Triple Antibody Research Articles

Clinical manifestations and maternal and perinatal outcomes in pregnant women with obstetric antiphospholipid syndrome at a high complexity institution: Descriptive study

ObjectiveTo describe the clinical characteristics, as well as the maternal and perinatal outcomes in pregnant women with the antiphospholipid syndrome in a reference institution. Materials and methodsA retrospective descriptive study was carried out in order to evaluate pregnant women with antiphospholipid syndrome according to Sydney criteria or rheumatologist criteria between 2010 and 2016. Cases with hereditary thrombophilia, cervical incompetence, history of hepatitis B, hepatitis C, and human immunodeficiency virus were excluded. The information on sociodemographic and clinical variables was collected from the review of medical records. ResultsSixteen pregnant women were included; seven (43.8%) patients had a history of abortion, five (71.4%) on more than one occasion; these losses occurred after week ten. Nine (56.3) had antiphospholipid syndrome associated with systemic lupus erythematosus. The main serological marker was lupus anticoagulant in 12 (75%) pregnant women. Two (12.5%) patients had triple positivity and six (37.5%) double positivity of antiphospholipid antibodies. The most frequent obstetric complications were premature rupture of membranes (28.6%), pre-eclampsia (13.3%), and placental insufficiency (11.8%), which were more common in patients with systemic lupus erythematosus, as well as in those with triple and double antiphospholipid antibody positivity. ConclusionsObstetric antiphospholipid syndrome was associated with systemic lupus erythematosus in the majority of cases; however, the latter was in remission. The worst obstetric outcomes were observed in patients with this association or in cases with triple or double antiphospholipid antibody positivity.

Manifestaciones clínicas y desenlaces maternos y perinatales en gestantes con síndrome antifosfolípido obstétrico de una institución de alta complejidad: estudio descriptivo

ObjectiveTo describe the clinical characteristics, as well as the maternal and perinatal outcomes in pregnant women with the antiphospholipid syndrome in a reference institution. Materials and methodsA retrospective descriptive study was carried out in order to evaluate pregnant women with antiphospholipid syndrome according to Sydney criteria or rheumatologist criteria between 2010 and 2016. Cases with hereditary thrombophilia, cervical incompetence, history of hepatitis B, hepatitis C, and human immunodeficiency virus were excluded. The information on sociodemographic and clinical variables was collected from the review of medical records. ResultsSixteen pregnant women were included; seven (43.8%) patients had a history of abortion, five (71.4%) on more than one occasion; these losses occurred after week ten. Nine (56.3) had antiphospholipid syndrome associated with systemic lupus erythematosus. The main serological marker was lupus anticoagulant in 12 (75%) pregnant women. Two (12.5%) patients had triple positivity and six (37.5%) double positivity of antiphospholipid antibodies. The most frequent obstetric complications were premature rupture of membranes (28.6%), pre-eclampsia (13.3%), and placental insufficiency (11.8%), which were more common in patients with systemic lupus erythematosus, as well as in those with triple and double antiphospholipid antibody positivity. ConclusionsObstetric antiphospholipid syndrome was associated with systemic lupus erythematosus in the majority of cases; however, the latter was in remission. The worst obstetric outcomes were observed in patients with this association or in cases with triple or double antiphospholipid antibody positivity.

Remission of autoimmune diabetes by anti-TCR combination therapies with anti-IL-17A or/and anti-IL-6 in the IDDM rat model of type 1 diabetes

BackgroundThe cytokine IL-17 is a key player in autoimmune processes, while the cytokine IL-6 is responsible for the chronification of inflammation. However, their roles in type 1 diabetes development are still unknown.MethodsTherefore, therapies for 5 days with anti-IL-17A or anti-IL-6 in combination with a T cell-specific antibody, anti-TCR, or in a triple combination were initiated immediately after disease manifestation to reverse the diabetic metabolic state in the LEW.1AR1-iddm (IDDM) rat, a model of human type 1 diabetes.ResultsMonotherapies with anti-IL-6 or anti-IL-17 showed no sustained anti-diabetic effects. Only the combination therapy of anti-TCR with anti-IL-6 or anti-IL-17 at starting blood glucose concentrations up to 12 mmol/l restored normoglycaemia. The triple antibody combination therapy was effective even up to very high initial blood glucose concentrations (17 mmol/l). The β cell mass was raised to values of around 6 mg corresponding to those of normoglycaemic controls. In parallel, the apoptosis rate of β cells was reduced and the proliferation rate increased as well as the islet immune cell infiltrate was strongly reduced in double and abolished in triple combination therapies.ConclusionsThe anti-TCR combination therapy with anti-IL-17 preferentially raised the β cell mass as a result of β cell proliferation while anti-IL-6 strongly reduced β cell apoptosis and the islet immune cell infiltrate with a modest increase of the β cell mass only. The triple combination therapy achieved both goals in a complimentary anti-autoimmune and anti-inflammatory action resulting in sustained normoglycaemia with normalized serum C-peptide concentrations.

Nanoparticles modified by triple single chain antibodies for MRI examination and targeted therapy in pancreatic cancer.

Triple scAbs (scAbMUC4, scAbCEACAM6, scFvCD44v6, MCC triple scAbs) were conjugated to the surface of polyethylene glycol modified IONPs (IONPs-PEG), forming the IONPs-PEG-MCC triple scAbs nanocomposite. Characterization of the nanocomposite was performed, and its cytotoxicity, specificity, and apoptosis induction were evaluated. In vivo MRI study and anti-pancreatic cancer effect assessment were performed in tumor-bearing nude mice. The size of the IONPs-PEG-MCC triple scAbs nanocomposite was about 23.6 nm. The nanocomposite was non-toxic to normal pancreatic ductal epithelial cells, and could specifically bind to and be internalized by MUC4/CEACAM6/CD44v6-expressing PDAC cells. With an r2 relaxivity of 104.2 mM-1 s-1, the IONPs-PEG-MCC triple scAbs nanocomposite could significantly shorten the MRI T2-weighted signal intensity both in vitro and in vivo. The IONPs-PEG-MCC triple scAbs nanocomposite also showed a favorable anti-pancreatic cancer effect. In the present study, the IONPs-PEG-MCC triple scAbs nanocomposite was firstly confirmed as a bi-functional nanocomposite in both MRI and treatment, providing its critical clinical transformation potential in PDAC detection and treatment.

A Randomized, Controlled Trial of Ebola Virus Disease Therapeutics

BackgroundAlthough several experimental therapeutics for Ebola virus disease (EVD) have been developed, the safety and efficacy of the most promising therapies need to be assessed in the context of a randomized, controlled trial.MethodsWe conducted a trial of four investigational therapies for EVD in the Democratic Republic of Congo, where an outbreak began in August 2018. Patients of any age who had a positive result for Ebola virus RNA on reverse-transcriptase–polymerase-chain-reaction assay were enrolled. All patients received standard care and were randomly assigned in a 1:1:1:1 ratio to intravenous administration of the triple monoclonal antibody ZMapp (the control group), the antiviral agent remdesivir, the single monoclonal antibody MAb114, or the triple monoclonal antibody REGN-EB3. The REGN-EB3 group was added in a later version of the protocol, so data from these patients were compared with those of patients in the ZMapp group who were enrolled at or after the time the REGN-EB3 group was added (the ZMapp subgroup). The primary end point was death at 28 days.ResultsA total of 681 patients were enrolled from November 20, 2018, to August 9, 2019, at which time the data and safety monitoring board recommended that patients be assigned only to the MAb114 and REGN-EB3 groups for the remainder of the trial; the recommendation was based on the results of an interim analysis that showed superiority of these groups to ZMapp and remdesivir with respect to mortality. At 28 days, death had occurred in 61 of 174 patients (35.1%) in the MAb114 group, as compared with 84 of 169 (49.7%) in the ZMapp group (P=0.007), and in 52 of 155 (33.5%) in the REGN-EB3 group, as compared with 79 of 154 (51.3%) in the ZMapp subgroup (P=0.002). A shorter duration of symptoms before admission and lower baseline values for viral load and for serum creatinine and aminotransferase levels each correlated with improved survival. Four serious adverse events were judged to be potentially related to the trial drugs.ConclusionsBoth MAb114 and REGN-EB3 were superior to ZMapp in reducing mortality from EVD. Scientifically and ethically sound clinical research can be conducted during disease outbreaks and can help inform the outbreak response. (Funded by the National Institute of Allergy and Infectious Diseases and others; PALM ClinicalTrials.gov number, NCT03719586.)

Clinical features and risk factors of portal vein thrombosis in 28 patients with antiphospholipid syndrome

Objective: Portal vein thrombosis (PVT) is a rare and severe clinical manifestation of antiphospholipid syndrome (APS), as well as a predictor of poor prognosis. This study was conducted to explore the clinical features and risk factors of PVT in APS patients. Methods: A total of 123 APS patients diagnosed from 2012 to 2019 were retrospectively enrolled. The diagnosis of PVT was made according to the 2009 American College of Liver Diseases (AASLD) criteria. Clinical and laboratory data were collected. A multivariate (MV) logistic regression model was constructed using a stepwise forward selection procedure among those candidate univariables with P values<0.10. Results: A total of 28 cases with PVT, and 95 control cases without PVT were finally enrolled.The 28 APS-PVT patients included 5 males and 23 females with age range from 17 to 63 years. Clinical manifestations included acute thrombosis in 8 patients, chronic thrombosis in 16, and 4 with portal vein spongiform. As to the involved vessels, single portal vein thrombosis was seen in 20 patients, portal combined with superior mesenteric vein (SMV) and splenic vein in one patient, portal plus SMV in 4 and only SMV in 3 patients. Other manifestations were portal hypertension (16/28), esophageal varices (13/28), spleen infarction (7/28) and gastrointestinal bleeding (4/28). Two antiphospholipid antibodies were positive in 13 cases. Triple positive antibodies were seen in 7 cases. Multivariate logistic regression analysis showed that disease duration less than 0.5 years (OR=72.74, 95%CI 7.50-705.45, P<0.001), hypoalbuminemia (OR=356.45, 95%CI 19.19-6 620.14, P<0.001), and elevated erythrocyte sedimentation rate (ESR)/C-reactive protein (CRP) (OR=14.41, 95%CI 1.49-139.20, P<0.001) were independent risk factors for PVT in APS. Conclusion: PVT is usually misdiagnosed due to insidious onset. Short disease duration, hypoalbuminemia and elevated ESR/CRP are risk factors for PVT in APS. Better understanding, early diagnosis and treatment will improve the clinical outcome.

Monoclonal antibody-based diagnostic assays for pepper mild mottle virus

A triple antibody sandwich enzyme-linked immunosorbent assay (TAS-ELISA) and an immunocapture reverse transcription-polymerase chain reaction (IC-RT-PCR) for pepper mild mottle virus (PMMoV) detection were developed based on monoclonal and polyclonal antibodies produced in this study. Production of anti-PMMoV monoclonal antibodies (MAbs) was achieved using the hybridoma technique and a recombinant protein of the PMMoV coat protein as the antigen. Production of a polyclonal antibody (PAb) against the recombinant coat protein of PMMoV was carried out in a New Zealand White rabbit. The PAb was specific to five tobamoviruses consisting of PMMoV, tobacco mosaic virus (TMV), odontoglossum ringspot virus (ORSV), tomato mosaic virus (ToMV) and ribgrass mosaic virus (RMV). Two TAS-ELISA protocols were developed based on the characteristics of the antibodies produced. One protocol, based on MAb TOBA1, could detect five tobamoviruses (TMV, PMMoV, ORSV, ToMV, and RMV), four of which infect peppers. In the other protocol, TOBA10 was used to specifically detect PMMoV. We also successfully developed an IC-RT-PCR procedure using TOBA1. The sensitivity of the IC-RT-PCR (1:2,000,000) was much higher than TAS-ELISA (1:5120) for detection of the virus in plant sap. We anticipate these assays to facilitate the screening process of tobamovirus-resistant pepper cultivars in breeding programs.

Nécrose hémorragique bilatérale des surrénales sous apixaban : penser au syndrome des antiphospholipides ?

IntroductionAdrenal hemorrhage is a classical but rare complication of antiphospholipid syndrome, revealing diagnosis in one third of the cases. Anti-vitamin K therapy is the standard treatment but direct oral anticoagulants are discussed as an alternative. In the latest recommendations, it is advised not to use direct oral anticoagulants in the setting of antiphospholipid syndrome. Case reportWe present a case of bilateral adrenal hemorrhage revealing primary antiphospholipid syndrome with triple positive antibody profile, in a 47-year-old man treated by apixaban for previous venous thromboembolism. ConclusionTo our knowledge, it is the first case of adrenal hemorrhage occurring during apixaban treatment in a patient with antiphospholipid syndrome. This case illustrates the inefficacy of direct oral anticoagulants to prevent thrombotic events in antiphospholipid syndrome, in accordance with the latest recommendations.

Upgrading Therapy Strategy Improves Pregnancy Outcome in Antiphospholipid Syndrome: A Cohort Management Study.

The current study evaluates the efficacy and safety of different treatment strategies for pregnant patients with antiphospholipid syndrome. One hundred twenty-seven consecutive pregnancies were assessed; 87 (68.5%) with a history of pregnancy morbidity alone were treated with prophylactic low molecular weight heparin (LMWH) + low-dose aspirin (LDA, 100 mg) (group I) and 40 (31.5%) with a history of thrombosis and/or severe pregnancy complications with therapeutic LMWH + LDA (group II). LMWH doses were increased throughout the pregnancies depending on the patients' weight gain, and treatment was switched to a more intensive one at the first sign of maternal/fetal complications. The study's primary outcome was live births. There were no significant differences in live birth rate between group I (95.4%) and group II (87.5%). Even fetal complication rate was similar in the two groups; group II nevertheless had a higher prevalence of maternal and neonatal complications (p = 0.0005 and p = 0.01, respectively) and registered a significantly lower gestational age at delivery and birth weight (p = 0.0001 and p = 0.0005, respectively). Two patients in group I switched to group II therapy, six patients in group II switched to a more intensive treatment strategy (weekly plasma exchange + fortnightly intravenous immunoglobulins in addition to therapeutic LMWH + LDA). The multivariate analysis uncovered that triple antiphospholipid antibodies positivity was an independent factor leading to a more intensive therapy. All eight switched patients achieved a live birth. Study results revealed that adjusted LMWH doses and switching therapy at first signs of severe pregnancy complications led to a high rate of live births in antiphospholipid syndrome patients.

Independent association of low IFNλ1 gene expression and type I IFN score/IFNλ1 ratio with obstetric manifestations and triple antiphospholipid antibody positivity in primary antiphospholipid syndrome

Recent data suggest an important role of type I interferons (IFN) in antiphospholipid syndrome (APS). Here we aimed to evaluate the interplay of type I and type III (or IFNλs) IFNs in APS and potential clinical and serological associations. Our findings suggest that patients with primary APS (PAPS) and systemic lupus erythematosus (SLE)/APS displayed increased type I IFN scores but decreased IFNλ1 gene expression levels compared to healthy individuals, as assessed with real-time qPCR analysis in isolated peripheral blood mononuclear cells (PBMCs). Type I IFN score/IFNλ1 ratio was remarkably higher in patients with PAPS and SLE/APS as well as in SLE patients with or without antiphospholipid antibodies (aPL) vs controls. In conclusion, our results reveal an association between low IFNλ1 expression and obstetric APS. Moreover, the type I IFN score/IFNλ1 ratio seems to be a potential marker of high risk APS given its associations with triple aPL positivity.

Identification of natural weed hosts of Cucumber mosaic virus subgroup-I and the absence of seed transmission in weed hosts in Pakistan

ABSTRACT Every year in Pakistan the Cucumber mosaic virus (CMV) severely damages tomato crops, but little is known about the epidemiology of this disease. Tomato fields with a high incidence of CMV were tested to determine the range of potential natural alternative weed hosts of CMV. A total of 553 symptomatic leaf samples from 36 plant species representing 19 families were analysed for the presence of CMV subgroup-I and subgroup-II using triple antibody sandwich enzyme-linked immunosorbant assay (TAS-ELISA) and reverse transcription polymerase chain reaction (RT-PCR). CMV subgroup-I was detected for the first time in nine plant species: Chenopodium album, Calotropis procera, Heliotropium indicum, Cornopus didymus, Convolvulus arvensis, Melilotus indica, Galium aparine, Nicotiana plumbaginifolia and Withania somnifera. Back indexing with leaf extracts of naturally infected TAS-ELISA- and RT-PCR-positive plants of all of these weed species produced severe symptoms in tomato plants of the susceptible variety Nagina. Grow-out testing proved the absence of seed transmission of CMV subgroup-I in TAS-ELISA- and RT-PCR-positive weed species. This information is useful for reducing early CMV infection by eradicating these weed species, thereby reducing virus reservoirs and the vector aphid population. However, the TAS-ELISA and RT-PCR tests proved the absence of CMV subgroup-II in the tested samples.

PF708 THE IMPACT OF ANTIPHOSPHOLIPID ANTIBODIES (APL) ON OUTCOMES OF PATIENTS WITH IMMUNE THROMBOCYTOPENIA AND AUTOIMMUNE HEMOLYTIC ANEMIA TREATED WITH SPLENECTOMY

Background:Antiphospholipid antibodies (aPL) are present in up to 40% of patients with autoimmune cytopenias. There is limited information about their clinical significance. Splenectomy is a second line therapy in both Immune Thrombocytopenia (ITP) and Autoimmune Hemolytic Anemia (AIHA) with high response rates and durable remissions. There is no information about the impact of aPL in patients treated with splenectomy and there are concerns about lower response rates and a higher incidence of thrombosis.Aims:Define the impact of aPL on the safety and efficacy of splenectomy for the treatment of ITP or AIHA.Methods:We performed a case‐control study, including patients with either ITP or AHAI treated with splenectomy between 2000 and 2018. The cases were patients with moderate to high aPL titers in two measurements with 12 weeks apart. They could have a clinical criterion of antiphospholipid syndrome (APS) but patients with another autoimmune disease were excluded. The control group included patients with IT or AIHA with a negative determination of aPL. Cases and controls were paired by age, diagnosis (IT or AIHA), and date of splenectomy.Results:We included 68 patients (34 in each group): ITP 53% and AIHA 47%. Most patients were female (78%) with a median age of 37 years (19 to 63). Among the cases (aPL patients), 41% had triple antibody positivity and 62% a lupus anticoagulant phenomenon (LA).Before splenectomy, aPL patients have received more steroid cycles (p = 0.05) and more lines of therapy other than steroids (p = 0.02) in comparison with controls. The time between diagnosis and splenectomy was longer in aPL patients (54 vs. 18 months, p = 0.02).At 30 days, complete response (CR) rates for aPL patients and controls were 65% and 79% respectively (p = 0.27). We identify as factors associated with lower CR rate: AIHA diagnosis, thrombotic APS, positive anti‐beta2‐glycoprotein, aPL with triple antibody positivity and a more than one line of treatment. On multivariate analysis, only AIHA remained significant (OR 0.07, IC 95% 0.0–0.4, p &lt; 0.001).Regarding splenectomy, most were laparoscopic (88%). There were no differences in medical complications (35% vs. 23% p = 0.42) however, patients with aPL had a higher incidence of early infections (21 vs. 3%, p = 0.05). On multivariate analysis, patients with thrombotic APS (OR 6.9, IC 95% 1.3–34.8, p = 0.01) and an open splenectomy (OR 6.1, IC 95% 1.1–32.7 p = 0.03) had a higher risk of medical complications, whereas women had a lower risk (OR 0.2, IC 95% 0.0–0.9 p = 0.04).Median follow‐up was 52 months vs. 41 months (p = 0.14) for aPL patients and controls. At last follow‐up 44% vs. 38% required a new treatment for ITP/AIHA (p = 0.8). There was no difference in treatment‐free survival among both groups (log rank, p = 0.83). The incidence of long term infections and thrombosis during follow‐up was similar between groups (21% vs 6% p = 0.07 and 15% vs 9% p = 0.7, respectively). Long term Infections were associated with a shorter treatment‐free survival period (HR = 5.3, IC 95% 1.9–14.1 p &lt; 0.00).Summary/Conclusion:Although patients with aPL (with or without APS) are taken to splenectomy later and with more previous treatment lines, the response rate and treatment‐free survival are similar to those of patients without aPL. The incidence of thrombosis is the same between groups, but there was a higher incidence of infections in aPL patients. The latter can be related to the more intensive immunosuppressive treatment before splenectomy. Patients with thrombotic APS had more medical complications and a trend of lower response rates that must be further explored.image

Obstetric outcomes in patients with primary thrombotic and obstetric antiphospholipid syndrome and its relation to the antiphospholipid antibody profile.

Introduction: Previous studies suggested different obstetric outcomes between patients with thrombotic or obstetric antiphospholipid syndrome, but the data are inconclusive. Aims: To investigate obstetric outcomes and their relation to the antiphospholipid antibody profile in primary thrombotic or obstetric antiphospholipid syndrome patients and compare those to a control population. Materials and methods: A retrospective single-centre study on a cohort of 30 pregnant women with primary antiphospholipid syndrome treated at Karolinska University Hospital Solna, Sweden between 2000 and 2016. The pregnancy outcomes were compared to the outcomes of all pregnancies in Stockholm County during the same period. Results: Preeclampsia (p < 0.001), low birth weight at delivery (p = 0.001), Apgar < 7 at 5 minutes (p < 0.001) and small infants (p < 0.001) were more common in antiphospholipid syndrome patients compared to controls. Obstetric antiphospholipid syndrome patients had a higher incidence of small infants (p = 0.023), lower birth weight (p = 0.013) and infants born with complications (p=0.004) compared to thrombotic antiphospholipid syndrome. Mothers with triple antibody positivity had a higher incidence of preeclampsia (p = 0.03), preterm delivery (p = 0.011), small infants (p=0.002) and infants born with complications (p = 0.012). Conclusions: Patients with primary antiphospholipid syndrome, especially those with obstetric antiphospholipid syndrome and triple antibody positivity, are at higher risk for adverse pregnancy outcomes, even under antithrombotic treatment. More frequent antenatal controls in high-risk patients can further improve outcomes.

First Report of Onion Yellow Dwarf Virus on Shallot (Allium cepa var. aggregatum) in China

Allium species are economically important crops in the world. Viruses are among the most important pathogens affecting their yield, especially those belonging to the genera Potyvirus, Carlavirus, and Allexivirus (Katis et al. 2012). Members of the genus Potyvirus are usually the most abundant and cause most of the damage induced. Onion yellow dwarf virus (OYDV) and Leek yellow stripe virus (LYSV) are often found in almost all Allium-cultivating regions and cause significant yield losses worldwide (Katis et al. 2012; Milosevic et al. 2015). In May 2017, severe leaf twisting, yellowing, and plant stunting were observed on shallot (Allium cepa var. aggregatum) in Jilin and Heilongjiang provinces of China. The disease was found in 77% of fields of shallot (total 12,000 ha) in 2017 and 2018. A total of 29 symptomatic plants were collected and tested using double antibody sandwich (DAS)-ELISA kits (DSMZ, Braunschweig, Germany) for the presence of OYDV and LYSV and a triple antibody sandwich ELISA kit (DSMZ) for shallot latent virus (SLV). OYDV was detected in 24 out of 29 shallot samples, and all were negative for LYSV and SLV. The virus was mechanically transmitted from an ELISA-positive sample to 10 plants of shallot using 0.01 M phosphate buffer (pH 7). All 10 mechanically inoculated plants of shallot developed symptoms identical to those observed on the original host plants 21 days postinoculation. All 10 inoculated plants were DAS-ELISA positive for OYDV. Presence of OYDV in ELISA-positive shallot plants was further confirmed by reverse transcription polymerase chain reaction (RT-PCR). Total RNAs were extracted using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany); reverse transcription and PCR were carried out with the PrimeScript II first Strand cDNA Synthesis Kit (Takara, Japan) and Premix Taq (Ex Taq version 2.0) (Takara, Japan). OYDV coat protein (CP) specific primer pair (U: GCCGGCCCAGGGGAGGATG; D: CATTCTGACTCCAAGCAGAG) designed to amplify the complete CP gene was used for amplification. All infected shallot plants yielded an amplicon of the expected size (774 bp), whereas no amplification products were obtained from healthy controls. The RT-PCR product derived from the isolate JL1-3 was sequenced after T vector ligation with a pMD18-T Vector Cloning Kit (Takara, Japan) and submitted to GenBank (accession no. KY347900). Pairwise comparison of the JL1-3 isolate CP sequence with other homologous sequences available in GenBank was conducted, and sequence analysis showed that CP gene of this Chinese isolate shared the highest nucleotide identity of 97 and 95% with the CP gene of OYDV isolates OYDV-AT and AC-41 (GenBank accession nos. JX433020 and Y11826) from Germany and Netherlands, respectively. To our knowledge, this is the first report of OYDV on shallot in China. Further investigation is necessary to prevent the spread of this pathogen to new locations and to new hosts (Naderi Saffar et al. 2013) in China.

Red blood cell alloimmunization in multitransfused hemodialysis renal patients in central Sudan

Aims: Blood transfusion is an integral part in the management of chronic renal failure (CRF). Alloimmunization is a recognized complication of red blood cell (RBC) transfusion with consequences including delayed hemolytic transfusion reactions and difficulties in getting compatible blood for future transfusion. Therefore, the current study was designed to identify the frequency of RBC alloimmunization and the specificity of alloantibodies against red cell antigen among the hemodialysis patients. Methods: A total of 301 patients (239 males and 62 females) with CRF who received more than two units of blood and matched for ABO and Rh(D) antigen were enrolled in this cross-sectional study which was carried out from December 2016 to December 2017. After detailed history through questionnaire conducted to the patients, antibody screening was done by 2-cell panel with homozygous expression of the antigens (ID-Diacell I-II-DiaMed). Positive samples were further subjected to antibody identification using commercial panels of 11 cells (ID-DiaPanel- DiaMed). Results: Out of 301 patients 239 (79.4%) were males and 62 (20.6%) were females. The prevalence of alloimmunization was 16.9% and the most alloantibody frequent was anti-C (21.3%), anti-E (16.4%), and anti-K (14.8%). The most common alloantibodies produced were against Rh system (64%). Dual and triple antibody was observed. All alloantibodies were immunoglobulin G (IgG) class except anti-M was IgG and immunoglobulin M (IgM). Conclusion: This study showed that 16.9% of the multitransfused patients with chronic kidney disease (CKD) developed alloantibodies, most of which were of the Rh phenotype. These alloantibodies may lead to allograft rejection, or even poor patient survival. Thus, we advocate that renal transplant be instituted at the earliest opportunity whenever it becomes inevitable as a modality of treatment to enhance better outcomes.

Diagnostic utility of triple antibody (AMACR, HMWCK and P63) stain in prostate neoplasm.

Aims and Objective:In recent period, basal cell markers high molecular weight cytokeratin (HMWCK), P63 and prostate biomarker AMACR have been used as adjuvant to morphology in diagnostically challenging cases with a very high sensitivity and specificity.Materials and Methods:In this prospective study, total of 80 cases including 40 cases of malignant lesions and 40 cases of benign lesions of the prostate were taken. Tumor grade was determined according to Gleason's grading system. AMACR, HMWCK, P63 expressions were determined by immunohistochemical staining.Results:This study showed AMACR had a sensitivity of 90%, specificity of 100%. AMACR was not expressed in any of the 40 cases of benign lesions of the prostate while in malignant lesions of prostate it was expressed in 36 of 40 (90%) cases; 15 of 16 (93%) of well-differentiated carcinoma were positive for AMACR expression; 17 of 19 (89.47%) moderately differentiated and 4 of 5 (80%) cases of poorly differentiated tumors were positive for AMACR. There was statistically significant difference in expression of AMACR between benign and malignant lesions of the prostate (P = 0.001). In benign lesions, HMWCK and P63 were expressed in all the 40 (100%) cases, while in malignant lesions of prostate it was not expressed in any of the (0%) case. AMACR expression was not seen in any of the benign lesion. Out of 40 malignant cases, 4 cases were negative for AMACR, HMWCK and P63, 36 cases were positive only for AMACR, but no case was positive for HMWCK and P63.Conclusions:As an adjunct to biopsy, AMACR, HMWCK and P63 have potential for combating diagnostically challenging cases.

Sequence Analysis of Plum pox virus Strain C Isolates from Russia Revealed Prevalence of the D96E Mutation in the Universal Epitope and Interstrain Recombination Events.

The understanding of genetic diversity, geographic distribution, and antigenic properties of Plum pox virus (PPV) is a prerequisite to improve control of sharka, the most detrimental viral disease of stone fruit crops worldwide. Forty new PPV strain C isolates were detected in sour cherry (Prunus cerasus) from three geographically distant (700–1100 km) regions of European Russia. Analysis of their 3’-terminal genomic sequences showed that nineteen isolates (47.5%) bear the D96E mutation in the universal epitope of the coat protein. Almost all of them cannot be detected by the monoclonal antibody 5B in triple antibody sandwich enzyme-linked immunosorbent assay and Western blot analysis that may potentially compromise serological PPV detection in cherries. Full-length genomes of seven PPV-C isolates were determined employing next-generation sequencing. Using the Recombination Detection Program (RDP4), the recombination event covering the region from (Cter)P1 to the middle of the HcPro gene was predicted in all the available PPV-C complete genomes. The isolates Tat-4, belonging to the strain CV, and RU-17sc (PPV-CR) were inferred as major and minor parents, respectively, suggesting possible pathways of evolution of the cherry-adapted strains. Downy cherry (P. tomentosa) was identified as the natural PPV-C host for the first time.

Survey for the identification and geographical distribution of viruses and virus diseases of maize (Zea mays L.) in Ethiopia

A survey to identify the distribution of virus diseases of maize was made in major maize growing regions of Ethiopia. Four surveys were conducted between 2015 and 2017. A total of 284 maize fields have been surveyed, of which 846 leaf samples with virus like disease symptoms were collected from 191 fields. There were no symptoms indicating for virus presence in maize grown in 93 fields which were exempted from sampling, while in contrast up to 100% disease incidence was recorded in maize grown in the Benishangul-Gumuz, Oromia and South Nations, Nationalities and People (SNNP) regions. Symptoms varied in maize ranging from the most common mosaic and streak to severe leaf mottling and necrosis as well as stunting and pre-mature plant death. Double or triple antibody sandwich (DAS or TAS) enzyme-linked immuno-sorbent assay (ELISA) to test for eight common maize viruses such as Maize chlorotic mottle virus (MCMV), Sugarcane mosaic virus (SCMV), Maize streak virus (MSV), Maize dwarf mosaic virus (MDMV), Maize mosaic virus (MMV), Maize stripe virus (MSpV), Wheat streak mosaic virus (WSMV) and Johnsongrass mosaic virus (JGMV) confirmed the presence of MCMV, SCMV and MSV in the leaf samples. Single or mixed infections with MCMV and SCMV frequently occurred and triple infections of MCMV, SCMV and MSV were found in 1% of samples from SNNP region. Sequence analysis of the coat protein genes of randomly selected seropositive samples of the three viruses showed little variability within the studied isolates and those retrieved from the GenBank. Our results indicated maize lethal necrosis disease (MLND) caused by MCMV and SCMV co-infection was the most important disease in SNNP and Oromia while maize streak disease was the predominant virus infecting maize in Benishangul-Gumuz.

Antiphospholipid syndrome: An update on risk factors for pregnancy outcome.

The optimal treatment of women with primary antiphospholipid syndrome (APS) is still debated. About 20-30% of women with APS remain unable to give birth to healthy neonates despite conventional treatment, consisting of prophylactic-dose heparin and low-dose aspirin. These cases are defined "refractory obstetric APS". The early identification of risk factors associated with poor pregnancy outcome could be the optimal strategy to establish criteria for additional therapies, such as hydroxychloroquine, steroids, intravenous immunoglobulin, and plasma exchange. The aim of the present study was to review current literature about risk factors for poor pregnancy outcome. The PubMed database was used to search for peer-reviewed original and review articles concerning risk factors for pregnancy outcome in APS from 1st January 1990 to 15th January 2018. History of pregnancy morbidity and/or thrombosis, the association with SLE and/or other autoimmune diseases are well known history-based predictive factors for obstetrical complications, such as miscarriage, maternal venous thromboembolism, intrauterine foetal demise, preeclampsia, and neonatal death. Moreover, laboratory findings associated with poor pregnancy outcome are:triple antiphospholipid antibodies aPL positivity, double aPL positivity, single aPL positivity, false-positive IgM for CMV, and hypocomplementemia. Triple positivity is confirmed as the most significant risk factor by a large body of evidence. Furthermore, the abnormal uterine arteries Doppler velocimetry results are confirmed to be strongly associated with poor pregnancy outcomes in APS. The good performance of the uterine arteries velocimetry, as a negative predictive factor, was reported by different studies. On the contrary, in case of abnormal uterine arteries results, the relevance of a careful surveillance is highlighted for the high risk of maternal-foetal complications. Nevertheless, this tool is a late indicator to suggest any additional treatments. In order to prevent obstetrical complications and establish the optimal combination therapy, the knowledge at preconception or at the beginning of pregnancy of risk factors associated with poor pregnancy outcome could be a crucial step for management and treatment of APS. In addition, in the preconception assessment a regimen with low-dose aspirin, folic acid, and vitamin D supplementation should be offered, and a treatment strategy has to be established (conventional vs additional therapy). In fact, additional treatment has to be tailored for each patient.

Occurrence of Tomato Spotted Wilt Virus Infecting Snapdragon (Antirrhinum majus) in India

HomePlant DiseaseVol. 102, No. 8Occurrence of Tomato Spotted Wilt Virus Infecting Snapdragon (Antirrhinum majus) in India Previous DISEASE NOTES OPENOpen Access licenseOccurrence of Tomato Spotted Wilt Virus Infecting Snapdragon (Antirrhinum majus) in IndiaC. Senthilraja, P. Renukadevi, V. G. Malathi, S. Nakkeeran, and H. R. PappuC. SenthilrajaSearch for more papers by this author, P. Renukadevi†Corresponding author: P. Renukadevi; E-mail: E-mail Address: renucbe88@gmail.comhttp://orcid.org/0000-0001-9665-1681Search for more papers by this author, V. G. MalathiSearch for more papers by this author, S. NakkeeranSearch for more papers by this author, and H. R. PappuSearch for more papers by this authorAffiliationsAuthors and Affiliations C. Senthilraja P. Renukadevi † V. G. Malathi S. Nakkeeran , Department of Plant Pathology, Centre for Plant Protection Studies, Tamil Nadu Agricultural University, Coimbatore-03 H. R. Pappu , Washington State University, Department of Plant Pathology, Pullman. Published Online:19 Jun 2018https://doi.org/10.1094/PDIS-02-18-0250-PDNAboutSections ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Snapdragon (Antirrhinum majus L.) is an important ornamental plant grown all over the world. A recent survey in the Nilgiris district of Tamil Nadu (India) indicated that snapdragon plants exhibited typical symptoms of tospovirus infection, including severe chlorotic and necrotic rings in leaves accompanied with stunting. Ten symptomatic plant samples were collected from Kotagiri and subjected to serological detection of tomato spotted wilt virus (TSWV) with a triple antibody sandwich ELISA kit (DSMZ, Germany). All the suspected symptomatic plants were positive for TSWV. For bioassay studies, one representative sample was collected, and the virus was mechanically transmitted through sap inoculation using 0.1 M phosphate buffer (pH 7.0) into nine different indicator host plants. Among them, Vigna unguiculata (cultivar CO7) and Physalis peruviana exhibited localized, chlorotic spots, which later turned necrotic. Other indicator hosts, including Datura metal, D. stramonium, Nicotiana glutinosa, N. tabacum, Impatiens balsamiana, Gomphrina globosa, and Solanum lycopersicum (tv. PKM1), exhibited local as well as systemic symptomic necrotic rings on the leaves, followed by wilting of the inoculated plants. Symptoms exhibited by all the assay hosts resembled those of TSWV infection (Parrella et al. 2003; Renukadevi et al. 2015; Salem et al. 2012). Electron microscopic observation of plant sap from a symptomatic leaf on a snapdragon plant revealed the presence of spherical virion particles of TSWV (80 to 100 nm in diameter) (Pappu et al. 2009). Further, the tospovirus nucleocapsid gene was amplified with specific primers (N-F-5′-CAAGCAATAAAGATAAAGAAAGC-3′; N-R-5′-AGCATATAACAACTTCTACGATC-3′) through reverse transcription PCR for three symptomatic leaf samples. One representative amplicon of 850 bp was cloned, sequenced, and submitted to the NCBI GenBank database under the accession number MG191200. The sequence of nucleocapsid gene shared maximum identity of 99% with other TSWV isolates, reported in different hosts, from various countries (India, KJ494928; Korea, HQ267713; France, FR693048). All these results clearly illustrate the infection of A. majus by tomato spotted wilt virus. In India, TSWV was reported for the first time as a new pathogen, infecting chrysanthemum in Nilgiris, Tamil Nadu (Renukadevi et al. 2015). Our study is the first report of TSWV infecting a new host, snapdragon (A. majus). This is suggestive of the spread and host-range extension of TSWV into different crop plants in India, which needs further investigation.