Universal ITS4 Research Articles

Design and Implementation of Online Learning System: An Analysis from Students’ Perspectives

The COVID-19 pandemic has changed the nature of education, leading to a move away from in-person instruction toward online training. This raises the question of how beneficial, given the COVID-19 epidemic, online schooling is. The effectiveness of e-learning and student efforts during the COVID-19 epidemic will be used in this study to measure the Telkom University S1 Business Administration department's level of learning satisfaction. This type of research is descriptive quantitative since it makes use of a questionnaire. A private university's hundred students made up the study's population. To evaluate data, use the SmartPLS program. The results of the data analysis show that learning satisfaction is significantly impacted by both student actions and the effectiveness of e-learning.

Molecular Variation in Some Taxa of Genus Astragalus L. (Fabaceae) in the Iraqi Kurdistan Region

Astragalus L. is one of the main genera of blossoming plants, and its diversity of species and forms is well known. The Astragalus L. taxa make a significant contribution to the mountainous and steppe ecosystems of the Kurdistan region of Iraq. Although the species within this genus have been the subject of several molecular studies, the evolutionary relationships among these species remain unidentified. Despite extensive research, little is known about the phylogenetic relationships among the various subgenera of Astragalus. This research is intended to investigate the molecular variation of 33 species of the genus Astragalus L. found in the Kurdistan area of Iraq. For molecular validations, three separate techniques (nuclear ribosomal DNA (rDNA), inter simple sequence repeats (ISSR), and conserved DNA-derived polymorphism (CDDP)) were used. With respect to Astragalus L. indentations, universal ITS1 and ITS4 gene sequencing was used, and the discovered sequences were subjected to BLAST searches in the NCBI database. A phylogenetic tree was generated with two main clades. Regarding detecting genetic diversity between the taxa, 24 molecular markers (14 ISSR and 10 CDDP) were used. High values of polymorphic materials and gene diversity were detected. ISSR markers had an average of 22.71 polymorphic bands per primer, while CDDP markers had the highest mean values for polymorphic information content (0.37), Shannon’s information index (0.27), expected heterozygosity (0.19), and unbiased expected heterozygosity (0.23). Cluster and principal coordinate analyses divided the Astragalus L. taxa into four main groups using the two molecular data sets. According to the results of the molecular variance analysis, the highest variation was detected within sections, with values of 92.01 and 89.48% for ISSR and CDDP markers, respectively. These outcomes suggest the effectiveness of molecular markers and the ITS region in determining and identifying genetic correlations between Astragalus species.

Isolation and Characterization of Rice Blast and Brown Spot Disease in Different Regions of Tamil Nadu, India

Rice (Oryza sativa L.) is the most important staple food crop cultivated in almost every district of Tamil Nadu. Among the rice fungal diseases, rice blast caused by Pyricularia oryzae and brown spot caused by Bipolaris oryzae are considered to be most potent threats causing major yield losses in Tamil Nadu. The present study aims in identification and characterization of rice blast and brown spot pathogen from different rice growing regions of Tamil Nadu. Three isolates of blast pathogen and five isolates of brown spot pathogen were collected and characterized based on colony morphology and conidial characters. P. oryzae and B. oryzae was identified based on cultural and morphological characters. Molecular characterization of blast and brown spot isolates were done with universal ITS primers. Pathogenicity test was carried out for all the isolates of blast and brown spot and the isolate showing maximum disease incidence was found as virulent one. The present work of morphological and molecular characterization of blast and brown spot pathogen will therefore be helpful to identify and manage the disease effectively in Tamil Nadu.

Morphological and Molecular Characterization of Phytophthora palmivora Isolates and Their Virulence Test on Cocoa Clone Sulawesi 2

Morphological characterization of Phytophthora isolates commonly was done on the basis of the colony and hyphal swelling characteristics, form, and shape of chlamydospore, sporangia as well as oogonia and antheridia. Molecular characterization was conducted using specific primer pairs Pal1 s and Pal2a for Phytophthora palmivora and universal primer ITS4 and ITS5 followed by sequencing of isolates. The virulence of Phytophthora palmivora isolates was tested on a cocoa pod of the Sulawesi2 clone. A total of 21 Phytophthora isolates were collected from Palopo, Gowa, and Pinrang Districts. Based on colony morphology and microscopic features i.e. chlamydospore, sporangium, and its papilla form, all isolates indicated Phytophthora palmivora. Molecular identification using a specific primer showed that all ten representative group isolates had the same band in size of 650 bp, whereas using universal ITS4 and ITS5 primers, all isolates generated one band in the size of 900bp. The sequencing result showed, that all isolates were placed in the group P. palmivora. The virulence of P. palmivora isolates on the Sulawesi2 clone revealed a varying degree of virulence, from less virulent to highly virulent. All isolates from Pinrang were classified as highly virulent because induced necrotic in more than 50% of the tested cocoa pod.

Improvement of Methods for Safety Control of Microbial Producers and Food Produced Therewith.

The study substantiates the necessity to implement the algorithm of molecular-genetic assessment of biosafety of the genetically modified microorganisms (GMM) and to develop standardized methods to test the genetically modified strains producing enzymes, bioactive substances, and other products of microbial synthesis prior to their use in food industry. Analysis of microbial producers and related food products for the presence of GMM-associated DNA revealed high incidence of the marker genes amp and lacZ in enzyme preparations and in mycelium of industrial genetically modified producer of Aspergillus genus. The procedure of extraction of DNA from mycelium of mold fungi is optimized by including the stage of additional purification of the extracts, assessment of their purity by PCR with universal ITS primers, and determination of effective DNA concentration in the samples prior to conduction of the molecular genetic assay. For identification and genotyping of mold fungi (the biotechnological producers of enzyme preparations), the Sanger sequencing method was adapted. Using this modified method, we determined the species of five equivocally identified strains of Aspergillus genus. To identify the closely-related micromycetes of Ascomycota division, a genotyping algorithm was developed based on amplification of total DNA with expanded panel of primers and DNA sequencing by capillary electrophoresis.

Identification of Egyptian Mangrove Species Based on DNA Barcoding

Aims: Mangroves are woody trees or shrubs that grow in the intertidal zone and are distributed along tropical and subtropical coasts. These plants are resilient to various environmental challenges; they are also one of the most efficient terrestrial and coastal ecosystem for carbon fixation and storage. In recent years, mangrove reforestation has attracted much attention as a strategy to reduce the effects of climate change. In Egypt, there are two types of mangroves, Rhizophora mucronata and Avicennia marina, between 30°N and 30°S of the equator. Mangrove management presents a difficult task, particularly when it comes to managing molecular mangroves for long-term sustainability. With the impact of human activity on mangrove ecosystems increasing each year, molecular research on mangrove correlates remains to be conducted. For this reason, using DNA barcoding technology to quickly identify species, mangrove ecosystems may be protected.
 Methodology: In this work, the two Egyptian mangrove species were assessed through morphological, cytological, and molecular approaches. Two universal DNA barcodes, rbcL and ITS, were examined to identify their efficacy for Egyptian mangrove species identification and phylogenetic reconstruction.
 Results: According to pairwise alignments, the rbcL region had the highest level of variability (73.2%), whereas the ITS region was the least variable (11.96%). The selected Egyptian mangrove species can potentially be distinguished by barcoding loci rbcL and ITS due to the existence of distinctive variable sites.

Process Mining using Inductive Miner Algorithm to Determine the actual Business Process Model

At the beginning of 2019, the COVID-19 pandemic entered the country of Indonesia resulting in all learning activities being carried out online in all cities of Indonesia. Likewise, Telkom University concentrates all teaching and learning activities online using the CeLOE Learning Management System. Learning Management System is a system that helps lecturers in managing teaching and learning activities independently in educational institutions. CeLOE is a learning management system of Telkom University developed based on Moodle. In this study, we analyse the CeLOE event log using the process mining method. The goal is to find out the learning patterns of students using CeLOE during the COVID-19 pandemic. This research case study focuses on the activities of students of the Telkom University S1 Informatics study program for the first semester of 2020/2021 in using CeLOE LMS. The analysis of this study conducted a comparison of the performance of three variants of the inductive miner (IM) algorithm through conformance checking values. The results of the analysis obtained are value of conformance checking from the three variants of the inductive miner (IM) algorithm have an average fitness value of up to 1 prove that the inductive miner (IM) algorithm can make a model based on the event log well. Besides that, it has a fairly high precision value with a value range of 0.750-0.850 shows that the inductive miner (IM) makes a process model with relatively many variations of activities outside the event log and the IM process model is "overfit-ting" for all variants of the IM algorithm. Inductive miner (IM) is the best inductive miner (IM) algorithm variant with a fitness value of 1.0, precision value of 0.750, and the generalization value of this algorithm is relatively high (0.984). It is hoped that this research can contribute to the addition of new perspectives related to the implementation of process mining using inductive miner (IM) algorithm in the field of education

First Report of Tar Spot on Corn Caused by Phyllachora maydis in Georgia, United States.

Tar spot is a major foliage disease of corn (Zea mays) caused by the fungus Phyllachora maydis. This disease can reduce the quality of silage, stover, husks, and grain (Valle-Torells et al. 2020). It was identified in the United States for the first time in 2015 in northern Illinois and Indiana (Ruhl et al. 2016). As of 2020, it has also been confirmed in Iowa, Michigan, Wisconsin, Ohio, Florida, Missouri, Minnesota and Pennsylvania (Telenko et al. 2020, Collins et al. 2021). In early August 2021, tar spot symptoms and signs were observed in late-planted, hybrid corn in southwestern Georgia in both Tift and Calhoun Counties. Where it occurred, incidence was nearly 100% and severity ranged from approximately 1% to 20% leaf coverage. As of November 2021, Tar spot has been confirmed in 13 counties throughout South Georgia. The symptoms on leaves were chlorotic lesions and the signs were black, raised, circular to irregular-shaped structures (stromata or clypei) ranging from 0.2 mm to 8 mm on the surface of the leaves. The stromata were present on both green and necrotic leaf tissue. Southern corn rust (Puccinia polysora) was often, but not always observed on leaves with tar spot. Microscopic observations of stromata included single and clustered ascomata (60 × magnification) that contained cylindrical, unitunicate asci with ellipsoid, hyaline, aseptate ascospores and abundant filiform paraphyses (400 × magnification). For molecular confirmation, stromata were surface sterilized with 95% ethanol and separated from the leaf tissue, then DNA was extracted using the Qiagen DNeasy Plant Mini-Kit (Qiagen, Inc., Valencia, CA). PCR was conducted with the universal ITS1 and ITS4 primers to amplify the internal transcribed spacer (ITS) region of the rDNA. The amplicons were Sanger sequenced (Genewiz, Inc., South Plainfield, NJ) and a consensus sequence of a representative lesion was deposited in GenBank (accession number OK649959). Using the BLASTN algorithm our sequence shared 100% and 99.2% coverage, and 97.2% and 98.4% similarity to P. maydis GenBank accessions MG881848 and MK184990, respectively. Phyllachora maydis is an obligate parasite that cannot be cultured, so Koch's postulates were not performed. Inoculum of P. maydis may have been transported to Georgia from Florida by wind or other weather events, but this has not been confirmed.

Pengembangan LKM Berbasis Guided Discovery Learning (GDL) Pada Mata Kuliah Geometri Analitik

This research was aimed to develop a valid, practical and effective student worksheet (LKM) based guided discovery learning (GDL) on Analytical Geometry course. This research was developmental research with a quantitative approach. Subjects of this research were Qomaruddin Gresik University S1 Mathematics Education students who take Analytical Geometry courses. Development of this LKM-based GDL was using the stages of Plomp. Stage generally consists of: (1) initial investigation, (2) design, (3) realization / construction, (4) testing, evaluation and revision and (5) implementation. Results showed that LKM-based GDL developed in this research has fulfilled the criteria of validity, practicality and effectiveness.

First report of root rot and damping off disease in soybean (Glycine max) caused by Pythium deliense in India.

Seedling rot symptoms were observed at Research Farm of ICAR-Indian Institute of Soybean Research, Indore, India. The infected seedlings had water-soaked lesions on the cotyledons and hypocotyls that gradually developed into brown lesions and further progressed to soft rot. These seedlings could be easily pulled-off from the soil. The diseased seedling samples were rinsed thoroughly in flowing tap water and eventually in double-distilled water and were subjected to surface sterilization with NaOCl(1%). The samples were further washed thrice with sterilized double distilled water. The root fragments were properly sterilized and placed on V8 juice agar as well as potato dextrose agar (PDA) media plates. These plates were incubated at 27± 2°C for 48 hours. After incubation, white fluffy mycelial growth was observed on both the media. The fungus was observed to produce brown round vesicles with mycelial attachment when observed under a compound microscope magnification of 20X. Subcultures of these fungal isolates were placed on PDA media and incubated for 7 days at (27±2°C). The pure fungal culture along with PDA media was cut into small pieces and mixed with a sterilized soil mix (70% soil and 20% sand and 10 % vermicompost) at the rate of one petri dish per pot (plastic pots of 10 cm depth) and covered properly with tin foil. These pots were subjected to substrate colonization for 10 days at room temperature and the substrates were shaken occasionally to improve infection efficiency of pathogen by enhacing inocula production. Seeds of soybean variety, Gaurav were sown in three replicates, each with 10 seeds in the inoculated pots. The control was established by sowing seeds in the soil mix, amended previously with plain PDA. The pots were maintained at 25 to 30 ºC with 45 to 50 % of soil moisture content under glasshouse conditions. In the inoculated pots, the fungus killed soybean seeds before and after germination. Some of the plants that emerged developed lesions were initially yellow and gradually turned to necrotic later. These lesions were found on the roots of the plant and at the base of the hypocotyl region. The soybean seeds planted in un-inoculated soil emerged but did not develop any necrotic lesions. When the causal organism was re-isolated from the diseased plant part it was found to be morphologically and culturally similar to theoriginal culture. The isolated pathogen was thus classified as Pythium deliense based on morphological and cultural characters as well as the pathogenicity test. (Plaats-Niterink 1981). For further confirmation of pathogen's identity, complete genomic DNA of the fungus was extracted using the HiPurA Fungal DNA Purification Kit (HiMedia, India). The nuclear rDNA region of the internal transcribed spacer and 5.8S rDNA was amplified by universal primers ITS 1 (5' TCCGTAGGTGAACCTGCGG 3') and ITS 4 (5' TCCTCCGCTTATTGATATGC 3') as mentioned by White et al. (1990). Amplification was performed in a 12.5 μL reaction volume containing 1.5 μL of 10X PCR buffer, 3 μL of 25 mM MgCl2, 1.2 μL of 2.5 mM deoxyribonucleotide triphosphates (dNTPs), 0.7 μL of 10 pM each primer (ITS 1 and ITS 4), and 1 μL of DNA template, 0.3 μL of 1 units of Taq DNA polymerase. The thermal cycle consisted of 4-minute initial denaturation at 94°C, followed by 35 cycles of 1-minute denaturation at 95°C, 30-second primer annealing at 57 The PCR products were sequenced and submitted to NCBI (GenBank Acc. MT2665888). The BLAST study of the fungal isolate showed 100% similarity with reference sequences of Pythium deliense (MT126658.1) in the GenBank. The isolate was identified as Pythium deliense on the basis of molecular analysis, corroborating the above morphological identification. Further, the beta-tubulin gene (Bt) was amplified with primers BtF (5'GCTGGCCTTGATGTTGTTCG3') and BtR (5'CGTGA AGAGTACCCAGAC CG3'). Similarly, the cytochrome oxidase gene was amplified with primers COXF (5'GGTGCTTTTTCAGGTGTAGTTGG3') and COXR (5'GCTCCTGCTAATACTGGTAATG T3'). The PCR products were sequenced and submitted to GenBank with accession numbers MW196444 and MW196445 respectively. In BLAST analysis, the beta-tubulin gene exhibited 100 percent sequence homology with Pythium deliense (MK752986.1) and cytochrome oxidase gene also showed 100 % sequence homology with Pythium deliense (HQ708566.1). Pythium deliense has been recorded worldwide causing disease in many agricultural crops including soybean but to our knowledge, this is the first study in India of the genus Pythium and Pythium deliense causing root rot and damping off of soybean.

Differentiation of Two Pleurotus Species Based on the Restrictive Digestion Profile of the Internal Transcribed Spacer Region

Two oyster mushrooms (Pleurotus eous P-31 and P. ostreatus EM-1) are under either cottage industry or semi-commercial cultivation in Ghana. The latter (P. ostreatus) is already well known to the public and on the shelf of some leading supermarkets. There is morphological resemblance between the two species making it difficult for the untrained eye to distinguish between them except for the colour difference. In this study, molecular methods were em­ployed to differentiate among the two species. The Internal Transcribed Spacer ITS 1 and ITS 4 regions of the rDNA of the two oyster species were amplified by the conventional PCR using the universal primer pair, ITS 1 and ITS 4 followed by restrictive digestion with enzymes, (Hh I, Hinf I, Rsa I and Hae III). The two species could not be separated based on the ampli­fied bands only, as both produced a characteristic band size of 650 bp. Gel profiling showing restrictive patterns generated by the four enzymes indicated that only the Hae III restrictive enzyme was effective in separating P. eous P-31 and P. ostreatus EM-1. This is the first record of the separation of the Ghanaian Pleurotus species by molecular methods indicating their genetic differences.

Molecular and pathological characterization of isolates of Colletotrichum falcatum Went. causing red rot in sugarcane

Red rot also known as cancer of sugarcane is caused by a pathogen Colletotrichum falcatum (Went.). The disease has a devastating effect as it hinders sugarcane cultivation worldwide. The major way to manage the disease is to develop the disease resistant varieties which require the study of genetic diversity of the pathogen. The present research aim was to study the pathogenic and molecular diversity among the isolates of red rot pathogen collected during surveys of major sugarcane growing areas of Punjab, Haryana and Uttar Pradesh states. Pathogenic assay of isolates on fourteen host differentials grouped them into eight groups on the basis of reaction expressed and virulence frequency. The molecular variation among the isolates using ISSR marker analysis showed high level of polymorphism, which confirmed the variation in virulence pattern of isolates. Polymorphism information content (PIC) and similarity coefficient values varied in the range of 0.227 to 0.321 and 0.29 to 0.93, respectively. The dendrogram grouped isolates in different clusters which reveal considerable level of molecular diversity among the isolates. However, the genetic diversity estimates based on ISSR markers did not show any correspondence with pathogenic variation of the isolates which could be due to same geographical conditions. Nucleotide sequences analysis of the ribosomal DNA (rDNA) genes using universal ITS primers showed the nucleotide variation in the isolates which could be due to base substitution at one to four sites which suggested its role in the origin of virulence and diversity in Colletotrichum falcatum. The presence of ITS variation in the virulent isolates suggested its role in the origin of virulence and diversity in Colletotrichum falcatum. But this needs further verification using proteomic approach for the identification of proteins expressed in relation to pathogenicity.

Molecular signature of nrDNA-ITS marker in Isodon rugosus (Lamiaceae)

Molecular features of nrDNA-ITS sequences in medicinal plant Isodon rugosus were assessed with universal ITS-1 and ITS-2 primers. ITS sequences of 46 Isodon species were defined for their respective ITS-1, 5.8S and ITS-2 regions through in-silico datamining and analysis. Only in 32 species, sequence of all the three defined regions was complete, while in the rest of 14 species was partial. Isodon rugosus revealed five genic regions, namely, 18S rRNA gene (partial sequence, > 1…..38), ITS-1 (complete sequence, > 39…..236), 5.8S rRNA gene (complete sequence, > 237…..400), ITS-2 (complete sequence, > 401…..607) and large subunit 26S rRNA gene (partial sequence, > 608…..672). The sequence regions were recorded with variable sites (VS), singleton (ST) and species-specific parsimonious-informative (PI) sites. The information was also collected in a phylogenetic tree obtained using the maximum likelihood (ML) method.

Molecular Depiction of Thirteen Indian Toxic Plants with ITS Markers

Plant identification is an overwhelming task due to different biological attributes and great diversity in plant species. In the absence of physical markers, molecular techniques have become useful for the identification of species of origin of medicinal plant seeds, pastes, and formulations of suspected plants. The ITS region of nuclear rRNA was amplified from thirteen different toxic plant species by using universal primer ITS 1 & 4. Nucleotide sequences of all selected plants were submitted in NCBI and accession numbers were acquired. The results of this study give accurate identification of thirteen plant species and proved the ITS region of 18s-26s nuclear ribosome to be an important tool for phylogenetic analysis and species identification of plants. The sequence was aligned with top matched reference sequence and presented in Clustal Omega software for making a phylogenetic neighbour tree. The significance of these findings is paramount in forensic toxicology scenarios especially when fragmentary plant material is found in the stomach/intestine and its morphological identification becomes impossible. In these circumstances, the PCR based molecular technique surely plays a significant role in solving complicated forensic cases.

Morphological and molecular characterization of Saprolegnia spp. from Himalayan snow trout, Schizothorax richardsonii: A case study report

Snow trout, Schizothorax richardsonii, in early as well as in advance life stages are highly susceptible to Saprolegnia spp. infections. In the present study, we aimed to identify the Saprolegnia spp. from different life stages of infected snow trout eggs, juveniles, and adults from two geographic regions, Bhimtal and Champawat of Central Himalaya, India. Morphological identification was carried out by microscopic observation of life stages of Saprolegnia. For the molecular characterization, the internal transcribed spacer region (ITS) was amplified using universal primers ITS 1 and ITS 4. On the basis of the morphological and molecular findings, we have identified two Saprolegnia species from snow trout, i.e., Saprolegnia parasitica from eggs and adults; and S. australis from eggs and juveniles. In particular, S. parasitica was isolated from both geographical regions and S. australis only from Bhimtal, where a comparatively higher temperature regime prevails. An in-vitro experiment was conducted to study the growth of Saprolegnia spp. in varying incubation temperatures. The results confirmed that S. australis could not thrive at or below 7 °C, whereas S. parasitica could grow within the temperature range of 4–20 °C.

KECURANGAN AKADEMIK: FRAUD DIAMOND, PERILAKU TIDAK JUJUR, DAN PERSEPSI MAHASISWA

Academic cheating, especially those committed by students, is a worrying phenomenon that should not occur. Dishonest behavior is one of the factors causing the fraud. Pressure, opportunity and rationalization are other factors that cause students to cheat. The purpose of this study was to determine the analysis of diamond fraud p, dishonest behavior, and student perceptions influence academic cheating, the control variables used were religiosity and technological progress. This research approach is a mix method (mix methods). The object of research is Pamulang University S1 Accounting Study Program in odd semester 2018/2019 with a sample of 142 people. All questions are submitted via Google Drive. For data processing using SPSS version 22. The result of data processing requires diamond fraud to have a significant positive effect on academic fraud. There are 1.5% of students stating academic cheating related to the absence and collusion during exams, this is due to the pressure and ability of more than the individual student. And 3.9% of students are proven to have plagiarism when e-learning and writing papers, this is done because of the often wrong rationalization of unscrupulous students. Person of the student usually justifies what he usually does not accustom the right. Student perceptions and dishonest behavior did not have a significant effect on academic fraud. Keywords: Fraud diamond; dishonest behavior; student perception; academic cheating

Influence of selected native yeast starter cultures on the antioxidant activities, fermentation index and total soluble solids of Malaysia cocoa beans: A simulation study

Antioxidant activity of cocoa beans is often influenced by drying and roasting stages. In this study, 13 naturally-existing yeast strains were isolated and used as a starter culture and the resulted antioxidant properties of cocoa beans were determined by total polyphenols content (TPC), 2, 2-Diphenyl-1-picrylhydrazyl (DPPH) free radical scavenging activity and total flavonoids content (TFC). The isolated yeasts were identified via sequencing using universal primers ITS 1 and 4. Results revealed that the 13 naturally-existing yeast strains were Pichia kudriavzevii (MH979676, MH979680, MH979681, and MH979677), Hanseniaspora thailandica (MH979675), Hanseniaspora species (MH979678), Wickerhamomyces species (MH979679), Saccharomyces cerevisiae (MH979683), Hanseniaspora opuntiae (MH979684) and Candida quercitrusa (MH979685, MH979687, MH979686 and MH979682). Yeasts were selected based on the phylogenetic analysis, where each species of different genus (except Candida genus) was used as a starter culture. Dried cocoa beans inoculated with isolates (Hanseniaspora thailandica, Pichia kudriavzevii, Hanseniaspora opuntiae, Hanseniaspora species, Wickerhamomyces species and Saccharomyces cerevisiae) contained TPC, TFC and DPPH ranging from 21.82 to 69.81 mg/g Gallic acid (GAE), 1.68–6.33 mg/g Catechin and 113.85 to 328 μmol/g Trolox (TE), respectively. It is noted that there was no significant change of the antioxidant activity between isolates at 24-h to 120-h fermentation. Based on the current study, Hanseniaspora thailandica and Pichia kudriavzevii are the potential starter cultures that result in cocoa beans with higher antioxidant content (p < 0.05) compared to natural fermentation.

Basic Tax Training to Improve Compliance of Fish Farmer Taxpayers in Jampang Village, Bogor [Pelatihan Dasar Perpajakan Untuk Meningkatkan Kepatuhan Wajib Pajak pada Petani Ikan Desa Jampang, Bogor

Compliance with taxpayers is important for optimal state revenue.. Jampang Village, located in Bogor Regency, is a village with the potential of residents, mostly in the form of fish farmers who already have market share and communities. The livelihood of most residents is the cultivation of freshwater fish. With a community education background that is mostly only up to high school, fulfilling tax obligations is one thing that is quite difficult. The lecturers of the Pamulang University S1 study program facilitate the provision of basic tax training with the aim of fostering awareness and willingness of farmers to contribute as tax-compliant citizens. The training provided for three days also aims to have the ability to simply calculate personal income tax and UMKM final taxes. The basic tax training was given to 75 participants by lecturing, discussion and question and answer. The material provided in addition to General Taxation Provisions, Personal Income Tax and Income Tax for MSMEs.

First Report of Northern Stem Canker Caused by Diaporthe caulivora on Soybean in Western Canada

In 2017, soybean (Glycine max) plants (cv. 24-10RY, R1 growth stage) with dead brown leaves associated with light to dark reddish-brown lesions and necrosis of the lower half of the stem, especially at the base of branches, were collected at Carman, Manitoba. Reddish-brown discoloration was observed inside stems when split in half. Severely infected plants wilted and desiccated. These symptoms are typical of Northern stem canker (Fernandez et al. 1999). Small pieces of the diseased stems (1 to 2 cm) were surface sterilized in 0.5% NaOCl and then rinsed twice in sterilized water, air dried on sterilized filter papers, and plated on potato dextrose agar (PDA) amended with 100 mg/liter of streptomycin sulfate at room temperature with 12-h light/12-h dark for 3 days. The growing hyphae were transferred using the hyphal tip method to new PDA plates and incubated for 3 weeks at room temperature. Cultures produced white-to-brown colonies interspersed with cottony tufts of mycelium. Stromata were small and scattered irregularly on the plate (Fernandez et al. 1999). The identity of the recovered isolate (Carm15) was confirmed by sequencing the internal transcribed spacer (ITS) region and β-tubulin gene. The ITS region was amplified using the universal ITS1 and ITS4 primers (Glass and Donaldson 1995). The β-tubulin gene was amplified using primers T1 and T22 (O’Donnell and Cigelnik 1997). PCR products (∼650 bp for ITS; ∼1,500 bp for β-tubulin) were purified with the Wizard SV Gel and PCR Clean-Up System (Promega, U.S.A.) and sequenced (Macrogen, U.S.A.). Using BLASTN searches (Altschul et al. 1990), the ITS sequence of Carm15 (GenBank accession MH299927) matched the type sequence of Diaporthe caulivora strain CBS 127268 (accession NR_111845) from G. max in Croatia with identities = 546/546 (100%) and gaps = 0/546 (0%). The β-tubulin gene sequence of Carm15 (GenBank accession MH732622) matched the type sequence of D. caulivora strain CBS 127268 (accession KC344013) with identities = 703/703 (100%) and gaps = 0/703 (0%). To confirm the pathogenicity of Carm15, soybean plants (cv. 24-10RY) were grown in the greenhouse. The stems of 15 plants at the V3 stage were excised just below the fourth node. Mycelial plugs (9 mm in diameter) from a 1-week-old culture of Carm15 grown on PDA at 25°C were placed over stems previously wounded with a sterile scalpel (Vrandecic et al. 2005). Sterile PDA control plugs were placed over cut soybean stems of another 15 plants of the same cultivar. Plugs of both treatments were wrapped with Parafilm to avoid drying. The plants were incubated in a moist chamber for 3 days and then left to grow on a greenhouse bench at 24:16°C day/night temperature, 13:11-h light/dark cycle, 80% relative humidity, and daily watering. Symptoms similar to those observed in the field were visible on the stems of all inoculated soybean plants. Lesions extended from the inoculation sites after 27 days. No symptoms were observed on control plants. The pathogen was reisolated from infected stems (Carm15GH) and identified as D. caulivora as above; the ITS and β-tubulin sequences of Carm15GH were identical to those of Carm15. The experiment was repeated twice. To our knowledge, this is the first report of Northern stem canker on soybean in Western Canada. Documenting the occurrence of Northern stem canker in Western Canada is important because it can have a significant impact on soybean yield, potentially resulting in up to 50% loss (Fernandez et al. 1999).

Genetic Diversity of Fusarium Oxysporum Races Associated with Cowpea Fields in Kakamega County

Fusarium oxysporum is the most abundant and most damaging species of the genus Fusarium responsible forcrop wilt diseases in cultivated fields. It possess risk to production of banana, tomato, onions, beans, peas, palm,wheat, sorghum, maize, potatoes, garlic and cowpea among others. Fusarium involves several species that producemycotoxins associated with serious animal diseases. Fusarium is a potential threat to global food security.Furthermore, disease incidence of pathogenic Fusarium species could increase due to the effects of the predictedglobal changes. Limitation of occurrence records and diversity of the races of F. oxysporum in Kakamega Countynecessitated this study. This study aimed to characterize strains of Fusarium pathogens in cowpea fields ofKakamega County. The colonies had sparse to abundant mycelia with colour ranging from white to pale violet. Theisolates gave rise to elliptical microchonidia without septa, smooth walled terminal and intercalary chlamydosporesat times singly and paired in some cases on microscopy. Further, PCR amplification of ITS gene region in the tenisolates of F. oxysporum was performed using universal ITS primers. Fusarium the genus was amplified as afragment of about 500 bp corresponding to the region between the 18S-28S rRNA intervening sequence forFusarium spp. The selected isolates of Fusarium spp. were sequenced and submitted in NCBI database with theaccession numbers of KY855504, KY855505, KY855506, KY855507, KY855508, KY855509, KY855510, KY855511,KY855512, KY855513 and KY855514. Eight soil-borne fungal isolates [KY855505, KY855506, KY855507,KY855508, KY855510, KY855511, KY855512 and KY855514] were identified as F. oxysporum based on its cultural,morphological and molecular characteristics. KY855504 and KY855509 had molecular identity to Ascotamycota andKY855513 had the molecular identity of Phoma sp. This study contributes knowledge on genetic diversity of localpathogenic Fusarium strains useful in crop breeding and disease management of cowpea crop in KakamegaCounty, Kenya