V8 Juice Agar Research Articles

First Report of Stem Rot of Konjac Caused by Phytophthora nicotianae in China.

Konjac (Amorphophallus) is an important economic crop widely used in health products and biomaterials in Asia (2). A serious foliage disease of Konjac was observed in Fuyuan County, Yunnan Province, China, in July 2012. The symptoms began with leaf color changes from light green to yellow, followed by discoloration on the stem base, plant wilting, bulb rotting, and ultimately plant death. Symptomatic tissues were cut into small pieces, surface-sterilized, and cultured on 20% V8 juice agar at 28°C. Five days after incubation, white fluffy colonies with the typical sporangium of Phytophthora sp. were observed from root and stem pieces. Isolates were identified as P. nicotianae based on morphological characteristics and DNA analysis. The growth rate of the colonies was 16 mm/d at 28°C. Sporangia were pyriform, ovoid to spherical, and papillate, and the dimensions of the 80 sporangia measured ranged from 23.7 to 60.4 × 19.4 to 45.7 μm (avg. 42.4 × 31.5 μm) with length-to-breadth ratios of 1.19 to 1.44 (avg. 1.34). The chlamydospores were spherical with a smooth surface, and their dimensions ranged from 20.3 to 47.3 × 18.9 to 45.9 μm (avg. 32.7 × 30.4 μm) (3). DNA was extracted from one colony containing spores and hyphae of the isolated P. nicotianae, and the nuclear ribosomal DNA internal transcribed spacer (ITS) region was amplified with primers ITS6 and ITS4 (4). The obtained 854-bp amplicon was purified and sequenced. NCBI BLAST retrieved a 100% identity with P. nicotianae (GenBank Accession No. KJ506732). A pathogenicity test of the isolated P. nicotianae was conducted in a greenhouse. After 7 days in a humidity-controlled greenhouse, all 10 inoculated plants showed similar symptoms as observed initially in the field, while control plants were symptomless. P. nicotianae was re-isolated from the inoculated stems, thus successfully completing Koch's postulates (1). To our knowledge, this is the first report of P. nicotianae as a pathogen of Konjac in China.

First Report in Chile of Mycocentrospora acerina, Causal Agent of Peony (Paeonialactiflora) Red Spot.

A survey to identify pathogens causing peony diseases in southern Chile (37°95' to 40°58'S) was conducted from 2008 to 2011. A noticeable symptom consisted of small red spots on leaves, stems, sepals, and first petals of the bud. The central part of the lesions (1 cm) enlarged, darkened, and became necrotic, coincident with rainy and cold weather, including frosts. Lesions grew but never coalesced completely. At the edges of leaves, the infected tissues cracked and produced a twisted and corrugated appearance. Rhizome symptoms were also observed and consisted of black spots, which enlarged to elongated lesions. Small pieces (~1 × 1 mm) of symptomatic leaves, previously washed with 2% NaOCl for 2 min were cultured on potato dextrose agar (PDA) and V8 juice agar (20%) media. The cultures were incubated in growth chambers at 20°C (dark) and 5°C (dark)/20°C (light) for 12/12 h (dark/light). Sporulation was obtained only with V8 under the dark and light regime. Mycelia growth was superficial and immersed in the media; hyphae were septate with thick black walls. Conidiophores were flexuous, not branched, and produced a single spore. Spores were elongate, multiseptate, with a long, strongly curved beak. After one week, sporulation decreased and thick-walled, round black clamydospores formed in the media. Spores ranged from 125 to 235 μm long and most frequently were 170 to 220 μm. The number of septa ranged from 5 to 12. Morphological and cultural characteristics fit the description of Mycocentrospora acerina (Harting) Deighton (1,2). DNA was obtained from fungal culture. The internal transcribed spacer (ITS) region was amplified using ITS1/ITS4 primers (3), and part of the amplicon (502 of 550 pb) was sequenced. The sequence was deposited in GeneBank (Accession No. KF015599) and showed 100% identity values with sequences of similar regions from M. acerina (strain ATCC 16259, Accession No. KF278454). Healthy leaves and rhizome pieces were washed with sterile distilled water and placed on sterile moist paper towel. A small agar disc with mycelium was placed on the leaves and rhizomes with and without wounding before inoculation. The inoculated materials were kept in closed boxes with high humidity at 5 to 20°C. Tests were positive in leaves and rhizomes with and without wounds. Seven days after leaf inoculations, necrotic symptoms developed. A second inoculation test in peony leaves of plants bagged with plastic under field conditions corroborated the in vitro test. Inoculated rhizomes developed dark orange lesions initially, then turned black with a watery consistency, similarly to affected rhizomes in the field. In both tests, controls showed no symptoms. To our knowledge, this is the first report of M. acerina on P. lactiflora globally (4). In an evaluation at Carillanca (38°41'S, 72°25'W), using a scale from 0 (no symptoms) to 7 (necrotic lesions covering >60% of foliage, with death of stems), 11 out of 31 peony varieties scored 0-1. As a reference, a score of 3 is the maximum damage allowed on peonies for export. These varieties might help to keep Chilean peonies in the market without an economic impact.

First Report of Black Leaf Mold of Tomato Caused by Pseudocercospora fuligena in Ohio.

Diseased tomato (Solanum lycopersicum L. cvs. Geronimo, Rebelski, and Big Dena) plants were received for diagnosis from a home gardener in Wayne County, Ohio, in August 2013 and from a 0.14-ha greenhouse in Brown County, Ohio, in September 2013. Approximately 10 and 60% of leaf area was diseased in the home garden and greenhouse, respectively. One or more lesions, each with an indistinct border, were observed on the leaves. Black fungal growth was observed on both sides of the leaf in association with the lesions. Microscopic examination revealed Cercospora-like conidia (2). Three symptomatic leaves from each location were surface-sterilized with 0.5% NaClO for 1 min and cultured on V8 juice agar medium at room temperature under continuous fluorescent lighting. One isolate was selected from each of Wayne Co. (SAM33-13) and Brown Co. (SAM34-13). The fungus produced small, dark-brown colonies within 2 weeks of plating. Mycelium was olive brown and septate, producing fascicles of conidiophores. Conidia were cylindrical, 2 to 14 septate, and 25.8 to 109.7 × 6.5 μm. Genomic DNA was extracted from colonies of isolate SAM33-13 grown on V8 juice agar medium using the Wizard SV Genomic DNA Purification System (Promega, Madison, WI). The internal transcribed spacer (ITS) region of rDNA was amplified by PCR using primer pair ITS1 and ITS4 (5), and the purified amplicon was sequenced (OARDC Molecular and Cellular Imaging Center, Wooster, OH). The ITS sequence was 99% identical to those of GenBank accessions of Pseudocercospora fuligena from Korea (JX290079) and Thailand (GU214675). The sequence was deposited in GenBank (KF931141). Based on morphology (4) and sequence analysis, the fungus was identified as P. fuligena (Roldan) Deighton (basionym Cercospora fuligena). To satisfy Koch's postulates, three 4-week-old tomato plants each of the cultivars L390 (AVRDC, Taiwan) and Mountain Spring (Siegers Seed Co., Holland, MI) were sprayed with a suspension of 1 × 103 conidia/ml of isolates SAM33-13 or SAM34-13 prepared from 3-week-old cultures growing on V8 juice agar medium. Three non-inoculated control plants were sprayed with sterilized water. Plants were maintained in a growth chamber at 25 to 30°C, 80% RH, and a 12 h/12 h day/night cycle. The first symptoms appeared 3 weeks after inoculation as light yellow foliar lesions. The lesions enlarged and turned black due to fungal growth, and the infected leaves dried. Disease severity was 70 and 10% of leaf area for cvs. L390 and Mountain Spring, respectively, for each isolate. Non-inoculated control plants were symptomless, and no fungus was re-isolated from the leaves. P. fuligena was isolated from symptomatic leaves of inoculated plants as described above, and the identity was confirmed based on morphology. In the United States, C. fuligena has not been reported infecting tomato since the first report in Florida in 1974 (1). To our knowledge, this is the first report of black leaf mold of tomato caused by P. fuligena in Ohio. Resistant cultivars, crop sanitation, and fungicides are recommended to manage the disease (3).

First Report of Cherry Stem Rot and Leaf Necrosis Disease Caused by Phytophthora nicotianae in Yantai, China.

Cherry (Cerasus avium (Linn.) Moench) is the third most economically important fruit in Yantai, Shandong Province, China. In August 2012, brown spots or necrosis on cherry seedling leaves, with an incidence of 8.2 to 34.3%, were observed in some fields of cherry seedlings in Yantai. Our survey indicated that the economic losses could reach up to 15.3% if disease conditions, such as a cool rainy summer season, were favorable. Conspicuous watery lesions on the stems turned to brown streaks; the leaves all wilted; and finally the plants collapsed. Diseased stem and leaf samples were surface-disinfected in 1% sodium hypochlorite for 1 min, rinsed three times in sterile water, which was absorbed with filter paper, and then transferred to 10% V8 juice agar medium containing 50 μg/ml ampicillin and 5 μg/ml carbendazim (1). The plates were incubated at 22°C in the dark for 5 days. The colonies consisted of white, loose, fluffy aerial mycelia. Eight isolates were obtained, and all were identified as Phytophthora nicotianae based on morphological characteristics and the sequence of the internal transcribed spacer (ITS) region of rDNA. The sporangia were ovoid/spherical, obturbinate with rounded bases and prominent papillae that were 37.5 to 62.5 × 30 to 50 μm (average 46.4 × 37.8 μm, n = 100) in size, with an average length-to-breadth ratio of 1.2. Chlamydospores were terminal, intercalary, and measured 19 to 42 μm (average 30.4 μm), which is typical of P. nicotianae (2). The genomic DNA of the eight isolates was extracted from mycelia. The ITS region of all eight isolates was amplified using primers ITS1 and ITS4, producing specific products that were directly sequenced. The sequence of a representative isolate P1401 (895 bp) was submitted to GenBank (Accession No. KJ754387). It was 100% similar to P. nicotianae strains NV-20T and TARI 22073 (KC768775 and GU111667). To confirm the pathogenicity, at least 10 cherry leaves and new stems were inoculated with mycelial plugs (5 × 5 mm) from each isolate. Necrosis of leaves and stems was observed 4 and 7 days after inoculation, respectively. No symptoms were observed on the control leaves and stems that were inoculated with blank agar plugs. P. nicotianae was re-isolated from the infected leaves, and the ITS sequence was analyzed to confirm its identity. Phytophthora species, such as P. cambivora, P. megasperma, and P. drechsleri, had been previously isolated from cherry (3), but to the best of our knowledge this is the first report of stem rot and leaf necrosis disease caused by P. nicotianae on cherry. Since the economic loss caused by this disease could reach 15% if an outbreak occurred in a rainy summer, control measures should be implemented.

Improved production of phleichrome from the phytopathogenic fungus Cladosporium phlei using synthetic inducers and photodynamic ROS production by phleichrome

Two different diketopiperazines, cyclo-(L-Pro-L-Leu) and cyclo-(L-Pro-L-Phe), which were isolated from the culture filtrate of Epichloe typhina and found to be inducers of phleichrome production, were chemically synthesized and evaluated for use in the improved production of phleichrome from wild-type and UV-mutagenized strains (M0035) of Cladosporium phlei. When supplemented with PDA and V8 juice agar media, both inducers showed significant increases in the production of phleichrome. Phleichrome production was increased in a dose-dependent manner up to a concentration of maximum yield for both inducers. No further significant induction was observed by supplementing inducers over the concentration of maximum yield. Among the two inducers, cyclo-(L-Pro-L-Phe) showed better inducing capability than cyclo-(L-Pro-L-Leu). The maximum yield was observed from the M0035 strain grown on V8 juice media supplemented with 150 μM cyclo-(L-Pro-L-Phe), which was estimated to be 232.6 mg of phleichrome per gram of mycelia and 10.2 mg of secreted phleichrome per 20 agar-plugs. Interestingly, growth inhibition was observed on V8 juice agar media with 100, 150, and 200 μM cyclo-(L-Pro-L-Phe) but not on PDA with the same amount of inducer, which suggests that the inhibitory effect might be through the overproduction of phleichrome rather than the toxic effect of the inducer itself. Superoxide production by purified phleichrome was dramatically stimulated upon illumination, thus demonstrating photodynamic production of superoxide in vitro by phleichrome.

Occurrence of Phytophthora citrophthora on Syringa vulgaris in Poland

<i>Phytophora citrophora</i> was isolated from dieback shoots, base of diseascd stems and top parts of lilac plants during 3 vegetation periods. The species was detected from about 75% of analysed plant parts. On V8 juice agar and potato-dextrose agar the quickest growth of the species was observed at 25·30°C but development did not occur at 5° and 35°C. Zoosporangia were mostly papillate from spherica1 to ellipsoidal with average dimensions 45.6 x 31.5 μm. <i>P. citrophthora</i> from 5 host plants caused necrosis development of leaves and stem pars of lilac but the quickest spread of disease occurred when plants or their parts were inoculated with isolates from <i>Syringa vulgaris</i> and <i>Pieris japonica</i>. It indicates that the pathogen may be transmissed in nurseries from diseased pieris grown near lilac.

First Report of Pythium Root and Stalk Rot of Forage Corn Caused by Pythium arrhenomanes in Japan.

Corn (Zea mays L.) is the most important forage crop in Japan. It was cultivated on 92,000 ha in 2011 and was mainly used as whole crop silage for cattle feed. In September 2009, a root and stalk rot disease was detected on corn plants cultivated in Tochigi, located in the central region of Japan. The symptoms of the disease included wilting of whole plants after the R5 (dent) stage (2) with drooping ears. Roots turned black and their number decreased. Further, the stalks became hollow and soft and harbored white hyphae. This tissue deterioration made machine harvest difficult. We obtained seven isolates of a Pythium-like organism by single hypha isolation from surface-sterilized pieces of diseased roots and stems on water agar and deposited one of the isolates at the NIAS genebank, Japan, under the accession no. MAFF511547. The isolate was grown in the dark on V8 juice agar medium for 10 days to produce oogonia. The oogonia were globose, light brown to yellow, smooth, 23.9 to 30.5 μm in size, and had 1 to 8 antheridia. Oospores were mostly plerotic, and oogonia walls were 1.3 to 2.7 μm thick. The morphology of the isolates was similar to that of Pythium arrhenomanes Drechsler and consistent with the species description (3). We analyzed the rDNA-ITS region sequences of the isolate as described by Kageyama et al. (1). The sequence (GenBank Accession No. AB903904) showed 99.1% (783/790 bp) similarity with that of P. arrhenomanes (AY598628). On the basis of morphological and rDNA sequence similarities, we identified the isolates obtained from corn as P. arrhenomanes. The pathogenicity of the isolate was confirmed by planting corn seedlings of the commercial Pioneer Brand hybrid 36B08 immediately after germination in five replicate pots containing soil mixed with 5% boiled barley grain by weight, incubated with or without the isolate for 7 days. After 10 days of incubation in a greenhouse at 20 to 25°C, only the inoculated plants exhibited symptoms of root and stalk rot. Since the inoculated organism was readily re-isolated from the diseased stems and roots, the pathogenicity of the isolate was confirmed. For field observation, the same hybrid of forage corn was sown in the fields in Nasushiobara, Tochigi, on 16 May 2011. The hybrid was sown in a row of 2 m, with 20 seeds planted at a distance of 10 cm with two replicates. For inoculum, the isolate was cultured on 5-cm-long wooden toothpicks, previously soaked in potato dextrose broth and placed on a V8 agar plate for 7 days at 25°C in the dark until covered by hyphae. The toothpicks were pierced into wounds made on the stems of corn plants, approximately 10 cm above the ground, using a thin iron needle. The wounds were about 2 mm in diameter and 2 cm deep. Field inoculation was conducted in late July at the R1 (silking) growth stage. Disease symptoms were observed in mid-September at R5, and only those plants that were inoculated with the toothpicks harboring the hyphae exhibited the typical stem rot symptoms. To our knowledge, this is the first report of root and stalk rot caused by P. arrhenomanes in forage corn in Japan.

First Report of Root and Stem Rot Caused by Phytophthora tentaculata on Mimulus aurantiacus in North America.

Sticky monkey flower plant, Mimulus aurantiacus (Phrymaceae), is a small, perennial shrub that is widely distributed throughout California, especially in coastal and disturbed habitats. It is also found in native plantings in parks and landscapes. In October 2012, nearly all the M. aurantiacus plants grown in a Monterey County, CA nursery for a restoration project were stunted and had dull, yellowish leaves. Roots and stem collars had necrotic, sunken lesions with few feeder roots. Thirty percent of the plants had died. Samples of diseased plants were sent to the CDFA-PPDC Lab and tested positive for Phytophthora sp. using the Agdia ELISA Phytophthora kit (Agdia, Elkhart, IN). A Phytophthora sp. was consistently isolated from the tissue on corn meal agar-PARP (CMA-PARP) (2). Sporangia were spherical to ovoid, papillate to bipapillate and 17 to 42.5 (avg. 27.5) × 12 to 35 (avg. 22.9) μm, with a length/breadth ratio of 1.2:1. Chlamydospores, which were spherical, terminal to intercalary, thin walled and 27.5 to 40 μm, and hyphal swellings formed on CMA-PARP. Spherical oospores, 25 to 36 μm, with primarily paragynous antheridia formed readily on V8 juice agar. rDNA sequences of the internal transcribed spacer (ITS) region of the isolates (GenBank KF667505), amplified using primers ITS1 and ITS4, were 100% identical to Phytophthora tentaculata (CBS 552.96, GenBank AF266775) by a BLAST query (1,3). To assess pathogenicity, exposed root crowns of three 3.78-liter potted M. aurantiacus plants were inoculated with 20 ml of zoospore suspension (2 × 104 ml-1). Plants were maintained in a 23°C growth chamber with a 12-h photoperiod and watered daily. Sterile water was applied to the exposed crowns of three control plants. At 2 weeks, all inoculated plants were wilted with chlorotic foliage. After 3 weeks, the cortical tissue of the crowns and roots was discolored and sloughing and P. tentaculata was recovered on CMA-PARP. P. tentaculata did not grow from the asymptomatic control plants. Inoculations were repeated with similar results. P. tentaculata is a homothallic species in Phytophthora clade 1 that causes crown, root, and stalk rot of nursery plants in Europe and China (1,4). A USDA PERAL analysis lists it as one of the top 5 Phytophthora species of concern to the United States (4). Genera infected with P. tentaculata include Apium, Aucklandia, Chicorium, Chrysanthemum, Delphinium, Gerbera, Lavandula, Santolina, Origanum, and Verbena (4). To our knowledge, this is the first report of P. tentaculata in North America. The source of inoculum of P. tentaculata in California remains unknown. The nursery used seed and cuttings of M. aurantiacus from nearby native areas for propagation, and P. tentaculata was not found in neighboring plant hosts or by baiting soil and water at the nursery. All infected M. aurantiacus material was destroyed. The presence of P. tentaculata in California nurseries could have serious economic impacts on the nursery industry and environmental impacts on susceptible native hosts, if spread into the wildlands.

First Report of Foliar Blight Caused by Phytophthora capsici on Citrus reticulata Blanco cv. Nian Ju in Guangdong, China.

Citrus reticulata Blanco cv. Nian Ju, an important ornamental plant, is traditionally displayed during the Chinese Spring Festival because its golden fruits are a symbol of auspiciousness. In the spring of 2012, foliar blight was observed on 10 to 30% of the Nian Ju plants at four nurseries in Yangjiang, Guangdong Province, China. Initial symptoms appeared as brown to black foliar lesions, followed by expansion of spots into blight. Some young branches also had necrosis. During frequent rainfall and prolonged wet periods at 22°C to 30°C, white and dense mycelia and sporangia were observed on the infected seedlings. To isolate the causal organism, leaves and stems were cut into sections. Each section included some partial lesion and adjacent asymptomatic tissues. They were surface-disinfested in 1% sodium hypochlorite for 60 s, rinsed three times with sterile water, and placed on V8 juice agar (V8A) at 25°C. After 3 days, 10 isolates were obtained and purified by single-zoospore method. These isolates were identified to species level by sequencing the rRNA internal transcribed spacer (ITS) region. Four representative isolates had an identical ITS sequence (GenBank Accession No. KF750568), which had 99% homology with Phytophthora capsici sequences in GenBank. In addition, all recovered isolates were identical in morphological characteristics. They produced caducous, papillate, and ovoid to ellipsoid sporangia (Length × width = 46.2 ± 7.7 × 23.6 ± 11.3 μm), often with a tapered base. The average length of pedicels was 33.3 ± 4.5 μm. All isolates are A2 mating type. They produced gametangia when paired with an A1 tester of P. capsici isolated from pepper on V8A. Plerotic oospores were 25.3 ± 2.1 μm in diameter. Amphigynous antheridia were 13.6 ± 2.8 μm long and 11.2 ± 0.9 μm wide. Oogonia were 27.4 ± 3.2 μm in diameter. To determine the pathogenicity, three 3-year-old potted C. reticulata cv. Nian Ju plants were sprayed with 20 ml of zoospore suspension from one representative isolate at 105 per ml. Two control plants were sprayed with 20 ml distilled water. All plants were then maintained at 90% relative humidity at 25°C with a 12-h photoperiod. Symptoms similar to those observed in the nurseries developed on all inoculated plants but not on any control plants after 10 days. The pathogenicity test was repeated once and similar results were obtained. P. capsici was recovered from all inoculated plants and resultant isolates had identical morphology to that of the isolates used for inoculation. P. capsici has a relatively broad host range including pumpkins, cucumbers, peppers, beans, squashes, and spinach (1,2). To our knowledge, this is the first report of foliar blight of C. reticulata cv. Nian Ju caused by P. capsici. This study indicates that P. capsici is potentially an important pathogen of C. reticulata cv. Nian Ju plants and further investigations into its epidemiology and development of site-specific integrated management programs for this new disease are warranted.

First Report of Leaf Spot Caused by Pseudocercospora pruni-persicicola on Sweet Cherry in Korea.

Sweet cherry, Prunus avium (L.) L., is not much cultivated in Korea, with only 150 ha planted for domestic consumption. In September 2012, a previously unknown leaf spot was observed with nearly 100% incidence on trees (cv. Seneca) planted in a plastic greenhouse in Iksan City of Korea. Interestingly, the same cultivar as well as other cultivars planted outdoors did not show these symptoms. Leaf spots were irregular to subcircular, dark brown with or without a yellow halo, and becoming coalesced to cause leaf blight and premature defoliation. A cercosporoid fungus was consistently associated with disease symptoms. Fungal structures within the lesion developed on both leaf sides but mostly on the upper side. Stromata were well-developed, globular, dark brown, composed of textura angularis-globosa, and 30 to 80 μm in diameter. Conidiophores were densely fasciculate, pale olivaceous to pale brown, subcylindrical, geniculate-sinuous, 8 to 24 × 3 to 4 μm, and aseptate to 2-septate. Conidiogenous loci were inconspicuous, neither thickened nor darkened. Conidia were olivaceous, generally darker than conidiophores, cylindrical to obclavate, almost straight to mildly curved, short obconically truncate at the base, obtuse at the apex, 1- to 10-septate, constricted at the septa, 12 to 86 × 3.5 to 5 μm, guttulate, and had unthickened, not darkened hila. Morphological characteristics of the fungus were consistent with previous descriptions of Pseudocercospora pruni-persicicola (J.M. Yen) J.M. Yen (1,3). A voucher specimen was deposited in the Korea University herbarium (Accession No. KUS-F27264) and a monoconidial isolate was deposited in the Korean Agricultural Culture Collection (Accession No. KACC47019). The complete internal transcribed spacer (ITS) region of rDNA was amplified with the primers ITS1/ITS4 (4) and sequenced. The resulting 505-bp sequence was deposited in GenBank (Accession No. KF670713). A BLAST search in GenBank revealed that the sequence showed >99% similarity with sequences of many Pseudocercospora species, indicating the close phylogenetic relationship of species in this genus. To conduct a pathogenicity test, a conidial suspension (~1 × 104 conidia/ml) was prepared in sterile water by harvesting conidia from 2-week-old cultures on V8 juice agar, and the suspension was sprayed until runoff onto the leaves of five healthy seedlings. Control plants were sprayed with sterile water. The plants were covered with plastic bags to maintain a relative humidity of 100% for 48 h and then transferred to a greenhouse. Necrotic spots appeared on the inoculated leaves 20 days after inoculation, and were identical to the ones observed in the field. P. pruni-persicicola was re-isolated from symptomatic leaf tissues, fulfilling Koch's postulates. Control plants remained symptomless. The fungus has previously been recorded on Prunus persica (L.) Stokes in Taiwan (2,3). To our knowledge, this is the first report of this fungus on P. avium globally as well as in Korea. The disease poses a new threat to the sweet cherry industry in Korea.

Phytophthora virginiana sp. nov., a high-temperature tolerant species from irrigation water in Virginia

Isolates belonging to a previously unknown species of Phytophthora were recovered from irrigation reservoirs at several ornamental plant nurseries in Virginia. Morphological features of this species include abundant lateral chlamydospores in clarified V8 juice agar and carrot agar and terminal, ovoid to obpyriform, nonpapillate and noncaducous sporangia in soil water extract. All tested isolates are silent A1 mating type. They did not produce any sexual structures but induced A2 mating type testers of P. cinnamomi and P. cryptogea to produce gametangia. Sequence analysis of the internal transcribed spacer (ITS) region confirmed that this species belongs to the high-temperature tolerant cluster within Phytophthora clade 9. Its ITS sequence differs from those of its two closest relatives, P. hydropathica and P. parsiana, by >26 bp. Based on these morphological, physiological, and molecular characteristics, we recognise it as a new species, described here as Phytophthora virginiana.

First Report of Phytophthora plurivora Causing Collar Rot on Common Alder in Spain.

Phytophthora decline of riparian alder (Alnus spp.) has been reported in several European countries (2). Death of common alder (Alnus glutinosa) due to Phytophthora alni has also been reported in Spain (4). During several surveys of alder trees in September 2012, typical dieback symptoms, including sparse small yellowish foliage and the presence of rusty exudates on the bark at the collar and lower stem were observed in A. glutinosa growing on the banks of the river Tera (Langa de Duero, Soria, 41°36'34″ N, 3°25'10″ W, elevation 851 m) and the river Tormes (La Maya, Salamanca, 40°41'42″ N, 5°35'36″ W, elevation 833 m). Bark samples plus cambium were taken from the active lesions at collar region, cut into small pieces, dried on filter paper, and plated on V8-PARPH agar (2). The samples were incubated for 4 days at 20°C in the dark before obtaining the Phytophthora isolates. Colonies developed on V8 juice agar (V8A) had limited aerial mycelium at the center and displayed radiate and slightly chrysanthemum-like growth pattern. Mycelial growth was optimal at 25°C (radial growth rate, 8.2 mm d-1), whereas no growth was observed at 32°C. Isolates were homothallic with paragynous antheridia, smooth-walled spherical (very rarely elongated) oogonia (22.8 to 30.6 μm diam.) and both plerotic and aplerotic golden brown oospores (21.3 to 28.5 μm diam.). In non-sterile soil extracts, the isolates produced abundant sporangia (31.5 to 57.2 × 21.3 to 38.4 μm; length:breadth ratio 1.2 to 1.6) borne terminally on unbranched or sympodial sporagiophores, occasionally attached laterally to the sporangiophores. Sporagia were non-caducous, semipapillate, mainly ovoid and obpyriform, obovoid to limoniform but sometimes distorted with two apices. On the basis of the morpho-physiological features, the isolates resembled P. plurivora (formerly identified as P. citricola) (3). To confirm this, genomic DNA was extracted and subjected to PCR. The internal transcribed spacer (ITS) region of the rDNA was amplified using the ITS-6 (5' GAAGGTGAAGTCGTAACAAGG 3') and ITS-4 (5' TCCTCCGCTTATTGATATGC 3') primers before sequencing (Secugen, Madrid, Spain). The sequences were deposited in the EMBL/GenBank database (Accession Nos. KF413074 and KF413075). In order to perform the pathogenicity test, 10 A. glutinosa seedlings (2 years old) per isolate were inoculated by using the under-bark inoculation technique (1) and 10 control seedlings were inoculated with V8A. Seedlings were incubated in a growth chamber at 22.5°C with a 14-h photoperiod. Three months after inoculation, all inoculated plants wilted and died, whereas the control plants showed no disease symptoms. To fulfill Koch's postulates, the pathogen was re-isolated from the necrotic lesions developed around inoculation points, thus confirming its pathogenicity. P. plurivora has been found to be present in rhizosphere soil beneath Alnus spp. and to cause aerial canker and collar rot on alder trees in Austria, Germany, and Romania (2,3). Further studies and surveys are essential to determine the distribution, extent of damage, and potential interactions with other alder pathogens (e.g., P. alni). To our knowledge, this is the first record of P. plurivora affecting A. glutinosa in Spain.

First Report of Rhizoctonia solani AG-1-IB Causing Leaf Blight of Sorrel (Rumex acetosa) in Brazil.

Rumex acetosa L., common name sorrel (in Brazil, azedinha), is an herb from Europe and Asia commonly used either as a vegetable or a medicinal plant (1). No pathogen has been recorded on this plant species in Brazil, where it has been promoted as an alternative vegetable crop. During a routine inspection of a vegetable garden in the campus of the Universidade Federal de Viçosa (Viçosa, state of Minas Gerais, Brazil) in July 2011, a group of sorrel plants were found bearing blight symptoms. Infected leaves had laminae with soaked irregular necrotic areas and infected petioles had reddish lesions. Healthy leaves touched by neighboring blighted leaves became diseased. A mycelial web was always associated with necrotic tissues. A representative specimen was collected, dried in a plant press, and deposited in the local herbarium (VIC 39063). Pure cultures were obtained through direct transfer of mycelium to PDA plates and deposited in the culture collection at the Universidade Federal de Viçosa - Coleção Oswaldo Almeida Drummond (COAD 1265). Slides containing fungal structures were mounted in lactophenol and observed under a microscope (Olympus BX 51). The fungus had the following morphology: mycelium superficial, either filiform or monilioid and constricted at septae, 6 to 10 μm diameter, often branching at right angles or nearly so, typically bearing a septum at branches near the branching point. Additionally, large, poorly differentiated, dirty white sclerotia were formed in older cultures. When mounted in DAPI, 7-day-old mycelium was seen to bear 5 to 13 nuclei per cell. These characteristics suggested that the fungus was Rhizoctonia solani Kuhn (RS). Anastomosis group (AG) was determined by sequencing the rDNA internal transcribed spacer (ITS) region using primers ITS5 and ITS4 (4). A BLAST search revealed that the sequence (GenBank Accession No. KC887353) had 96% sequence identity with RS AG-1-IB GenBank accessions JN426850.1, GU596491.1, JQ692292.1, and JQ692291.1. Pathogenicity of the isolate obtained from sorrel was tested by inoculating four healthy individuals with culture plugs taken from the margin of actively growing cultures on V8 juice agar. Inoculated plants were placed in a dew chamber for 48 h and later transferred to the bench of a greenhouse. Necrosis appeared on all inoculated plants 2 days after inoculation, developing into severe blight after 7 days. RS was isolated from infected tissues. RS AG-1-IB is known as a broad host-range plant pathogen (3). This is its first report as a pathogen of sorrel in Brazil. The sole other published record of this disease on sorrel is from the United States (2).

First Report of Citrus Root Rot Caused by Phytophthora palmivora in Egypt.

During spring-summer 2009, a survey was conducted to determine the species of Phytophthora present in citrus nurseries in Egypt. A total of 300 samples of soil and fibrous roots were collected from the rhizosphere of symptomatic Volkameriana lemon (Citrus volkameriana Tan. & Pasq.) plants growing in Delta (Benha-Qalyubia) and a desert (Cairo/Alexandria desert road) citrus nurseries. Plants showed various symptoms. Canopies of affected plants showed few and yellowish leaves, a general stunted growth, no new vegetation, and sometimes sudden desiccation; the root system showed few dark brown feeder roots, no new yellow-white apexes, and a fibrous appearance of the rootlets due to disintegration of the cortical bark but not of the xylem. Collected rootlets and soil were plated in Petri dishes containing a selective medium for the oomycete Phytophthora (2) and incubated for 3 to 6 days at 19 ± 1°C as described by Ippolito et al. (1). Pure cultures were obtained by single-hypha transfers and the isolates were identified as Phytophthora palmivora (Butler) Butler on the basis of morphological and cultural characteristics (3). Isolates formed stoloniferous colonies on potato dextrose agar (PDA) and grew between 10 and 30°C, with the optimum at 25°C. On V8 juice agar, they showed a highly fluffy pattern and produced terminal and intercalary globose chlamydospores. Sporangia were papillate, elliptical (45 to 51 × 29 to 35 μm; length/breadth ratio of 1.3:1.8), and were caducous with short pedicel. All isolates were A2 mating type, forming spherical oogonia and amphigynous antheridia in dual cultures with reference P. palmivora isolate of A1 mating type. Identification of the isolates was further confirmed by amplification and sequencing of the internal transcribed spacer (ITS) region using the universal primers ITS4 and ITS6. BLASTn analysis of ITS sequences (GenBank Accession No. HE583183) showed 99% homology with P. palmivora isolates available in GenBank. Pathogenicity tests for P. palmivora were conducted by inoculating three groups of ten 6-month-old Volkameriana lemon plants, transplanted into 1.4 liter pots with growing medium artificially inoculated at the rate of 1% (v/v) of P. palmivora inoculum produced according to Yaseen (4). Ten uninoculated plants served as a control. Two months after the inoculation, plants were analyzed for canopy symptoms and the presence of pathogen in feeder roots. More than 50% of inoculated plants showed foliage symptoms and extensive decay of feeder roots. Colonies of Phytophthora were recovered from necrotic rootlets and identified as P. palmivora, fulfilling Koch's postulates. To the best of our knowledge, this is the first report of P. palmivora as a pathogen to citrus plants in the Egyptian nurseries. P. palmivora should be considered a potential threat to the Egyptian citrus industry since it may negatively influence the nurseries and orchards production in the future.

Spore Types and Spore Production of <i>Ramularia areola</i> for Screening Cotton Germplasm for Resistance

Spore production ofRamularia areolahas always been a difficult task. Brazilian isolates ofR. areolaproduce spores of variable size and shape. The typical spores are 3 septate, rarely 4 and 5 septate, together with abundant single celled oblong to round bodies—a phenomenon not reported earlier forR. areola. Budding of spores is a continuous process as observed in our isolates. By repeated culturing the pathogen either ceases to produce typical spores or loses its pathogenic character. To solve this problem, a technique was developed to produce large quantity of typical spores under laboratory conditions. Sporulating cultures produced on Petri plates containing V8 juice-agar were kept on the laboratory bench till they became dry and then stored at 5°C for reisolation and/or for production of fresh inoculum. In such dried cultures spores remain viable for a period of over 12 months, and hence isolates ofR. areolaoriginatedfrom different geographic regions can be maintained in sporulating form. Results of the present investigation would aid cotton breeders and pathologists in screening germplasm resistant toRamulariaand in other genetical studies under glasshouse conditions.

Gene × environment tests discriminate the new EU2 evolutionary lineage of Phytophthora ramorum and indicate that it is adaptively different

SummaryA new evolutionary lineage of the destructive introduced tree pathogen Phytophthora ramorum, EU2 lineage, was recently discovered attacking larch and other hosts in Northern Ireland and south west Scotland, UK. Sixteen ‘medium × agar concentration × incubation temperature’ stress environments were tested to find a rapid and repeatable method to discriminate the known EU2 lineage from the EU1, NA1 and NA2 lineages in culture, in particular from the EU1 already prevalent across the UK; and to investigate whether EU2 might be adaptively different. At 25°C on both Carrot agar and V8 juice agar, the mean radial growth rates of all four lineages were significantly different, with NA2 > EU2 > EU1 > NA1. At this temperature, EU2 colonies were not only phenotypically distinct from EU1 and all other lineages but on average grew three times as fast as EU1. This indicates that EU2 is adaptively different from EU1. Twelve days growth in the environment ‘V8A/2% agar/25°C gave excellent discrimination of all four lineages in three repeat experiments, including clear discrimination of EU2 from EU1. Each lineage exhibited a distinctive colony pattern. The utility of this test environment was examined further by screening fresh UK isolates of unknown lineage from new larch outbreak sites alongside standard isolates. The lineage assignments predicted were corroborated by gene sequencing and RFLP profiling. These results also revealed that the EU2 lineage was present at several new larch sites in south west Scotland, whereas isolates from geographically adjacent areas such as the Isle of Mull, north west Scotland, the Isle of Man and north west England were all of EU1 lineage.

First Report of Leaf Spot on Switchgrass Caused by Pithomyces chartarum in the United States.

There are few reports on diseases of switchgrass. In November 2009, light brown to white bleached spots (1 to 2 × 3 to 4 μm) were observed on 'Alamo' switchgrass (Panicum virgatum L.) grown in a growth chamber in Knoxville, TN, from surface-disinfested seed produced in Colorado. Symptomatic leaf tissue was surface sterilized, air dried, and plated on 2% water agar (WA) amended with 6.9 mg fenpropathrin/liter (Danitol 2.4 EC, Valent Chemical, Walnut Creek, CA) and 10 mg/liter rifampicin (Sigma-Aldrich, St. Louis, MO). Plates were incubated at 26°C in the dark for 5 days. A sporulating, dematiaceous, mitosporic fungus was observed and transferred to potato dextrose agar. Colonies were white to gray, with brown as conidia increased. Conidia ranged in size from 10 to 22.5 × 20 to 37.5 (average 15.2 × 26.5) μm. Conidia were golden to dark brown, broadly ellipsoidal, some pyriform, with one longitudinal septum and two to three transverse septa, sometimes constricted at the transverse septa. Based on microscopic examination, the fungus was identified as Pithomyces chartarum (Berk. & Curt.) M.B. Ellis (1); observations were consistent with the authority (2). Pathogenicity assays were conducted with 5-week-old 'Alamo' switchgrass grown from seed scarified with 60% sulfuric acid and surface-sterilized with 50% bleach. Seed were sown in 9 × 9-cm pots containing 50% (v/v) ProMix Potting and Seeding Mix (Premier Tech Horticulture, Québec, Canada) and 50% Turface ProLeague (Profile Products, Buffalo Grove, IL). Eight replicate pots with ~20 plants each were sprayed with a spore suspension of 5.7 × 105 spores/ml sterile water prepared from 6-day-old cultures grown on V8 juice agar in the dark. Two more pots were sprayed with sterile water to serve as controls. All plants were subjected to high humidity for 72 h by enclosure in a plastic bag. Plants were placed in a growth chamber at 25/20°C with a 12-h photoperiod. Leaf spot symptoms similar to the original disease were evident on plants in each of the eight replicate pots 6 to 10 days post-inoculation. Control plants had no symptoms. Lesions were excised from leaves, surface sterilized, and plated on WA. The resulting cultures were again identified as P. chartarum based on morphology. The internal transcribed spacer (ITS) region of rDNA from the original isolate and the pathogen recovered from plants in the pathogenicity tests were amplified with PCR using primers ITS4 and ITS5. PCR amplicons were obtained from both isolates, sequenced, and found to have 100% identity. A 580-bp sequence was deposited at GenBank (Accession No. JQ406588). The nucleotide sequence had 98 to 100% identity to the ITS sequences of isolates of Leptosphaerulina chartarum (anamorph: P. chartarum), including isolate Mxg-KY09-s4 (GU195649) from leaf spot on Miscanthus × giganteus in Kentucky (1), and isolates from leaf lesions on wheat (EF489400 and JX442978). To our knowledge, leaf spot caused by P. chartarum has not been described on switchgrass (3). Pithomyces chartarum is a seedborne pathogen of switchgrass, and may play a role in stand establishment.

First Report of Camphor Tree (Cinnamomum camphora) as a Host of Phytophthora ramorum

Cinnamomum camphora (Lauraceae) is an evergreen shade tree grown in many parts of the United States, including California. From 2007 to 2011, an arborist working in a residential neighborhood in Mill Valley (Marin Co.) noticed several camphor trees with branch dieback and decline. Affected trees had patchy, irregular cankers on the branches and shoot blight. Cankers were black and most had horizontal fissures. Cankers were most abundant in the inside and lower portions of the canopies. In 2011, samples sent to Bartlett Tree Laboratory tested positive for Phytophthora sp. using the Agdia ELISA Phytophthora kit (Agdia, Elkhart, IN). In February 2009 and April 2011, camphor leaf samples were collected by Sacramento Co. inspectors during an annual nursery inspection for Phytophthora ramorum and submitted to CDFA. The normally bright green leaves were reddish with small necrotic spots surrounded by green halos. Camphor samples from Marin Co. were also collected and sent to CDFA in September 2011. An organism with coralloid coenocytic hyphae, chlamydospores, and ellipsoidal semi-papillate sporangia grew on CMA-PARP (4) from both Marin and Sacramento Co. samples. Morphologically, it matched the description of P. ramorum (3). rDNA sequences of the internal transcribed spacer (ITS) region of the Marin (GenBank KC473521) and Sacramento (KC473522) isolates, amplified using primers ITS1 and ITS4 (4), were 100% identical to P. ramorum by a BLAST query (AY038058). Microsatellite loci placed the Marin isolate in the NA1 clonal lineage, while the Sacramento isolate belonged to the NA2 lineage (2). Pathogenicity of both isolates was tested on 5 trees grown in 18.93-liter pots. Three leaves on each tree were inoculated with 6-mm agar plugs taken from the margin of 7-day-old cultures grown on V8 juice agar (V8). Leaves were wounded with a sterile pushpin and two colonized plugs of each isolate were covered with a freezer tube cap filled with sterile dH2O and attached to the leaves with a pin-curl clip (4). Three branches of the same plants were wounded and inoculated with a 3-mm colonized agar plug for each isolate and secured with Parafilm. An equal number of leaves and stems were treated with uncolonized V8 plugs as controls. Plants were sprayed with dH2O, covered in large plastic bags, and placed in a growth chamber at 18°C. After 4 days, the bags, caps, and plugs were removed from the leaves. Black lesions were seen 7 days after inoculation on most leaves and 10 to 14 days on inoculated branches. After 32 days, P. ramorum was isolated from leaf lesions and canker margins onto CMA-PARP. No Phytophthora spp. grew from the controls. The experiment was repeated once with similar results. Overall, leaf and stem lesions were larger with the NA2 lineage isolate than the NA1 lineage isolate, which is consistent with previous research (1). Leaf abscission was seen in 30% of the leaves inoculated with the NA2 lineage isolate but none of the NA1 or control leaves. To our knowledge, this is the first report of P. ramorum on camphor in nursery and landscape settings. Mill Valley is known for its mild temperatures and abundant summer fog. Optimal weather conditions likely led to the spread of P. ramorum from infected neighboring forest hosts to camphor in Mill Valley, rather than from an introduction of infected nursery plants.

Root and Stem Rot of Begonia Caused by Phytopythium helicoides in Virginia.

In the summer of 2011, severe root and stem rot of begonia (Begonia × semperflorens-cultorum cv. Vodka Dark Red) was observed during a field trial. Seventy-eight percent of the plants had symptoms included foliar blight, blackened and rotting roots, rotting stems, and collapsing crown, often leading to plant death. Isolation from the diseased plant roots consistently recovered a Pythium-like species and 41 isolates were subcultured for identification. These isolates produced very similar single-strand conformation polymorphism (SSCP) fingerprints (2), which were distinct from those of other oomycete pathogens known to attack begonia (1). These isolates produced proliferous, ovoid to globose, terminal, and papillate sporangia which were 30.6 to 45.4 μm (av. 38.7 μm) in length and 20.5 to 35.4 μm (av. 28.2 μm) in width. Oogonia were produced in single culture grown in clarified V8 juice agar. These smooth-walled oogonia were mostly aplerotic and 28.9 to 36.8 μm (av. 33.1 μm) in diameter. Each contained a single oospore with a diameter of 23.7 to 34.4 μm (av. 26.9 μm). Single to multiple antheridia were attached lengthwise to each oogonium. These morphological characteristics match the description of Phytopythium helicoides (= Pythium helicoides) (3). The identity of these isolates was confirmed by sequencing the rDNA internal transcribed spacer (ITS) 1 and 2 regions. ITS sequence of the representative isolate 55C7 (GenBank Accession No. KC907734) had 97 to 99% homology with P. helicoides sequences in GenBank. Two isolates, 55C7 and 56A7, were tested for pathogenicity to begonia in the summer of 2012. Twelve plants per isolate were inoculated by injecting ground P. helicoides-colonized rice grains into the root soil using a long-neck funnel. Sterile rice grains were used on control plants. Aboveground symptoms including foliar blight, stem rot, and collapsing crown were observed 7 days after inoculation and the disease progressed for additional 6 weeks. At 7 weeks, all inoculated plants showed different symptom levels. Four and 10 plants inoculated with 55C7 and 56A7, respectively, were already dead. Begonia roots showed severe symptoms including blackening, stunted growth, and rotting. Seven of 12 control plants also had notable symptoms due to cross contamination. Isolates recovered from all symptomatic plants had identical SSCP fingerprints to those of isolates 55C7 and 56A7. To our knowledge, this is the first report of P. helicoides attacking begonia plants. The avenue of this pathogen entering the 2011 field trial remains unknown. The field trial in 2011 and pathogenicity test in 2012 indicate that this pathogen is potentially destructive to begonia. Additional research is warranted to identify the origin and dissemination of this pathogen to mitigate the risk to begonia production.

First Report of QoI Insensitive Cercospora beticola on Sugar Beet in Ontario, Canada.

Cercospora beticola Sacc. causes Cercospora leaf spot (CLS) of sugar beet (Beta vulgaris L.) and is the most destructive foliar disease of sugar beet worldwide (1). The QoI fungicide pyraclostrobin has been an important management tool for CLS in Canada since 2003. Beginning in 2010, some growers reported poor disease control after applying pyraclostrobin. Leaf disk samples with CLS lesions were collected in September 2012 from 16 commercial fields located in Kent and Lambton Counties, Ontario, Canada. These counties (ca. 300,000 ha) encompass the major commercial sugar beet production area in Ontario (ca. 3,925 ha). CLS severity ranged from low to severe among the sampling sites. Leaf discs with a single leaf spot were cut from leaves using a hole punch. Spots were up to 5 mm in diameter with tan, light brown, or sometimes gray centers. DNA was extracted from leaf discs using a Qiagen DNeasy Plant Mini Kit (Germantown, MD) according to the manufacturer's instructions. PCR was used to amplify a fragment of the C. beticola cytochrome b (CYTB) gene (4). Pure cultures were obtained by placing plant tissue in a moist chamber and transferring single spores to V8 juice agar. PCR products were sequenced for 32 samples at the Genomics Technology Support Facility (Michigan State University, East Lansing, MI) and 25 were confirmed to have 100% identity with the sequence of QoI-resistant C. beticola from Michigan (2) and to QoI-resistant isolates from GenBank (Accession Nos. JQ619933 and JQ360628). The remaining seven had 100% identity with a sensitive isolate (EF176921.1). Each resistant isolate contained a change in codon 143 that is predicted to lead to a substitution of G143A in the cytochrome b gene. This G143A mutation has been associated with QoI resistance in a number of fungi (3). To confirm the result, a conidium germination bioassay was carried out using nine isolates with the G143A mutation on sugar beet leaf agar covered with water agar amended with pyraclostrobin at concentrations ranging from 0 to 54.3 μg/ml and distributed on a spiral gradient using an Eddyjet II spiral plater. The medium was supplemented with salicylhydroxamic acid (SHAM) to block the alternate oxidation pathway. Following incubation at 25°C for 2 days, the distance between the center of the plate at which conidial germination was 50% of the maximum observed growth (EC) and the point at which conidial germination terminated were measured (TEC). The EC50 values were determined from the SGE software for each isolate by entering the EC and TEC values, respectively. The estimated EC50 for a representative wild type (sensitive) isolate was 0.03 μg/ml, while the value for the resistant isolate could not be calculated because it was greater than the highest concentration tested (54.3 μg/ml). Additionally, in the controls with no SHAM or fungicide, the resistant isolate showed a consistent reduced germination rate compared to the sensitive isolate (30.0% and 93.5% germination, respectively). Confirmation of fungicide insensitivity will require a re-evaluation of current management practices in Ontario to minimize economic losses due to CLS.