No such dsRNA species were detected in plants of Fragaria vesca or seven strawberry cultivars known to be free from JY. Neither JY symptoms nor these dsRNA species were detected in healthy strawberry and F. vesca plants graft‐inoculated with tissue from JY‐affected plants. It is not known whether the JY‐associated dsRNA species are those of a causal agent of JY or are a consequence of the JY condition. Nevertheless, the detection of such dsRNA species in plants affected by JY may offer a possible objective method for detecting the incipient condition in symptomless strawberry plants. However, the concentrations of dsRNA in JY‐affected plants are very low and dsRNA analysis is thought not to be sufficiently reliable for routine testing of plants. The occurrence of anomalous dsRNA species in extracts from some strawberry plants was caused by dsRNA from two‐spotted spider mites (Tetranychus urticae) infesting the plants.