Two-step RT-PCR Research Articles

Validation and comparison of different end point and real time RT-PCR assays for detection and genotyping of porcine reproductive and respiratory syndrome virus

The accuracy and rapid diagnosis of PRRSV infection is a major prerequisite for every control and/or eradication strategy. In this study two real time RT-PCR based on different chemistry analysis (TaqMan Probes and SYBR Green) have been developed and validated before comparison to an end point two-step RT-PCR validated previously. All assays were aimed at discrimination between PRRSV genotypes. Furthermore, an exogenous internal control (IC) system had also been implemented in qRT-PCR. A rigorous analytical validation, executed on infected cell cultures and serum, demonstrated good sensitivity, specificity and repeatability. In particular RT-PCR was exceptionally sensitive and could detect a viral titre in the order of a magnitude of 1copies/μL, 10-fold lower than other qRT-PCR described in this study. Optimal diagnostic performances have been demonstrated analyzing samples retrieved from an experimental infection, with RT-PCR again outperforming real time RT-PCR assays. All tests, showing substantial agreement between them, were able to detect early stages of viraemia (1 DPI) and some animals were classified as positive until the end of the study (76 DPI). Therefore, this supports the assays usefulness in animals with different clinical conditions and in a broad range of epidemiological scenarios. The benefits and disadvantages of different assays were also considered and discussed.

Generic detection of poleroviruses using an RT-PCR assay targeting the RdRp coding sequence

In this study a two-step RT-PCR assay was developed for the generic detection of poleroviruses. The RdRp coding region was selected as the primers’ target, since it differs significantly from that of other members in the family Luteoviridae and its sequence can be more informative than other regions in the viral genome. Species specific RT-PCR assays targeting the same region were also developed for the detection of the six most widespread poleroviral species (Beet mild yellowing virus, Beet western yellows virus, Cucurbit aphid-borne virus, Carrot red leaf virus, Potato leafroll virus and Turnip yellows virus) in Greece and the collection of isolates. These isolates along with other characterized ones were used for the evaluation of the generic PCR's detection range. The developed assay efficiently amplified a 593bp RdRp fragment from 46 isolates of 10 different Polerovirus species. Phylogenetic analysis using the generic PCR's amplicon sequence showed that although it cannot accurately infer evolutionary relationships within the genus it can differentiate poleroviruses at the species level. Overall, the described generic assay could be applied for the reliable detection of Polerovirus infections and, in combination with the specific PCRs, for the identification of new and uncharacterized species in the genus.

Simultaneous detection of major pome fruit viruses and a viroid.

A rapid and sensitive two-step RT-PCR protocol for simultaneous detection of major apple viruses, namely Apple mosaic virus (ApMV), Apple stem pitting virus (ASPV), Apple stem grooving virus (ASGV), Apple chlorotic leaf spot virus (ACLSV) and Apple scar skin viroid (ASSVd), was developed. Five specific primer pairs were tested and confirmed for these viruses and viroid together in a single tube, giving amplicons of ~198, ~330, ~370, ~547 and ~645bp corresponding to ASGV, ASSVd, ASPV, ApMV and ACLSV, respectively. Using a guanidinium-based extraction buffer along with a commercial kit resulted in better quality RNA as compared to kit, suited for multiplex RT-PCR. A rapid CTAB method for RNA isolation from apple tissue was developed, which produce good yield and saves time. To the best of our knowledge, this is the first report on the simultaneous detection of five pathogens (four viruses and a viroid) from apple with NADH dehydrogenase subunit 5 (nad5) as an internal control.

Development and validation of a real-time two-step RT-qPCR TaqMan® assay for quantitation of Sacbrood virus (SBV) and its application to a field survey of symptomatic honey bee colonies

Sacbrood virus (SBV) is the causal agent of a disease of honey bee larvae, resulting in failure to pupate and causing death. The typical clinical symptom of SBV is an accumulation of SBV-rich fluid in swollen sub-cuticular pouches, forming the characteristic fluid-filled sac that gives its name to the disease. Outbreaks of the disease have been reported in different countries, affecting the development of the brood and causing losses in honey bee colonies. Today, few data are available on the SBV viral load in the case of overt disease in larvae, or for the behavioural changes of SBV-infected adult bees. A two-step real-time RT-PCR assay, based on TaqMan® technology using a fluorescent probe (FAM-TAMRA) was therefore developed to quantify Sacbrood virus in larvae, pupae and adult bees from symptomatic apiaries. This assay was first validated according to the recent XP-U47-600 standard issued by the French Standards Institute, where the reliability and the repeatability of the results and the performance of the assay were confirmed. The performance of the qPCR assay was validated over the 6 log range of the standard curve (i.e. from 102 to 108 copies per well) with a measurement uncertainty evaluated at 0.11log10. The detection and quantitation limits were established respectively at 50 copies and 100 copies of SBV genome, for a template volume of 5μl of cDNA. The RT-qPCR assay was applied during a French SBV outbreak in 2012 where larvae with typical SBV signs were collected, along with individuals without clinical signs. The SBV quantitation revealed that, in symptomatic larvae, the virus load was significantly higher than in samples without clinical signs. Combining quantitation with clinical data, a threshold of SBV viral load related to an overt disease was proposed (1010 SBV genome copies per individual).

Activation of the Leukotriene B4 Receptor 2-Reactive Oxygen Species (BLT2-ROS) Cascade following Detachment Confers Anoikis Resistance in Prostate Cancer Cells

The majority of prostate cancer-related deaths are associated with advanced and metastatic malignancies. Although anoikis resistance has been recognized as one of the hallmarks of metastatic prostate malignancies, the molecular events that cause anoikis resistance are poorly understood. In this study, we found that the detachment of PC-3 prostate cancer cells caused a time-dependent increase in the expression level of the leukotriene B4 receptor-2 (BLT2) and that BLT2 played a critical role in establishing anoikis resistance in these cells. Blocking BLT2 with the pharmacological inhibitor LY255283 or with RNAi knockdown clearly abolished anoikis resistance and resulted in severe apoptotic death. Additionally, we demonstrated that the activation of NADPH oxidase (NOX) and subsequent generation of reactive oxygen species (ROS) were downstream of BLT2 signaling and led to the activation of NF-κB, thus establishing anoikis resistance during cell detachment. Furthermore, we observed that the ectopic expression of BLT2 in normal prostate PWR-1E cells rendered the cells resistant to anoikis and apparently diminished apoptotic cell death following detachment. Taken together, our results suggest that BLT2-NOX-ROS-NF-κB cascade induction during detachment confers a novel mechanism of anoikis resistance in prostate cancer cells and potentially contributes to prostate cancer progression.

Serological and Molecular Detection of Prune dwarf Virus Infecting Stone Fruits of Charmahal-va-Bakhtiari Province, a Central Region of Iran

Prune dwarf virus (PDV) is one of the major positive RNA viruses which cause economical damages in stone fruit trees. The symptoms of PDV vary between different stone fruits namely sour and sweet cherry, almond, peach, apricot and plum including leaf narrowing, leaf chlorosis, vein clearing, mosaic, leaf whitening, leathery leaf, bushy branches and stunt trees. During the years 2011 and 2012, 251 leaf samples were collected for detection of PDV in stone fruit orchards of Charmahal-va-Bakhtiari province. DAS-ELISA test proved PDV presence serologically. Then, total RNA were extracted and tested by two-step RT-PCR which replicated partial and full coat protein sequence of PDV. One hundred and eighty one out of total samples (251 samples) showed PDV infection using serological and two-step RT-PCR assays, hence, incidence of PDV in Charmahal-va-Bakhtiari province was confirmed. This is the first report of PDV in stone fruit orchards of Charmahal-va-Bakhtiari province and in Iran.

September through October 2010 multi-centre study in the Netherlands examining laboratory ability to detect enterovirus 68, an emerging respiratory pathogen

During September and October 2010, the Dutch Public Health Institute detected an enterovirus (EV) 68 (EV68) epidemic in the Netherlands through general practitioner-based surveillance of acute respiratory infections. EV68 shares phenotypic and genotypic properties with human rhinovirus (HRV). Despite increased EV and HRV detections, Dutch clinical laboratories did not identify EV68. To assess the capability of Dutch clinical laboratories to detect EV68, ten laboratories with more than eight detected EV and HRV cases in September and October 2010 provided information about their detection algorithms and testing results for a 2010 Dutch EV68 strain. For EV detection mostly stool specimens (median 49%), respiratory specimens (median 27%) and cerebrospinal fluid (median 22%) were used. For HRV detection only respiratory specimens were used. Except for the Seeplex® RV15ACE EV-specific assay, all EV and 73% of HRV assays, including those of the Public Health Institute, were able to detect EV68. Two-step EV RT-PCR protocols were the most sensitive. Thus, laboratories might have misidentified EV68 as HRV. In addition, EV68 cases might have also been missed because patients with respiratory diseases are usually not tested for EV infection. Therefore, clinical laboratories should include EV detection in the differential diagnosis of patients presenting with respiratory symptoms.

Evaluation of Expression of Lipases and Phospholipases ofMalassezia restrictain Patients with Seborrheic Dermatitis

BackgroundMalassezia species (spp.) are cutaneous opportunistic pathogens and associated with various dermatological diseases including seborrheic dermatitis, dandruff and atopic dermatitis. Almost all Malassezia spp. are obligatorily lipid-dependent, which might be caused by lack of the myristic acid synthesis. Recent genome analysis of M. restricta and M. globosa suggested that the absence of a gene encoding fatty acid synthesis might be compensated by abundant genes encoding hydrolases, which produce fatty acids, and that lipases and phospholipases may play a role in virulence of the fungus.ObjectiveThe current study aimed to investigate the contribution of lipases and phospholipases in virulence of the M. restricta as being the most frequently isolated Malassezia spp. from the human skin.MethodsSwap samples of two different body sites of at least 18 patients with seborrheic dermatitis were obtained and in vivo expression of lipases and phospholipases of M. restricta was analyzed by the gene specific two-step nested RT-PCR.ResultsThe results of the current study suggest that majority of the patients display expression of lipase RES_0242.ConclusionThese data imply a possible role of lipase in the host environment to produce free fatty acids for the fungus.

The Complete Genome Sequence of Southern rice black-streaked dwarf virus Isolated from Vietnam

Faculty of Agriculture Forestry Fisheries, Vinh University, Vinh city, Nghe An province 42000, Vietnam(Received on March 21, 2012; Revised on July 3, 2012; Accepted on July 11, 2012)We determined the complete genome sequence of aVietnamese isolate of Southern rice black-streaked dwarfvirus (SRBSDV). Whole genome comparisons andphylogenetic analysis showed that the genome of theVietnamese isolate shared high nucleotide sequenceidentities of over 97.5% with those of the reportedChinese isolates, confirming a common origin of them.Moreover, the greatest divergence between differentSRBSDV isolates was found in the segments S1, S3, S4and S6, which differs from the sequence alignmentresults between SRBSDV and Rice black streaked dwarfvirus (RBSDV), implying that SRBSDV evolved in aunique way independent of RBSDV. This is the firstreport of a complete nucleotide sequence of SRBSDVfrom Vietnam and our data provides new clues forfurther understanding of molecular variation andepidemiology of SRBSDV in Southeast Asia.Keywords : phylogenetic analysis, sequence, Southern riceblack-streaked dwarf virus, vietnamese isolate Southern rice black-streaked dwarf virus (SRBSDV) isproposed to be a novel member of the Fijivirus group 2 inthe family Reoviridae (Attoui, 2011; Zhang et al., 2008;Zhou et al., 2008). The double-stranded (dsRNA) ofSRBSDV contains 10 segments (S1 to S10), which werenamed in order of decreasing molecular weight (Zhou et al.,2008). SRBSDV was first observed in Yangxi county,Guangdong province in China in 2001. From then on, thisdisease became one of the most serious viral diseases ofrice in southern and central China, causing severe losses inrice production (Wang et al., 2010; Zhou et al., 2010). In2008, SRBSDV was also detected in maize plants innorthern China (Yin et al., 2011). In 2010, the occurrence ofSRBSDV disease was firstly reported in rice fields in theKumamoto Prefecture of Japan (Choi, 2010). In 2009, seriousviral rice disease occurred in many northern provinces ofVietnam, expanding to a total of 5506 hectares. Of this area,the yields of approximately 3510 hectares were totally lost.The causal agent of the rice dwarf disease in the north ofVietnam has also been identified as SRBSDV (Cuong et al.,2009; Hoang et al., 2011). Further investigation suggestedthat the outbreak of SRBSDV in Vietnam was associatedwith rising populations of the white-backed plant hopper(Sogatella furcifera), which is the major vector of SRBSDV(Cuong et al., 2009; Zhou et al., 2008). As planthoppers areconstantly displaced by wind currents, the spread of thevirus diseases they carry will be inevitable.Symptoms of SRBSDV infection vary depending on thecrop age when infected. Characteristic symptoms includedark-green and wrinkled leaves, incomplete tassel, tumor-like protrusions ending in small enations, tiller formation onthe upper parts, up-growing rootlets, and in particular thepresence of white to black waxy galls along the major veinsof the leaves and culms (Wang et al., 2012; Zhou et al.,2008; Zhou et al., 2010). Up to now, the complete genome sequence of SRBSDVhad been obtained only for three isolates, which originatedfrom Guangdong (GD), Hainan (HN) and Hubei (HB)provinces of China, respectively (Wang et al., 2010). Asonly partial sequences of segments 4 and 10 from severalVietnamese isolates were investigated and the S10 segmentwas very conserved among different isolates (Cuong et al.,2009; Hoang et al., 2011), more information about thegenome sequence of an SRBSDV isolate from Vietnamwill further characterize the geographic and molecularvariation of this virus, thus facilitating control and preven-tion of this disease in Southeast Asia.Viral genomic dsRNAs were extracted directly fromnaturally infected field-grown rice plants from Thua ThienHue province in central Vietnam using the method describ-ed previously (Dodds et al., 1984). Primers for cloningsegments S1 to S10 of Vietnamese isolate were designed toobtain the full length sequence of each genome segmentbased on the previously reported SRBSDV sequencesavailable in GenBank of NCBI (Wang et al., 2010). Twostep RT-PCR was employed to clone cDNA fragments of

Two generic PCR primer sets for the detection of members of the genus Torradovirus

Two degenerate primer pairs were designed for the universal detection of members of the genus Torradovirus. Primer pair Torrado-1F/Torrado-1R was designed based on the RNA-dependent RNA polymerase region located in RNA1 and primer pair Torrado-2F/Torrado-2R based on a region overlapping the two first coat proteins Vp35 and Vp26 in RNA2. The primers were used in two-step and one-step RT-PCR protocols. Both primer pairs were able to detect 14 out of 15 isolates belonging to the two torradovirus species Tomato torrado virus (ToTV) and Tomato marchitez virus (ToMarV) and the two tentative species Tomato chocolate spot virus (ToChSV) and Tomato chocolàte virus (ToChV). Due to poor sample quality, one isolate of ToTV was detected with primer pair Torrado-2F/Torrado-2R and not with primer pair Torrado-1F/Torrado-1R, suggesting that the latter primer pair was less sensitive. Nevertheless, both primer pairs proved to be suitable for the universal RT-PCR detection of torradoviruses and can be deployed for the detection of all currently known torradoviruses and possibly for the detection of new members of this group.

Design and validation of consensus-degenerate hybrid oligonucleotide primers for broad and sensitive detection of corona- and toroviruses

The ssRNA+ family Coronaviridae includes two subfamilies prototyped by coronaviruses and toroviruses that cause respiratory and enteric infections. To facilitate the identification of new distantly related members of the family Coronaviridae, we have developed a molecular assay with broad specificity. The consensus-degenerated hybrid oligonucleotide primer (CODEHOP) strategy was modified to design primers targeting the most conserved motifs in the RNA-dependent RNA polymerase locus. They were evaluated initially on RNA templates from virus-infected cells using a two-step RT-PCR protocol that was further advanced to a one-step assay. The sensitivity of the assay ranged from 10 2 to 10 6 and from 10 5 to 10 9 RNA copy numbers for individual corona-/torovirus templates when tested, respectively, with and without an excess of RNA from human cells. This primer set compared to that designed according to the original CODEHOP rules showed 10–10 3 folds greater sensitivity for 5 of the 6 evaluated corona-/torovirus templates. It detected 57% (32 of 56) of the respiratory specimens positive for 4 human coronaviruses, as well as stool specimens positive for a bovine torovirus. The high sensitivity and broad virus range of this assay makes it suitable for screening biological specimens in search for new viruses of the family Coronaviridae.

Rapid discrimination of Tomato chlorosis virus, Tomato infectious chlorosis virus and co-amplification of plant internal control using real-time RT-PCR

Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV) (genus: Crinivirus, family: Closteroviridae) are two emergent whitefly-transmitted viruses that have been associated with yellowing symptoms of tomato crops during the last two decades. A real-time, one-step reverse transcription (RT) TaqMan ® polymerase chain reaction (PCR) assay was developed and optimized for the multiplex detection of TICV, ToCV and an internal control of mitochondrion cytochrome oxidase subunit I (mtCOXI) gene from plants. The plant mtCOXI assay can be used as an internal control in at least 77 plant species from 28 different families. The one-step RT TaqMan PCR assay successfully detected and discriminated the two virus species in infected tomato plants, other host plants and their whitefly vectors. In direct comparison, the assay was approximately 10,000-fold and 100-fold more sensitive than conventional one-step RT-PCR and two-step nested RT-PCR, respectively. The increased sensitivity allowed the use of alternative template preparation methods that do not require RNA purification. The assay can be performed either by the direct addition of crude plant extract into the real-time reaction mixture or alternatively, the sap extract can be blotted on a positively charged nylon membrane, eluted and added in the reaction mixture. The developed assay allows the simple, fast and cost-effective testing of a large number of samples and can be easily applied in surveys and certification schemes.

Two-Step RT-PCR Kit

Two-Step RT-PCR Kit

Clinical applicability of single‐tube multiplex reverse‐transcriptase PCR in dengue virus diagnosis and serotyping

This study has evaluated the clinical applicability of a single-tube multiplex RT-PCR as compared with a two-step nested RT-PCR for the diagnosis as well as serotyping of dengue virus in patient's samples. Seventy-six acute phase blood samples collected from clinically suspected dengue patients during the 2008 outbreak were subjected to two-step nested RT-PCR and single-tube multiplex RT-PCR for dengue diagnosis and serotyping. Of the 76 samples, 17 (22.4%) were positive for dengue viral RNA. Single dengue virus infection was found in 16 cases and 1 had concurrent infection with two serotypes (3&1). Dengue serotype 3 was the predominant serotype (70.5%), followed by serotype 1 (23.5%). Single-tube multiplex PCR had concordant result with that of two-step nested RT-PCR including the one with concomitant infection. This study reveals the predominance of dengue serotype 3 in North India in addition to the co-circulation of multiple serotypes and concomitant infection. The rapid and accurate diagnostic capability of single-tube multiplex RT-PCR used in the study appears to be promising enough to be commonly used for dengue viral detection as well as serotyping.

Occurrence of Three Genotypes of Sugarcane Yellow Leaf Virus in a Variety Collection in Mauritius

Sugarcaneyellow leaf virus (SCYLV) is widely distributed in Mauritius, but so far the characterisation of genotypes of the virus has not been determined. RT-PCR primers were used to identify genetic diversity of the virus in a variety collection plot. Total nucleic acids were extracted from leaves of thirteen introduced varieties infected by SCYLV and a two-step RT-PCR was optimised for each of the three genotype-specific primer pairs CUB-F/CUB-R, REU-F/B-REV, and PER-F/PER-R tested. The presence of three SCYLV genotypes namely the BRA-PER, CUB and REU was confirmed in the germplasm collection. Genotype REU was observed in 10 varieties while 4 varieties were infected by genotype BRA-PER. Mixed infection with genotypes CUB and REU was observed in variety Co6304 while Q88 was co-infected by genotypes BRA-PER and REU. PCR fragments of 363 bp (BRA-PER), 452 bp (CUB) and 905 bp (REU) amplified from varieties PR67245, Co6304 and S17 were cloned and sequenced. Blast analysis of these three sequences showed high homologies with the corresponding genotype sequences from GenBank—100% similarity with isolate Taiwl (AJ491144, BRA genotype), and >99% similarity with isolates CUB-YL1 (AM083988) and REU-YL2 (AM072756) respectively. Recent screening of some local commercial cultivars revealed infection by REU and BRA-PER genotypes. Further intensive surveys are being carried out to assess the distribution of the three SCYLV genotypes in sugarcane fields in Mauritius.

Development and validation of a two-step real-time RT-PCR for the detection of eel virus European X in European eel, Anguilla anguilla

Eel virus European X (EVEX) is one of the most common pathogenic viruses in farmed and wild European eel (Anguilla anguilla) in the Netherlands. The virus causes a hemorrhagic disease resulting in increased mortality rates. Cell culture and antibody-based detection of EVEX are laborious and time consuming. Therefore, a two-step real-time reverse transcriptase (RT-)PCR assay was developed for rapid detection of EVEX. Primers and probe for the assay were designed based on a sequence of the RNA polymerase or L gene of EVEX. The real-time RT-PCR assay was validated both for use with SYBR Green chemistry and for use with a TaqMan probe. The assay is sensitive, specific, repeatable, efficient and has a high r2-value. The real-time RT-PCR assay was further evaluated by testing field samples of European eels from the Netherlands, which were positive or negative for EVEX by virus isolation followed by an indirect fluorescent antibody test. The real-time RT-PCR assay allows rapid, sensitive and specific laboratory detection of EVEX in RNA extracts from 10% eel organ suspensions and cell cultures with cytopathic effects, and is a valuable contribution to the diagnosis of viral diseases of eel.

Folic Acid Remodels Chromatin on Hes1 and Neurog2 Promoters during Caudal Neural Tube Development

The mechanism(s) behind folate rescue of neural tube closure are not well understood. In this study we show that maternal intake of folate prior to conception reverses the proliferation potential of neural crest stem cells in homozygous Splotch embryos (Sp(-/-)) via epigenetic mechanisms. It is also shown that the pattern of differentiation seen in these cells is similar to wild-type (WT). Cells from open caudal neural tubes of Sp(-/-) embryos exhibit increased H3K27 methylation and decreased expression of KDM6B possibly due to up-regulation of KDM6B targeting micro-RNAs such as miR-138, miR-148a, miR-185, and miR-339-5p. In our model, folate reversed these epigenetic marks in folate-rescued Sp(-/-) embryos. Using tissue from caudal neural tubes of murine embryos we also examined H3K27me2 and KDM6B association with Hes1 and Neurog2 promoters at embryonic day E10.5, the proliferative stage, and E12.5, when neural differentiation begins. In Sp(-/-) embryos compared with WT, levels of H3K27me2 associated with the Hes1 promoter were increased at E10.5, and levels associated with the Neurog2 promoter were increased at E12.5. KDM6B association with Hes1 and Neurog2 promoters was inversely related to H3K27me2 levels. These epigenetic changes were reversed in folate-rescued Sp(-/-) embryos. Thus, one of the mechanisms by which folate may rescue the Sp(-/-) phenotype is by increasing the expression of KDM6B, which in turn decreases H3K27 methylation marks on Hes1 and Neurog2 promoters thereby affecting gene transcription.

Antiretroviral activity of two polyisoprenylated acylphloroglucinols, 7-epi-nemorosone and plukenetione A, isolated from Caribbean propolis

Polyisoprenylated acylphloroglucinols have recently emerged as antitumoral agents. This study aims at elucidating the antiretroviral activity of two such compounds which were isolated from Caribbean propolis: 7-epi-nemorosone and plukenetione A, the structure of which is based on an adamantane moiety. Plukenetione A is for the first time shown to have antiretroviral activity. The isolation of both small molecules was carried out using RP-HPLC. Their antiretroviral activity was studied based on lentiviral particles produced in HEK293T cells from the SIV-based vector VLDBH; their cytotoxicity was monitored by MTT proliferation assay. The antiviral activity of 7-epi-nemorosone was studied in CEMx174-SEAP infected with the HIV-1-strain pNL4.3wt. Reverse transcriptase inhibition was determined by a standard two-step RT-PCR using MMLV RT. 7-epi-nemorosone and plukenetione A were found to be potent antilentiviral agents in the employed system, inhibiting viral infection at concentrations below 1 µM/2 µM, respectively. Whereas 7-epi-nemorosone was not able to inhibit the reverse transcriptase in vitro (IC50 > 25 µM), plukenetione A effectively inhibited its enzymatic activity at an IC50 of 1.75 µM. Despite 7-epi-nemorosone and plukenetione A sharing some structural core elements, the mechanism of action involved in their antiretroviral activity seems to be different. We propose that 7-epi-nemorosone inhibits the viral replication by interrupting the Akt/PKB signaling cascade, as was demonstrated previously in various cell lines. Since plukenetione A effectively inhibits the enzymatic activity of MMLV reverse transcriptase at concentrations that show antilentiviral activity, we suggest that this small molecule acts by interfering with the enzyme's catalytic site.

Effects of in ovo exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin on hepatic AHR/ARNT-CYP1A signaling pathways in common cormorants (Phalacrocorax carbo)

Our previous studies have isolated multiple isoforms of aryl hydrocarbon receptors (AHRs) and AHR nuclear translocators (ARNTs) in avian species. However, roles of such genes on cytochrome P450 1A (CYP1A) expression are not fully understood. To investigate the effects of dioxins on the hepatic expression profiles of AHR1, AHR2, ARNT1 and ARNT2 in avian species, and whether the expression levels of AHRs and ARNTs affect the transcriptions of CYP1A4 and CYP1A5 genes, the eggs of common (great) cormorants (Phalacrocorax carbo) collected from Lake Biwa, Japan, were in ovo administrated with 0, 1500 and 4500pg/g egg of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), and the hepatic expression levels of AHRs, ARNTs and CYP1As in embryos were monitored with two-step real-time RT-PCR. In young and adult cormorants collected from the same location, the hepatic expressions of these genes were also measured to understand the effects of growth stage. The residue levels of TCDD and other chlorinated dioxin-like congeners (DLCs) in the body of cormorants were quantified with high-resolution gas chromatography equipped with mass-spectrometry. There was no observable effect of in ovo TCDD treatment even at the highest dosage on mortality, body weight and morphology of the liver, heart, spleen, kidney and lung in the embryos. The mRNA expression of ARNT2 was slightly suppressed by the treatment with TCDD, while no alteration was observed for the expression of AHR1, AHR2 and ARNT1. Expressions of CYP1A4 and CYP1A5 were dose-dependently enhanced by TCDD, but CYP1A4 mRNA level increased more prominently than CYP1A5, indicating the difference in induction efficiency between the CYP1A isozymes. Comparison of hepatic mRNA levels of these genes among embryonic, young and adult cormorants revealed that young and adult cormorants had greater CYP1A5 expression levels than embryos, independently of the accumulation levels of DLCs. These results suggest that the hepatic induction of each CYP1A by DLCs in cormorants occurs in an isoform-specific manner and CYP1A5 expression, at least partially, depends on the factors related to the growth of cormorants, but the transcriptional processes of CYP1As are not related to the expression levels of AHRs and ARNTs. This study yielded results supporting our previous observations that in reality, high accumulation of DLCs induces hepatic CYP1A4 and 1A5 expressions in the wild cormorant population.

First report of Carnation mottle virus in Turkey

Carnation (Dianthus caryophyllus) is the most important cut flower produced in Turkey. However, yield and quality are lower than carnations from Turkey’s international competitors (Tascioglu & Sayin, 2005). This could be due to virus infections causing reduction of yield, size and the quality of the flowers. Detection of Carnation mottle virus (CarMV) in other countries (Sanchez-Navarro et al., 1999; Singh et al., 2005) and the presence of suspect plants in Antalya prompted screening for CarMV. Surveys were conducted in the greenhouses of three different carnation producers in Antalya and 17 samples representing 17 different cultivars were collected. Total RNA was isolated from 100 mg leaf samples from plants using a one-step RNA isolation method (BioBasic). A set of primers specific to the conserved sequences of CarMV coat protein (CP) gene was designed (sense BC57 5’ GATCGCGATGAATCCCA CTGTGC 3’ and anti-sense BC58 5’ TCACATCCTATAAACAACCATTG 3’) using sequences available in GenBank. Samples were tested for CarMV by a two-step RT-PCR method, using PrimeScript RT-PCR kit (Takara) and the specific primers. No amplification was observed in the healthy control whereas a 1000 bp fragment corresponding to the CP gene of CarMV was amplified from a positive control. When the greenhouse samples were tested by RT-PCR, the 1000 bp fragment was amplified from 15 of 17 samples demonstrating that major carnation cultivars commonly grown in the most important carnation production region of Turkey were infected with CarMV. To confirm these results, an amplicon from the RT-PCR was sequenced and submitted to GenBank (Accession No. FJ825618). The sequence of the amplicon showed 99% nt identity with the CP gene of CarMV isolate ITALY-ca4 (EF622209). The same samples were also tested for Carnation etch ring virus and Carnation ringspot virus, but none of the samples tested positive. Despite the small sample size, detection of CarMV in all the cultivars grown in the Antalya region indicated that CarMV has potential economical significance. Although typical mottling symptoms were not observed, growth retardation, narrowed leaves and small flowers resulting in reduced yield and quality of flowers that could be attributed to CarMV infection and represents the first report of CarMV in Turkey.