Technological University Research Articles

The Influence of Student Engagement and Student Satisfaction on Continuous Use of Paid Knowledge on Moocs Platform: A Survey Case Study of School of Management, Guangdong University of Technology

Background and Aim: Since 2012, the advent of Massive Open Online Courses (MOOCs) has sparked a global revolution in digital education. As modern educational technology continues to advance rapidly, the sharing of educational resources and the establishment of online courses have become critical priorities. This research aims to analyze the current state of online course learning among students in management colleges, tackle the challenge of enhancing online learning environments, develop innovative models for online platforms, and meet diverse learning needs. Through investigation and research on students' understanding of online courses, usage patterns, and existing challenges, the study seeks to foster well-rounded management professionals equipped to meet the demands of contemporary society. Materials and Methods: This study involves seven variables that will be assessed through questionnaires to ensure reliability and validity in research measurement. To achieve this, we integrated previous questionnaire designs related to paid courses on knowledge payment platforms and conducted a pre-test to refine the questionnaire based on participant feedback and data performance. Following adjustments, a finalized version of the questionnaire was developed to enhance accuracy in data collection. The focus of this research is on users of paid knowledge platforms who either intend to purchase or have already made purchases. Therefore, screening questions were initially included in the questionnaire design to identify respondents familiar with paid courses. Respondents not aware of such courses were excluded from further questioning. Subsequently, additional inquiries were directed towards filtering out those unwilling to pay. The final sample analysis was conducted exclusively on users who were aware of paid courses and either expressed willingness or demonstrated behavior in paying for them. Results: The researcher will outline the study's subjects in this chapter, including the target population, sample units, sample size, and related sampling procedures. Additionally, they will establish the research instrument for this study and delineate the various sections of the questionnaire. The validity, internal consistency, and reliability of the research content will also be addressed. Internal validity is determined by two factors: prediction and Cronbach's alpha coefficient. Conclusion: The relevant research findings are presented, which are beneficial for learners in both courses, and the level of support provided by the course structure varies for different learners; Understanding the needs of learners for the course is essential. Based on the aforementioned research, the ultimate goal is to promote curriculum optimization and iteration and provide corresponding guidance and references for developing MOOC classes to enhance teachers' teaching abilities.

Preparing physiotherapists for the future: the development and evaluation of an innovative curriculum

BackgroundEducational innovation in health professional education is needed to keep up with rapidly changing healthcare systems and societal needs. This study evaluates the implementation of PACE, an innovative curriculum designed by the physiotherapy department of the HAN University of Applied Sciences in The Netherlands. The PACE concept features an integrated approach to learning and assessment based on pre-set learning outcomes, personalized learning goals, flexible learning routes, and programmatic assessment. PACE distinguishes itself from traditional education because of the flexible learning routes, vertical organization in learning communities, absence of pre-defined learning activities and class schedules, and a culture of continuous learning and development. PACE is based on three guiding principles: 1) flexible and varied, 2) self-directed and collaborative, 3) future-oriented. PACE was implemented in 2021 for first-year students. This study evaluates the implementation to inform future curriculum development.MethodsA sequential explanatory mixed methods design was used to evaluate the implementation of PACE using a questionnaire, focus groups, in-depth interviews, and a national progress test allowing for benchmarking results. Participants were undergraduate physiotherapy students of cohort 2021–2022, the first group who experienced PACE and teachers involved with this cohort. Questionnaire data were analyzed using descriptive statistics. To compare mean total scores of the national progress test between four different universities a one-way ANOVA was conducted including a post-hoc analysis. Reflexive thematic analysis guidelines were applied to analyze the interview data.ResultsIn total 82 first year students (44,6%) of cohort 2021–2022 and 36 teachers (60%) completed the questionnaire. Results show that the guiding principles were implemented as intended. Results of the national progress test on knowledge and clinical reasoning showed that students of the HAN University performed well compared to other universities. Thematic analysis of interviews and focus groups resulted in three themes and nine subthemes: 1) navigating a personalized curriculum, 2) caring and sharing, and 3) shaping professional identity. PACE contributed positively to students' intrinsic motivation, learning joy, identity development, and life-long learning skills. Areas for improvement were self-directed learning support, and teaching strategies to prompt deep learning.ConclusionThe evaluation showed that the guiding principles of PACE were implemented as intended and that the innovation positively contributed to student learning,

Study on the Changes in College Students' Learning Behaviors under ChatGPT-based Interventions: A Case Study of Hunan University of Technology

Generative artificial intelligence, exemplified by ChatGPT, has garnered significant attention from the global technology community. Scholars suggest that this technology could lead to profound transformations in areas such as education and research. As digital information continues to evolve, the disruption of traditional educational models by AI-driven innovations appears to be an inevitable progression. This study aims to explore whether generative AI facilitates or impedes the development of education, its impact on traditional offline educational models, and its potential to enhance student learning outcomes. Utilizing sampling techniques, surveys, data mining, convolutional neural networks, and logistic regression, this research systematically investigates and critically analyzes college students' perceptions of the advantages and disadvantages of ChatGPT compared to conventional learning methods, the degree of its influence, and potential future implications.

Migraine among King Khaled University students; prevalence, determinants, and impact on academic life.

Migraine is a common primary headache disorder that significantly affects academic life and is often associated with stress, depression, anxiety, and irregular sleep patterns among university students. This study aimed to assess the prevalence of migraine among King Khalid University (KKU) students, identify its determinants, and evaluate the impact of migraine and other headaches on academic life and performance. An analytical cross-sectional study was conducted among 732 students from Colleges of Medicine, Pharmacy, Engineering, and Computer science. We used a self-administered questionnaire, including the ID Migraine™ screening tool, which was administered either through an online survey or face-to-face. Convenience and snowball sampling methods were adopted to recruit participants between June 1 and August 31, 2024. The median [interquartile range (IQR)] age was 21(2.0) years, 58.2% were female, 97.5% were Saudi, and 93.0% were non-smokers. The prevalence of migraine was 44.1%. The key predictors of migraine were female gender (adjusted odds ratio (AOR)=1.78 (1.29 - 2.46), P<0.001), family history AOR = 2.39 (1.75- 3.27), P<0.001], working alongside education (AOR = 1.95 (1.19 - 3.18), P = 0.007), family debt (AOR = 1.86 (1.06 - 3.29), P=0.03), and having chronic diseases like bronchial asthma (AOR = 2.16 (1.11 - 4.20), P=0.02) and hypertension AOR = 6.23 (1.34 - 28.84), P = 0.01). Over 90% reported migraines affected concentration, sleep, and exam preparation, and 65% indicated an impact on university attendance. Migraines are highly prevalent among KKU students, affecting academic daily life. Early detection and lifestyle changes are essential, and universities should plan and implement coping strategies to support affected students.

EXAMINING THE TRANSITIONAL JOURNEY: A MULTIPLE CASE STUDY OF A FORMER EMPLOYEES TURNED TO COLLEGE STUDENTS

This study aimed to explore and understand the experiences of Former Employees who turned back to college students. Using purposive sampling and inclusion criteria, the participating three (3) Kapalong College of Agriculture Sciences and Technology (KCAST) students who are former employees were identified. All of them participated in the in-depth interviews. This study employed a qualitative research methodology grounded in case studies to gain a deeper understanding of participants' experiences. Such an approach is beneficial for qualitative researchers as it guides hypothesis development through detailed investigations of small groups. Results revealed the challenges of the participants: struggling in adapting to changing social and professional environment; juggling between work and studies: and financial challenges in the pursuit of education. In response to the challenges they have encountered, they deem the following coping strategies essential; turning pressure into motivation; and empowering oneself through prayer and guidance. Upon reflecting on their entire experience, they arrived at the following insights; essence of striving for greater aspiration; importance of work experience in career progression; and education as pathway to advance career positions. It can be concluded that the transition from former employees to college students represents a transformative and enriching journey characterized by challenges, growth, and fresh opportunities. These individuals exhibit resilience and commitment as they balance work responsibilities and academic pursuits. The perspectives and diverse backgrounds they bring add valuable insights, contributing to a vibrant learning atmosphere that enhances the educational experience. KEYWORDS: Former Employees, College Students, Multiple-Case Approach, Qualitative, Cross-Case Analysis

The Competitive Edge of Hong Kong Universities: Distinct Features and Advantages of Studying in Hong Kong

Along with the trend of education globalization, more and more students choose to study abroad. This paper discusses and explores the competitive advantages of studying in Hong Kong, particularly for Chinese students. With its globally recognized universities such as the University of Hong Kong and the Hong Kong University of Science and Technology, the region offers a high-quality, internationalized educational experience that facilitates adaptation for Mainland students. The mutual recognition of Hong Kong degrees fosters academic collaboration with mainland China, while English as the primary language of instruction enhances students communication skills and employability in multinational corporations. The paper highlights Hong Kong's robust academic environment, characterized by distinguished faculty and advanced facilities, as well as diverse post-graduation pathways, including students opportunities for further study, employment in Hong Kong, and career development in Mainland China. Ultimately, studying in Hong Kong not only enriches students' cross-cultural educational experiences but also equips them with valuable perspectives and networks essential for their future careers, which can be beneficial throughout their whole lives

Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood

To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.

A Stable Zn(II) Metal-Organic Framework as Turn-On and Blue-Shift Fluorescence Sensor for Amino Acids and Dipicolinic Acid in Living Cells or Using Aerosol Jet Printing.

Amino acids and dipicolinic acid (DPA) are important biomarkers for identifying human health. Establishing rapid, accurate, sensitive, and simple assays is essential for disease prevention and early diagnosis. In this work, a novel Zn(II) metal-organic framework (MOF) with the formula {[Zn5(μ3-OH)2(BTDI)2(dpp)2]·dpp·4H2O·2DMF}n (JXUST-53, where JXUST denotes Jiangxi University of Science and Technology, H4BTDI = 5,5'-(benzo[c][1,2,5]thiadiazole-4,7-diyl)diisophthalic acid; dpp = 1,3-di(4-pyridyl)propane) was successfully synthesized via a mixed-ligands strategy. JXUST-53 exhibits a three-dimensional (4,10)-connected deh1 topological structure, which remains stable after soaking in aqueous solutions with different pH values (1-12) and organic solvents for at least 24 h, showing high chemical and pH stability. As a potential fluorescence sensor, JXUST-53 can specifically recognize l-threonine (l-Thr), l-histidine (l-His), and DPA in EtOH solutions through fluorescence enhancement and a blue-shift effect. It is worth noting that JXUST-53 is the first MOF-based fluorescence sensor capable of recognizing l-Thr. In addition, the university logo of JXUST with JXUST-53 deposited on it was printed by aerosol jet printing technology, enabling a portable and convenient method for monitoring DPA. More importantly, JXUST-53 has good biocompatibility and low cytotoxicity to sense l-Thr, l-His, and DPA in living cells.

The Sociotechnical Dynamics of Virtual Work-Integrated Learning in Journalism Education During the COVID-19 Pandemic

ABSTRACT This study explores how sociotechnical factors in a virtual work-integrated learning (WIL) environment influenced the development of practical journalism skills and professional socialisation of journalism students at a selected South African university during the COVID-19 pandemic. Using a university of technology as a case study, the data for this study were collected using focus group discussions with final-year journalism students and semi-structured in-depth interviews with their employers. The study finds that the COVID-19 pandemic forced WIL into a virtual format, which participants felt impacted their ability to develop essential journalism skills, including production, practical, and technological skills. The virtual nature of WIL also affected their professional socialisation, particularly in terms of interacting with colleagues and news sources and developing career management skills. As the demand for graduates with practical skills and professional socialisation increases, the importance of WIL also rises. The pandemic's impact on journalism provides an opportunity to rethink WIL's role and purpose within the curriculum, using the reflections of students and employers in this study.

Комплекс упражнений по обучению иноязычной коммуникативной грамматике студентов технических направлений подготовки (на примере английского языка)

The purpose of the study is to theoretically substantiate and develop a set of exercises for training the foreign language communicative grammar to technical students. The article examines foreign language grammatical skills and describes the stages of their formation (perception, imitation, substitution, modification, reproduction and combination). Language, conditional speech, and speech exercises for teaching foreign grammar are described. Insufficient effectiveness of language exercises in the process of training grammatical skills among students of an engineering university has been established. During the analysis of textbooks on English for technical areas, it was revealed that they are not intended for teaching communicative grammar. For the first time, the study examines a set of exercises for teaching communicative grammar to students of engineering and technical universities, substantiates the division of speech and conditional speech exercises into levels, which determines the scientific novelty of this study. As a result of the research, a set of exercises for teaching communicative grammar to students of technical fields was developed, consisting of conditional speech and speech exercises that contain vocabulary trained within the framework of a thematic lesson and consistent with its (thematic lesson) theme.

Impact of Integrated Weed Management Strategies on Weed Density and Biomass in Rice (Oryza sativa L.)

To assess the effectiveness of various weed management practices on controlling weed density and dry weight in rice (Oryza sativa L.). A field experiment was carried out during 2022 and 2023 at the Crop Research Centre, Sardar Vallabhbhai Patel University of Agriculture and Technology, Meerut, in the Indo-Gangetic plains In Randomized Block Design (RBD) with 12 treatments, each replicated thrice. The treatments included a weedy check, a weed-free condition, farmer’s practice of one hand weeding at 40 days after transplanting (DAT), Pyrazosulfuron applied at 150 g ai ha-1 as a pre-emergence herbicide, Pyrazosulfuron 150 gm ai ha-1 followed by one hand weeding at 40 DAT, Bispyribac sodium at 25 g ai ha-1 applied 15 days after transplanting as a post-emergence herbicide, Bispyribac sodium at 25 g ai ha-1 followed by one hand weeding at 40 DAT, Ethoxy sulfuron applied at 20 g ai ha-1 as a pre-emergence herbicide, Ethoxy sulfuron 20 gm active ingredient per hectare followed by one hand weeding at 40 DAT, Penoxsulam applied at 22 g ai ha-1as a post-emergence herbicide, Penoxsulam 22 g active ingredient per hectare followed by one hand weeding, and a combination of Pyrazosulfuron 150 gm active ingredient per hectare as pre-emergence, followed by Penoxsulam 22 g ai ha-1 as post-emergence, and one hand weeding at 40 DAT. Weed density and dry weight were recorded at 30, 60, and 90 days after transplanting using quadrat sampling. The weed-free treatment consistently exhibited the lowest weed density and dry weight across both years, whereas the untreated weedy check resulted in the highest weed density and dry weight throughout the study. Among the herbicide treatments, the combination of Pyrazosulfuron and Penoxsulam with one hand weeding was found to be the most effective in significantly reducing weed density and dry weight.

Research on the Impact of Certification-Related Reforms on Students’ Abilities Based on the Regression Discontinuity Design

Based on the survey data of international economics and trade majors in Guangzhou City University of Technology, this paper uses regression discontinuity design (RDD) to select indicators such as teamwork, business knowledge, analysis and technology to conduct a comprehensive survey on IACBE certification and a series of teaching reforms. According to the research, professional certification and a series of teaching reforms have a significant impact on the effect of students’ practice. In the future, attention should be paid to teaching team building, students’ teamwork ability and the application of new technology to make higher education better adapt to the changing business needs.

Unveiling Gender Dynamics in Career Decision-making: Insights from students of University of Technology and Applied Sciences, (UTAS) Sultanate of Oman

This study explores gender differences in career decision-making among students at the University of Technology and Applied Sciences (UTAS) in the Sultanate of Oman. A sample of 380 students, selected using stratified random sampling from a total student population of 35,037, participated in the study with 179 responses received, reflecting a response rate of 47.1%. The sample was proportionally distributed based on the number of students enrolled at each campus, ensuring representation from all university branches, including Muscat (13,000 students), Nizwa (4,697 students), Salalah (3,528 students), Ibra (3,267 students), Ibri (2,682 students), Shinas (3,202 students), and Musannah (4,661 students). Data was collected through a structured 40-item questionnaire, which included seven subscales: educational, on-the-job training, university, financial, personality, social, industrial (focused on Tourism, manufacturing, and technology), and governmental factors. Participants rated items on a five-point Likert scale. Independent samples t-tests and factor analysis were used to analyze the data. Factor analysis was conducted to identify underlying factors influencing career choice. The factor analysis revealed eight key factors influencing career choices: University factors, Government initiatives in the manufacturing sector, Monetary benefits, Personality traits, Technology sector opportunities, Academic performance, Tourism opportunities, and Student involvement. Independent samples t-tests revealed significant gender differences in perceptions related to career guidance and counseling services, career placement services, personal interests in career decisions, and on-the-job training opportunities, with female students generally expressing more positive views than male students. These findings underline the importance of enhancing career counseling and placement services, increasing on-the-job training opportunities, and integrating personal interests into career counselling to support gender-inclusive career development.

Effect of Recommended and Graded Doses of Biochar with and without ZMB Biofertilizer and Zinc on the Growth Attributes of Rice (Oryza sativa L.)

A field experiment was conducted during the Kharif seasons of 2022 and 2023 at the Students' Instructional Farm, Acharya Narendra Deva University of Agriculture and Technology, Kumarganj Ayodhya, to assess the impact of graded doses of biochar, varying fertility levels, and the addition of biofertilizers and zinc on rice cultivation under partially reclaimed sodic soils. Nine treatments were applied, including combinations of recommended doses of fertilizers (RDF), biochar (5 t ha⁻¹ and 2.5 t ha⁻¹), biofertilizer (ZMB), and zinc sulphate (ZnSO₄) in a randomized block design with three replications. The treatments were: T1 (Control), T2 (100% RDF), T3 (50% RDF), T4 (50% RDF + 5 t ha⁻¹ biochar), T5 (50% RDF + 5 t ha⁻¹ biochar + ZMB), T6 (50% RDF + 5 t ha⁻¹ biochar + ZMB + ZnSO₄), T7 (100% RDF + 2.5 t ha⁻¹ biochar), T8 (100% RDF + 2.5 t ha⁻¹ biochar + ZMB), and T9 (100% RDF + 2.5 t ha⁻¹ biochar + ZMB + ZnSO₄). The rice variety NDR 2065 was used as the test crop. Growth parameters such as plant height, dry matter accumulation, root length, root volume, number of tillers, and panicle length were evaluated. The results showed that the treatment T9 (100% RDF + 2.5 t ha⁻¹ biochar + ZMB + ZnSO₄) produced the highest growth and quality parameters, indicating a significant improvement in rice performance. The study suggests combining biochar, biofertilizers, and zinc under reduced fertilizer levels can enhance rice growth and productivity in sodic soils, offering a sustainable approach to soil fertility management.

Bridging the health information gap among undergraduate university students: The role of academic libraries.

Although university students are young and seem generally healthy, they do have health information needs that affect their academic work. Some university healthcare services and academic libraries collaborated during the COVID-19 pandemic to provide health information to students. The study explored the health information gap among undergraduate students in universities in Ghana. The study involved 382 students from the University of Cape Coast, the University of Ghana, and Kwame Nkrumah University of Science and Technology, including nine librarians and six university health professionals. Respondents for the study were chosen using stratified sampling and purposeful sampling techniques. A questionnaire and a semi-structured interview guide were used to collect the data. The study revealed limited access to health information for undergraduate students. Male and female students had similar high priorities (personal hygiene, disease prevention, healthy living, mental health) but reproductive health information was mostly a priority for female students. Inadequate access to health information among undergraduate students may pose a threat to avoidable health risks and academic productivity. Based on the findings, a functional Collaborative Health Information Model for Academic Libraries and University Healthcare Systems is proposed to address undergraduate students' health information needs.

The Relationship Between Muscle Metabolic Index (Cr/CysC) Levels and Short-Term Prognosis with Acute Ischemic Stroke: Findings from a Cohort Study.

Sarcopenia significantly impacts prognosis in patients with acute ischemic stroke (AIS). This study investigates the relationship between serum creatinine/serum cystatin C (Cr/CysC) levels and short-term prognosis in AIS patients, aiming to inform post-treatment strategies. We analyzed AIS patients at the First Affiliated Hospital of the University of Science and Technology of China from January 2022 to January 2024. Baseline data were collected through interviews and medical records, with a 3-month follow-up for prognosis assessment. 265 were included in the final analysis. Cr/CysC levels were categorized into quartiles (Q1-Q4). Logistic regression and restricted cubic spline analysis were employed to evaluate the association between Cr/CysC and prognosis. Among the 265 patients, the average age was 66.18 ± 12.41years, and 129 (48.68%) had poor short-term prognosis. Multivariate logistic regression showed that patients in the lowest quartile of Cr/CysC (Q1) had a significantly lower risk of poor prognosis compared to those in the highest quartile (Q4) (odds ratio= 0.287, 95% confidence interval: 0.090-0.917, P= 0.035). A linear relationship was identified between Cr/CysC and prognosis (P overall<0.001, P nonlinear= 0.571). This study establishes a significant linear correlation between Cr/CysC levels and poor short-term prognosis in AIS patients. Encouraging muscle function exercises may enhance patient outcomes.

Impact of Aerobic Exercise on Obesity among Female Undergraduates of Ladoke Akintola University of Technology, Ogbomoso, Nigeria

Impact of Aerobic Exercise on Obesity among Female Undergraduates of Ladoke Akintola University of Technology, Ogbomoso, Nigeria

Critical application of TGfU in sports coaching

ABSTRACT Background The foundational nature of the ‘Teaching Games for Understanding’ (TGfU) approach [Thorpe, R., D. Bunker, and L. Almond. 1986. Rethinking games teaching. Loughborough: University of Technology.] has led to considerable interest from researchers and practitioners since its inception [Stolz, S., and S. Pill. 2014. “Teaching Games and Sport for Understanding.” European Physical Education Review 20 (1): 36–71. https://doi.org/10.1177/1356336X13496001]. Consequently, many variations of TGfU have come to the fore [Mitchell, S., J. Oslin, and L. Griffin. 2020. Teaching sport concepts and skills: A tactical games approach. 4th ed. Champaign, IL: Human Kinetics.]. Despite the considerable interest from physical education related researchers, those in sports coaching have been slower to embrace the TGfU approach, particularly in competitive adult settings [Kinnerk, S., S. Harvey, C. MacDonncha, and M. Lyons. 2018. “A Review of the Game-Based Approaches to Coaching Literature in Competitive Team Sport Settings.” Quest.]. Indeed, there is a lack of consensus about the TGfU’s efficiency and studies have shown that practitioners lack knowledge on how to implement it in their own context [Karagiannis, K., and S. Pill. 2017. “A Case Study Exploring Coaching Practice and Coaching Perspectives at One Soccer (Football) Club.” Scientific Journal of Education, Sports, and Health 18 (1): 140–150.]. Purpose Therefore, the aim of this study was to critically explore the utility of TGfU as a pedagogical approach within a competitive sports coaching setting, whilst considering its impact on the coach and players’ learning. Methodology An Action Research (AR) methodology involving progressive cycles of practice over the course of a full eight-month volleyball season. The participants of the study were the players (n = 13) and the first author as the coach. Data were drawn from focus groups and reflective field notes. Data collection proceeded in tandem with a combination of inductive and deductive analysis. Findings Results indicated the need to adapt the approach to the context critically rather than safely, which demands a well-developed knowledge of the field and engagement with reflection. This suggests a close consideration of the coaching context and the interpretation of TGfU as a flexible approach rather than a rigid model, which has been widely understood to evolve based on contextual needs [Casey, A., MacPhail, A., Larsson, H. & Quennerstedt, M. (2021). Between hope and happening: Problematizing the M and the P in models-based practice. Physical education and sport pedagogy, 26(2), 111–122. https://doi.org/10.1080/17408989.2020.1789576]. Findings suggest a reconceptualisation of the well-established notion of ‘player-centred’ [Metzler, M. 2011. Instructional Models for Physical Education. 3rd ed. Scottsdale, Arizona: Holcomb Hathaway, Publishers, Inc.] to that of ‘interaction-centred’ (between the coach and the players) as crucial to effective practice. Here, the use of questioning played a key role in mediating the interaction between the coach and the players. Finally, the current study demonstrated that, despite not being a linear process, the players’ game understanding and overall performance improved throughout the season. Such improvement was instigated by facilitating the players’ ability to reflect, progressing to being able to reflect on themselves, the team, and to some extent on the opposition.

Effect of Fast-Track Surgery Based on Nutritional Support in the Rehabilitation of Patients Undergoing Radical Thyroidectomy and Lateral Lymphadenectomy: A Retrospective Analysis.

This study aims to investigate the impact of fast-track surgery (FTS), based on nutritional support, on postoperative rehabilitation and nutritional status in patients undergoing radical thyroidectomy and lateral lymphadenectomy. This retrospective study included 112 patients who underwent radical thyroid cancer surgery and lateral neck lymph node dissection at Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, between April 2021 and April 2023. Based on various nursing methods, patients were divided into two groups, with 58 patients included in the observation group (FTS care based on nutritional support), and 54 patients in the control group (routine perioperative care). Postoperative clinical indicators, nutritional status, Quality of Life, associated complications, and follow-up outcomes at 3 and 12 months were compared between the two groups. Patients in the observation group showed significantly shorter meal times, hospital stays, and off-bed time compared to the control group (p < 0.05). After three months of intervention, the observation group had higher body weight, muscle mass, and body fat, and lower Nutritional Risk Screening (NRS) scores compared to the control group (p < 0.05). At the 12-month follow-up, the observation group had better nutritional status indicators than the control group (p < 0.05). Furthermore, the observation group exhibited higher Quality of Life scores (p < 0.001) and reduced incidence of delayed complications (p < 0.05). During the three-month follow-up, the observation group demonstrated higher Quality of Life Questionnaire Core 30 (QLQ-C30) score compared to the control group (p < 0.05). Additionally, the overall incidence of complications was significantly lower in the observation group (p < 0.05). FTS nursing based on nutritional support effectively promotes postoperative recovery, improves nutritional status, and enhances Quality of Life in patients following radical thyroidectomy and lateral lymphadenectomy, which is worthy of being widely popularized.

Epidemiology of malaria and hematological analysis in district Dir (lower), Pakistan

Background: Malaria is considered as a tropical disease, in developing countries. Among all parasitic infections malaria is most widespread and devastating disease. According to WHO malaria is endemic in 24 countries. Methods: This cross-sectional study was conducted at Department of Medical Laboratory Technology University of Haripur. Total 995 samples were collected at District Head Quarter Hospital (DHQ), Tehsils Hospitals (THQs), and other private laboratories in District Dir (Lower). These samples were processed to observe the shape of RBCs as well as plasmodium species in the smear microscopically, and for hemoglobin estimation. Data was analyzed through SPSS version-21. Results: Highest percentage of malaria was recorded in Munda (35.17%) followed by Timergara (19.59%) whereas the lowest number of cases were found in Khall (5.02%). Prevalence of P. vivax was (98.0 %) and P. falciparum was (2 %) in district Dir Lower. Mean red blood cell count (RBCs) was 4.2±0.64 mm3 while mean Hb was 11.0±1.99g/dl. Based on different age categories, the highest RBCs and Hb levels were found in age group 41-50 years, whereas the lowest RBCs were found in age group 11-20 years while the lowest Hb levels were recorded in group 1-10 years. In associated diseases, the upper respiratory tract infections (URTIs) were the most frequent (20%) followed by diarrhea (18%). Mean Hb of males was 11.8±1.53 g/dl while the mean Hb of female was 11.5±5.384 g/dl. Hb in both males and females were low as compared to the standard. However, as compared to females, Hb of males were significantly lower with p-value &lt;0.001. Conclusion: We concluded that males are more commonly infected from malaria as compared to females. Males and children were found to have low Hb as compared to females and higher age group patients. URTIs and diarrhea were the most common associated illness.