Vegetative Growth Research Articles

Exploring the relationships between ground observations and remotely sensed hazelnut spring phenology.

Crop phenology is very important in regular crop monitoring. Generally, phenology is monitored through field observation surveys or satellite data. The relationships between ground observations and remotely sensed derived phenological data can enable near-real-time monitoring over large areas, which has never been attempted on hazelnuts. In this study, we extracted phenological metrics derived from MODIS Enhanced Vegetation Index (EVI) in hazelnut production regions and compared them with the spring ground phenological data (BBCH scale) from orchards located in the same area of Turkey over the period from 2019 to 2022. We observed a specific temporal dynamic between remote sensing phenometrics and ground observations. The metrics Greenup, Upturning Date, and Threshold 20% metrics corresponded to the early of EVI growth and were synchronous with the female flowering of hazelnut and ending before bud break. The metrics Threshold 50% and Start of season were associated with the steepest portion of the EVI curve, i.e., canopy greening and thickening, and occurred between ovaries enlargement and leaves unfolding. The metrics Peak of Season, Stabilization Date, and Maturity corresponded to the end of spring vegetative growth. The main outcomes are that (i) female flowering occurred before 20% of vegetation development (BBCH 64P occurred about one month before Threshold 20%), (ii) phenometrics from satellite remote sensing (i.e., Upturning Date and Threshold 20%) well-reflected leaf emergence (rs = 0.30 and rs = 0.32, respectively; p < 0.05) and unfolding (rs = 0.35 and rs = 0.39, respectively; p < 0.05), and (iii) cluster appearance temporally aligned with the peak of the EVI curve (Stabilization Date and BBCH 71P differed by around 4 days). Our method is transferable to operational phenology monitoring, and future applications will consider the senescence season and the effect of environmental variability on the comprehension of vegetation dynamics.

Satellite-Observed Hydrothermal Conditions Control the Effects of Soil and Atmospheric Drought on Peak Vegetation Growth on the Tibetan Plateau

Recent research has demonstrated that global warming significantly enhances peak vegetation growth on the Tibetan Plateau (TP), underscoring the influence of climatic factors on vegetation dynamics. Nevertheless, the effects of different drought types on peak vegetation growth remain underexplored. This study utilized satellite-derived gross primary productivity (GPP) and the normalized difference vegetation index (NDVI) to assess the impacts of soil moisture (SM) and vapor pressure deficit (VPD) on peak vegetation growth (GPPmax and NDVImax) across the TP from 2001 to 2022. Our findings indicate that NDVImax and GPPmax exhibited increasing trends in most regions, displaying similar spatial patterns, with 65.28% of pixels showing an increase in NDVImax and 72.98% in GPPmax. In contrast, the trend for SM primarily showed a decrease (80.86%), while VPD showed an increasing trend (74.75%). Through partial correlation analysis and ridge regression, we found that peak vegetation growth was significantly affected by SM or VPD in nearly 20% of the study areas, although the magnitude of these effects varied considerably. Furthermore, we revealed that hydrothermal conditions modulated the responses of peak vegetation growth to SM and VPD. In regions with annual precipitation less than 650 mm and an annual mean temperature below 10 °C, decreased SM and increased VPD generally inhibited peak vegetation growth. Conversely, in warm and humid areas, lower SM and higher VPD promoted peak vegetation growth. These findings are crucial for deepening our understanding of vegetation phenology and its future responses to climate change.

AaSlt2 Is Required for Vegetative Growth, Stress Adaption, Infection Structure Formation, and Virulence in Alternaria alternata

Slt2 is an important component of the Slt2-MAPK pathway and plays critical regulatory roles in growth, cell wall integrity, melanin biosynthesis, and pathogenicity of plant fungi. AaSlt2, an ortholog of the Saccharomyces cerevisiae Slt2 gene, was identified from A. alternata in this study, and its function was clarified by knockout of the gene. The ΔAaSlt2 strain of A. alternata was found to be defective in spore morphology, vegetative growth, and sporulation. Analysis of gene expression showed that expression of the AaSlt2 gene was significantly up-regulated during infection structure formation of A. alternata on hydrophobic and pear wax extract-coated surfaces. Further tests on onion epidermis confirmed that spore germination was reduced in the ΔAaSlt2 strain, together with decreased formation of appressorium and infection hyphae. Moreover, the ΔAaSlt2 strain was sensitive to cell wall inhibitors, and showed significantly reduced virulence on pear fruit. Furthermore, cell wall degradation enzyme (CWDE) activities, melanin accumulation, and toxin biosynthesis were significantly lower in the ΔAaSlt2 strain. Overall, the findings demonstrate the critical involvement of AaSlt2 in growth regulation, stress adaptation, infection structure formation, and virulence in A. alternata.

Biochar distribution mode in soil affects the vegetative peanut growth, nitrogen uptake and nitrogen-fixing bacteria activity

Biochar distribution mode in soil affects the vegetative peanut growth, nitrogen uptake and nitrogen-fixing bacteria activity

Revealing the metabolic potential and environmental adaptation of nematophagous fungus, Purpureocillium lilacinum, derived from hadal sediment

The extreme environment shapes fungi in deep-sea sediments with novel metabolic capabilities. The ubiquity of fungi in deep-sea habitats supports their significant roles in these ecosystems. However, there is limited research on the metabolic activities and adaptive mechanisms of filamentous fungi in deep-sea ecosystems. In this study, we investigated the biological activities, including antibacterial, antitumor and nematicidal activity of Purpureocillium lilacinum FDZ8Y1, isolated from sediments of the Mariana Trench. A key feature of P. lilacinum FDZ8Y1 was its tolerance to high hydrostatic pressure (HHP), up to 110 MPa. We showed that HHP affected its vegetative growth, development, and production of secondary metabolites, indicating the potential for discovering novel natural products from hadal fungi. Whole-genome sequencing of P. lilacinum FDZ8Y1 revealed the metabolic potential of this piezotolerant fungus in carbon (carbohydrate metabolism), nitrogen (assimilatory nitrate reduction and protein degradation) and sulfur cycling processes (assimilatory sulfate reduction). Transcriptomic analysis under elevated HHP showed that P. lilacinum FDZ8Y1 may activate several metabolic pathways and stress proteins to cope with HHP, including fatty acid metabolism, the antioxidant defense system, the biosynthetic pathway for secondary metabolites, extracellular enzymes and membrane transporters. This study provides valuable insights into the metabolic potential and adaptation mechanisms of hadal fungi to the challenging conditions of the hadal environment.

First Report of Root-knot Nematode, Meloidogyne enterolobii, on Luffa cylindrica (L.) in Guangxi, China.

Luffa cylindrica (L.), an annual climbing herb of the Cucurbitaceae family, has a long planting history in China and is deeply loved by people due to its nutritional and medicinal value (Partap S, Kumar A et al., 2012). April 2023, symptoms such as plant dwarfism, decreased yield and serious root-knots appeared on L. cylindrica sampled from a commercial production base in Beihai, Guangxi, China (GPS 21°55'79″ N;109°49'61″ E). The investigated area of L. cylindrica was about 1.3 ha, the incidence of root-knot nematode disease was almost 90%. The roots of 20 L. cylindrica were dug up and many root-knots and egg masses were found. Nematodes in samples at different stages were collected by shallow dish method, and morphological identification was caried out. Males were worm-like, annulated, with the anterior part slightly conical. Females were globular to pyriform. The perineal pattern was oval, with the dorsal arch being moderately high to tall. The tail of the second-stage juvenile (J2) was very slender with a sharp tip. The transparent tail end was clearly visible. Morphological measurements of females (n = 20): body length = 677.2 ± 34.4 μm, body width = 512.8 ± 45.4 μm, stylet = 13.7 ± 0.5 μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 5.7 ± 0.8 μm. The measurements of J2s (n = 20): body length = 412.5 ± 19.4 μm, body wide = 16.2 ± 1.3 μm, stylet lengths = 12.6 ± 0.92 μm, DGO length = 3.1 ± 0.3 μm. Average tail length = 45.44 ± 4.1μm. The observed typical characteristics of M. enterolobii were consistent with those previously described by Yang & Eisenback (1983) and EPPO (2016). J2s hatched by single egg mass were used for DNA extraction and identification of molecular biology. Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), the specific primers of M. enterolobii, was used to validate this pathogen (Long et al., 2006). Consistent with that described before, the target amplification product was about 236 bp, and no product was obtained from the negative control, M. incognita and M. javanica (Chen et al., 2023). Using V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG), the rDNA ITS region was obtained and sequenced (Vrain et al., 1992). The target product was 765 bp (GenBank accession no. PQ205316), which was 100% homologous to those M. enterolobii ITS sequence available in the GenBank (KX823372, KJ146863). Koch's postulates were used to verify the pathogenicity of M. enterolobii on L. cylindrica, twelve 2-week-old L. cylindrica were planted in sterilized soil and inoculated with M. enterolobii J2s at a rate of 3,000 individuals per plant. The plants were grown at 26°C in a greenhouse, with non-inoculated controls set up. After 8 weeks, the roots of the non-inoculated plants (n = 12) showed no root-knot and grew well, while all inoculated plants developed root-knots and exhibited stunted growth. The average reproduction factor of the inoculated plants was 19.5, and the average root-knot rating was 7.2 (on a scale of 0 to 10) (Bridge and Page 1980), confirming the pathogenicity of M. enterolobii on L. cylindrica. We found that this is consistent with the description of M. enterolobii infecting Coriandrum sativum in Shanxi, China (Pan et al., 2024) and the infection of Selenicereus costaricensis in Guangxi, China by M. enterolobii (Wu et al., 2023). To our knowledge, this is the first report of M. enterolobii parasitizing L. cylindrica in Guangxi, China. With the increase of vegetable planting area, root-knot nematodes are becoming more and more serious and have become a limiting factor on vegetable production. This finding is of significant importance for vegetable growers to control M. enterolobii in this region, based on which suitable management measures will be taken.

Corn cobs as growing media for production of cucumber plants in agriculture sector: a new trend

Peat and perlite are considered traditional growing substrates in soilless culture. The high cost of both and the urgent need for agricultural waste recycling prompted scientists and soilless culture growers to find alternative growing substrates provide optimal growth conditions and help dispose waste safely. In this study, corn cobs (CB) were tested as growing media and compared with peat moss (PM) and perlite (P). The organic wastes tested: CB, PM, and P were examined with washed sand (WS) at five treatments (WS, CB, CB + peat, CB + P and CB + sand). Cucumber (Cucumis sativus L.) plants were cultivated using 5 kg pots that contained the investigated substrates. Vegetative growth parameters, early fruiting stage, photosynthetic pigments, and cucumber yield had the highest values with CB and CB + P substrates, while the lowest ones were found in WS and CB + WS. CB resulted in greater flowering with the number of fruits per plant and yield being 39.70%, 37.33%, and 33.67%, 29.88 in both seasons, higher than the lowest substrate (WS). Although adding P to CB showed the highest values of measured growth characteristics, its high cost decreased net profit. Furthermore, CB characteristics as a growing media qualify it for use in cucumber soilless culture production. The use of this replacement media, which contains crushed CB, could reduce (but not eliminate) the need for PM and P in soilless culture. Also, using pyrolyzed biomass in growing media provides another way to convert biomass residues into valuable products.

Plant phenology predicts the stability of primary production in three ecosystems of the northern Chihuahuan Desert

Abstract The temporal stability of plant productivity affects species' access to resources, exposure to stressors and strength of interactions with other species in the community, including support to the food web. The magnitude of temporal stability depends on how a species allocates resources among tissues and across phenological stages, such as vegetative growth versus reproduction. Understanding how plant phenological traits correlate with the long‐term stability of plant biomass is particularly important in highly variable ecosystems, such as drylands. We evaluated whether phenological traits predict the temporal stability of plant species productivity by correlating 18 years of monthly phenology observations with biannual estimates of above‐ground plant biomass for 98 plant species from semi‐arid drylands. We then paired these phenological traits with potential climate drivers to identify abiotic contexts that favour specific phenological strategies among plant species. Phenological traits predicted the stability of plant species above‐ground biomass. Plant species with longer vegetative phenophases not only had more stable biomass production over time but also failed to fruit in a greater proportion of years, indicating a growth–reproduction trade‐off. Earlier leaf‐out dates, longer fruiting duration and longer time lags between leaf and fruit production also predicted greater temporal stability. Species with stability‐promoting traits began greening in drier conditions than their unstable counterparts and experienced unexpectedly greater exposure to climate stress, indicated by the wider range of temperatures and precipitation experienced during biologically active periods. Our results suggest that bet‐hedging strategies that spread resource acquisition and reproduction over long time periods help to stabilize plant species productivity in variable environments, such as drylands. Read the free Plain Language Summary for this article on the Journal blog.

A Comprehensive Review of Nano-sized Silica’s Effects on Plant Growth, Molecular Responses, and Biochemical Changes

Silicon (Si) is a tetravalent metalloid and second most abundant on earth approximately 28%. Slags were used in agriculture as a silica fertilizer (10–28% Si); which improvise degraded crop soils, as well as crop growth and disease resistance. Si improves abiotic stress in crop lodging, UV tolerance, improves water uptakes and blocking the NaCl toxicity was observed in Gramineae family. It showed tolerance to biotic stress in terms of physical strengthening of plants against microbial infestation and activation of defensive enzymes such as peroxidase, polyphenol oxidase, lipoxygenase, phenylalanine ammonia lyase. There was an enhanced vegetative growth and germination percentage in varied vegetable crops with 100 to 500ppm range of silica nanoparticles. The plants available Si (H4SiO4) form in soil solution ranges about 0.1 to 0.6 mM and it get absorbed from roots via xylem to shoot containing a specialized cell surface protein called as Nod26-like major intrinsic protein (NIP) of aquaporin family. The list of total genes responsible for uptake of silica form are Low silica genes (Lsi1, Lsi2, Lsi3, Lsi6) and Si efflux transporter genes (SIET3, SIET4, SIET5). The nano-sized silica have been proven to be more validated impact on genes responsiveness via morpho-physiological parameter relationship. It is concluding that, use of silica in commercial crops have deep root to influence the genes and a bright future in its crop growth development aspects.

MORPHOLOGICAL CHARACTERIZATION OF PIGEON PEA [Cajanus cajan (L.) Millspaugh] ACCESSIONS FOR AGRONOMIC TRAITS IN ASSOSA DISTRICT, NORTHWESTERN ETHIOPIA

&lt;p&gt;&lt;strong&gt;Background:&lt;/strong&gt; Pigeon pea is a tropical grain legume being cultivated as important pulses for human food, feed and soil fertility improvement. Pigeon pea research in terms of crop improvement is still at a low level in Ethiopia. &lt;strong&gt;Objective: &lt;/strong&gt;To estimate the Genetic variability of pigeon pea accessions with respect to important qualitative and quantitative traits and select high yielding grain and promising traits for variety development. &lt;strong&gt;Methodology&lt;/strong&gt;: Treatments consisted in twenty two pigeon pea accessions (MPG1, MPG2, MPG3, MPG4, MPG5, MPG6, MPG7, MPG8, MPG9, MPG10, MPG11, MPG12, MPG13, MPG14, MPG15, MPG16, MPG17, MPG18, MPG19, MPG20, MPG21 and MPG22) collected from Assosa area. Treatments were laid out in a Randomized Complete Block Design with three replications. &lt;strong&gt;Results:&lt;/strong&gt; Qualitative characteristics recorded for accessions showed different modalities and frequencies at vegetative growth stage with the qualitative traits dominated were semi-spreading growth habit 65 %, leaflet shape with lanceolate 70 %, color about 44 % of the accessions exhibited yellow, seed size where 55 % accounted large sized, seed color pattern: 52% of accessions showed plain, pod color where 56 % genotypes had purple, seed with red dominated was 50 % and 71 % of accessions had totally pigmented pod. With respect to quantitative traits, genotypes accessions MPG11 and MPG15 had relatively higher grain yield (&amp;gt; 4000 kg/ ha) with the highest grain yield recorded for genotype MPG18. &lt;strong&gt;Implications:&lt;/strong&gt; The investigation of the present study for morphological evaluation of genotype Pigeon pea exhibited genetic variability among accession. &lt;strong&gt;Conclusion&lt;/strong&gt;: Agronomic traits such as plant height, branches per plant, pods per plant, seeds per pod, pod length, pod width, hundred seed weight and grain yield for accessions were exhibited significant differences which suggest high yielding accessions could be directly recommended for production while others could be utilized effectively to develop high yielding varieties through hybridization followed by selection. &lt;/p&gt;

Spatiotemporal Evolution and Drivers of Ecological Quality in the Tengger Desert (2001–2021)

Desert ecosystems, particularly in arid regions like the Tengger Desert, are highly sensitive to both anthropogenic activities and climate change, making the monitoring and evaluation of ecological quality critical for sustainable management and restoration efforts. This study analyses the spatiotemporal evolution of ecological quality in the Tengger Desert from 2001 to 2021 using the Remote Sensing Ecological Index (RSEI), incorporating meteorological factors (temperature, precipitation, wind speed), topographical factors (elevation, slope, relief) and anthropogenic indices (land use and land cover). The mean RSEI fluctuated between 0.1542 and 0.2906, indicating poor ecological quality, with a peak in 2008 attributed to national ecological projects. Despite initial improvements, overall ecological quality declined at a rate of 0.0008 a−1 from 2008 to 2021. Spatially, degradation was most pronounced in the central and southern areas. Due to sand-binding engineering in the Tengger Desert in 2008 and the mountain climate suitable for vegetation growth, improvements occurred in the northeast and southwest. Moran’s I and Hurst index analyses revealed significant spatial clustering of ecological quality and persistence of degradation trends, with over 49.53% of the area projected to experience further deterioration. Geodetector analysis identified land use and land use cover as the most influential factors on RSEI, especially in combination with wind speed, temperature, and precipitation, underscoring the role of both human activities and climate. The study highlights the need for sustained ecological management, particularly in areas showing continuous degradation, to prevent further ecological deterioration.

Differences in the Effects of Three Water Elements on Vegetation in Different Climatic Regions: Insights From the Yellow River Basin, China

ABSTRACTThe effects of water on vegetation have always been a concern. It is an important support as well as a major limiting factor with respect to vegetation growth. By analysing the spatiotemporal changes and correlations between precipitation (PRE), soil moisture (SM), vapour pressure deficit (VPD) and normalized difference vegetation index (NDVI) in the Yellow River Basin, we explored the different effects of three water elements on vegetation in different climatic regions. Our findings reveal the following: (1) NDVI and the three water elements report an increasing trend in the Yellow River Basin, with NDVI increasing most significantly. 92.1% of the Yellow River Basin showed an increase in NDVI. (2) Vegetation in the Yellow River Basin was most positively affected by PRE, followed by SM and VPD. PRE mainly affected the natural vegetation on both sides of the boundary between the arid and semi‐arid regions and the semi‐humid regions. SM mainly affected the natural vegetation in the arid and semi‐arid regions, whereas VPD mainly affected the crops in the irrigation areas, and the irrigation areas in arid regions were affected the most. These findings contribute to a deeper understanding of the relationship between water elements and vegetation.

Ecotypic variation and environmental influence on saffron (Crocus sativus L.) vegetative growth: a multivariate performance analysis

Saffron (Crocus sativus L.) is a crop of significant medicinal and economic importance, exhibiting phenotypic plasticity that leads to variable vegetative growth. This three-year multifactorial study evaluated the vegetative potential of various saffron ecotypes under contrasting environments. The results revealed significant effects on shoot sprouting, leaf count, and overall growth, with the ´Tamlakoute´ ecotype (E2) performing best, particularly in the coastal field (CF2). The leaf count increased markedly from 24.9 ± 8.8 in the first year to 188.8 ± 43.9 by the third year, influenced by ecotypes and cultivation fields. In contrast, plant length variations revealed less dependence on ecotypes throughout the different growing seasons. Pearson's correlation analysis showed a weak relationship (r = 0.108, p < 0.004) between the number of shoots per original corm and per progeny corm. This implies a varied trade-off in resource allocation between vegetative growth and corm formation. The principal component analysis highlighted patterns of variations governed by environmental drivers, particularly favoring the E2 ecotype. Performance scoring and ranking, which assigned scores based on vegetative performance across all ecotypes by environment combinations, identified CF2E2 as the highest-ranking performer, followed by CF2E1 and CF2E4, with comprehensive scores of 2.4, 1.3, and 1.1, respectively. These findings highlight the potential of selecting superior ecotypes and coastal environments to promote sustainable saffron cultivation.

Structural duality enables a single protein to act as a toxin–antidote pair for meiotic drive

In sexual reproduction, selfish genetic elements known as killer meiotic drivers (KMDs) bias inheritance by eliminating gametes that do not carry them. The selective killing behavior of most KMDs can be explained by a toxin-antidote model, where a toxin harms all gametes while an antidote provides resistance to the toxin in carriers. This study investigates whether and how the KMD element tdk1 in the fission yeast Schizosaccharomyces pombe deploys this strategy. Intriguingly, tdk1 relies on a single protein product, Tdk1, for both killing and resistance. We show that Tdk1 exists in a nontoxic tetrameric form during vegetative growth and meiosis but transforms into a distinct toxic form in spores. This toxic form acquires the ability to interact with the histone reader Bdf1 and assembles into supramolecular foci that disrupt mitosis in noncarriers after spore germination. In contrast, Tdk1 synthesized during germination of carrier spores is nontoxic and acts as an antidote, dismantling the preformed toxic Tdk1 assemblies. Replacement of the N-terminal region of Tdk1 with a tetramer-forming peptide reveals its dual roles in imposing an autoinhibited tetrameric conformation and facilitating the assembly of supramolecular foci when autoinhibition is released. Moreover, we successfully reconstituted a functional KMD element by combining a construct that exclusively expresses Tdk1 during meiosis ("toxin-only") with another construct that expresses Tdk1 specifically during germination ("antidote-only"). This work uncovers a remarkable example of a single protein employing structural duality to form a toxin-antidote pair, expanding our understanding of the mechanisms underlying toxin-antidote systems.

МАТЕРИАЛЬНО-ТЕХНИЧЕСКОЕ ОБЕСПЕЧЕНИЕ СЕЛЬСКОГО ХОЗЯЙСТВА: СОСТОЯНИЕ, ПРОБЛЕМЫ, НАПРАВЛЕНИЯ СОВЕРШЕНСТВОВАНИЯ

One of the determining conditions for competitive domestic agricultural production in foreign markets is the technical and technological modernization of the industry. However, despite the significance of the problem, over the past two decades, a stable trend of reduction in the number of employees in agricultural organizations in Russia has developed for all types of agricultural machinery. The highest rates of reduction in agricultural machinery were observed until 2010, and in subsequent periods the downward trend has significantly decreased. At the same time, it is not entirely correct to assess the current situation unambiguously, since the reduction in the fleet of machinery and equipment in agricultural organizations is due to certain objective circumstances and conditions: the area of cultivated land and cultivation of specific crops has decreased; the number of animals has decreased; the technical means used have become more energy-intensive and productive, which is especially important in the context of a shortage of personnel in rural areas. In 2018-2022 the production of domestic agricultural machinery in value terms increased by almost 2.5 times, while in physical terms the changes are insignificant. At the same time, domestic mechanical engineering practically does not produce machinery and equipment for pig farming, poultry farming, milk processing, potato harvesters, beet harvesting equipment, equipment for gardening, vegetable growing. As a result of the outstripping rate of disposal of agricultural machinery and equipment over the rate of their production and replenishment, the energy capacity of the industry is declining. The sanctions imposed on the Russian economy have led to increased risks of non-receipt of critical components and spare parts; disruption of stable logistics and distribution chains that have functioned for a long time, their rise in price; revision of contract terms, failure to meet delivery deadlines. Sanctions against the use of foreign high technologies used in precision farming, genetics, selection, enterprise management, etc. have a negative impact on the development of the agro-industrial complex.

The technological impact of production and farmers&amp;#039; income of vegetable pigeon pea growers under the rainfed situation in Panchmahal of Gujarat

The technological impact of production and farmers&amp;#039; income of vegetable pigeon pea growers under the rainfed situation in Panchmahal of Gujarat

Respective Advantages of Growing Different Green Manure With Nitrogen Fertilization in Cotton‐Based Cropping Systems: Insights From a Three‐Year Field Study

ABSTRACTPlanting green manure to improve cash crop yield and soil health has been widely recognized, and understanding cash crop performance after green manure integration is pivotal for determining its potential to bolster and enhance crop productivity and sustainable production. However, it is unclear whether the effects of different types of green manure on subsequent cash crops are uniform. In order to clarify this issue, we systematically analyzed the effects of green manure types and nitrogen (N) application rates on succeeding cotton agronomic performance, yield, biomass, yield stability, and nutrient uptake. A split‐plot experiment with two factors was designed, main factor includes four cover cropping systems monoculture cotton (MC), February orchid/cotton cover cropping (FoC), hairy vetch/cotton cover cropping (HvC), and a mixture of February orchid and hairy vetch/cotton cover cropping (FHC), and sub‐main factor include four N application levels (0 (N0), 112.5 (N1), 168.75 (N2), and 225 (N3) kg N ha−1). Results suggests that nonlegume green manure (February orchid) accumulated more biomass, N, P, and K nutrients than the legume green manure (hairy vetch) and green manure mixture. Compared with cotton yield of MC, the FoC, HvC, and FHC system increased by 5.8%, 7.6%, and 15%, respectively. N use efficiency was more significantly influenced by the N application rates than by cropping systems. Specifically, as N application rates increased, N use efficiency decreased under MC, HvC, and FHC systems, while it increased under the FoC system. Additionally, we observed a trade‐off between cotton yield and yield stability, with the highest yield stability when cotton yield reached 2633 kg ha−1. This study provides evidence that nonlegume green manure (February orchid) with greater advantages on cotton vegetative organ growth, legume green manure (hairy vetch) can promote nutrient uptake compared to other green manure, while green manure mixture (February orchid and hairy vetch mixture) significantly increased cotton yield and yield stability. These findings provide evidence‐based insights highlighting the respective benefits of incorporating diverse species of green manure into cotton‐based cropping systems in the Yellow River Basin of China.

Developing Strategies to Mitigate Squash Injury from the Soil Residual Activity of Glyphosate in Bareground Systems

Fresh market vegetables are an essential component of the human diet. Maximizing yield is critical, and to achieve this goal, fields must be weed-free when vegetable crops are planted. Historically, removing emerged weeds just before planting has been accomplished using the herbicide glyphosate. However, recent research has indicated that glyphosate applied to sandy, low-organic-matter soils just before transplanting vegetables can be injurious. Two field experiments investigated 1) the response of transplanted squash to the residual activity of glyphosate, and 2) the effects of implementing tillage, irrigation, or extending the plant-back interval after application and before planting to mitigate injury from glyphosate. Glyphosate applied at 1.3, 2.5, or 3.8 kg ae/ha 1 day before transplanting injured squash 13%, 29%, and 53%, respectively; extending the interval between application and planting to 7 days reduced injury to 1%, 11%, and 28% at the same rates. An interaction between application rate and planting interval was also observed on squash plant widths and biomass, as well as early-season and total marketable fruit numbers and weights. Total marketable fruit number was reduced 29% and 52% by glyphosate at 2.5 or 3.8 kg ae/ha, respectively, and a reduction in fruit production of 36%, 28%, and 23% was observed when glyphosate was applied 1, 4, or 7 days before transplanting, respectively. In a separate study, light tillage (5 cm deep) was the most effective cultural practice evaluated because it eliminated damage by glyphosate. Overhead irrigation of 0.6 cm was not beneficial in mitigating injury by glyphosate. Recommendations from this research will help vegetable growers avoid injury from the residual activity of glyphosate through a FIFRA 2(ee) recommendation label.

Indigenous Trichoderma isolates from Bukit Kijang, North Sumatra, Indonesia, are biocontrol agents against Ganoderma boninense in infected oil palm seedlings

Basal stem rot, caused by Ganoderma boninense is a serious disease in oil palm plantations in North Sumatra, Indonesia. However, the use of fungicides to control this pathogen can cause instability in terrestrial ecosystems and decrease the number of beneficial microorganisms. Therefore, identifying other effective and environmentally friendly control methods, such as Trichoderma, is essential. Trichoderma was previously isolated from the leaf, rachis, stem, and root tissues of oil palms but not from the rhizosphere soil. Therefore, this study aimed to assess the potency of indigenous Trichoderma isolates from the rhizosphere soil of oil palm seedling plantations in Bukit Kijang, North Sumatra, Indonesia, as biocontrol agents to reduce G. boninense infection. Four Trichoderma isolates were isolated from healthy oil palm rhizospheres in Bukit Kijang and screened in vitro. Based on molecular identification, the Trichoderma isolates were identified as T. asperellum1, T. virens1, T. asperellum2, and T. virens2. All Trichoderma species inhibited the development of Ganoderma and stimulated the vegetative growth of oil palm seedlings. Therefore, T. asperellum and T. virens can be used as biocontrol agents to control G. boninense and stimulate the vegetative growth of oil palm seedlings. To our knowledge, this is the first report of indigenous Trichoderma isolates from Bukit Kijang that can be used as biocontrol agents to control G. boninense.

Daylength Influences Time to Harvest and Stem Quality of Pycnosorus globosus and Caryopteris incana Specialty Cut Flowers

As the demand for locally grown specialty cut flowers increases, cultivars of Pycnosorus globosus and Caryotperis incana are becoming more available for growers to produce as cuts. However, protocols for year-round greenhouse production are limited. Therefore, our objective was to determine if the photoperiod influences flower induction and development, time to harvest, yield, and morphology of billy buttons (Pycnosorus globosus) ‘Paintball Globe’ and ‘Paintball Poppy’ and bluebeard (Caryopteris incana) ‘Pagoda Lagoon’ and ‘Pagoda Dark Pink’ to facilitate commercial greenhouse production. Shoot-tip cuttings were rooted and transplanted into bulb crates and placed in a greenhouse with a mean daily air temperature of 20 °C and 9-, 10-, 11-, 12-, 13-, 14-, 15-, or 16-hour photoperiods or a 9-hour short day (SD) with a 4-hour night interruption (NI) from 2200 to 0200 HR for 11 weeks. Billy buttons initiated inflorescences and developed flowers under all daylengths; however, the greatest stem lengths were recorded under long days (LDs). Bluebeard inflorescences initiated under all daylengths were tested. Time to visible inflorescence and flower was hastened under daylengths ≤14 hours, whereas inflorescences under the 16-h photoperiod or 4-h NI never fully developed. For ‘Pagoda Lagoon’ and ‘Pagoda Dark Pink’, the critical daylengths for flower development were 14 hours and 15 hours, respectively. On average, only bluebeard ‘Pagoda Lagoon’ harvested under photoperiods ≥10 hours developed marketable stem lengths (&gt;40 cm). To hasten time to visible inflorescence and harvest and ensure marketable stem lengths, billy buttons should be grown under daylengths ≥13 hours. Based on these results, we recommend growing bluebeard under a 16-hour photoperiod or NI for 4 to 6 weeks to promote vegetative growth, followed by an 11- to 14-hour photoperiod for flower induction and development. We classify billy buttons as a day-neutral plant for flower induction and a facultative LD plant for flower development. Similarly, bluebeard can be classified as a facultative SD plant for flower induction and an obligate SD plant for flower development.