Spermatogonial Transplantation Research Articles

Xenogeneic transplantation of spermatogonia from banana shrimp (Fenneropenaeus merguiensis) into white shrimp (Litopenaeus vannamei)

Banana shrimp (Fenneropenaeus merguiensis) is one of the famous shrimps for the consumer, while larvae of F. merguiensis for farming depend on wild-caught broodstock. On the other hand, white shrimp (Litopenaeus vannamei) is propagated from a culture broodstock and has a high growth rate. Currently, spermatogonia transplantation is one of the alternative methods to preserve and propagate the offspring of several vertebrates. Transplantation technology has not been reported in shrimp. This study provided information on the transplantation technique in shrimp using F. merguiensis as a donor and L. vannamei as a recipient. Spermatogonia were prepared from wild-caught F. merguiensis, 11–12 cm in length, and the cells were 8–10 µm in diameter. The spermatogonia were injected into postlarvae days 4, 9, and 16 of L. vannamei. The PKH-26 fluorescent signal was between the heart and hepatopancreas of the recipient 4 wk post-injection. In addition, the gonad of the recipient contained the proliferated donor germ cells in the gonad of the recipient after 4.5 month post-transplantation, determined by in situ hybridization with a VASA probe. The mature transplanted shrimps had dark spots on the gonad, similar to F. merguiensis's gonad. Then, the donor-derived offspring were achieved after the natural mating of transplanted shrimp. The donor-like morphology of F1 offspring was approximately 70.5%. When the genetics of F1 offspring were clarified and revealed, 2% of F. merguiensis, 28% of L. vannamei, and 70% of the hybrid between F. merguiensis and L. vannamei. The overall results indicated the successful establishment of spermatogonia transplantation in shrimp. The benefit of this work could apply to conserve or produce this shrimp in the future.

Spermatogonial Transplantation.

Spermatogonial transplantation is the unequivocal method to detect spermatogonial stem cells (SSCs) based strictly on the functional definition of stem cells - the cells' regenerative capacity. This method further allows for SSC quantification. A weakness of spermatogonial transplantation is its time-consuming nature; it takes 2 months to confirm the production of terminally differentiated cells in spermatogenesis, spermatozoa, in mice, which gives the assay endpoint. Using the mouse as the model system, we here describe the basic techniques of spermatogonial transplantation and provide practical guidance to successfully carry out this technique and to interpret data generated.

RNA Interference as a Method of Gene Knockdown in Cultured Spermatogonia.

Maintenance and self-renewal of the spermatogonial stem cell (SSC) population in the testis are dictated by the expression of a unique suite of genes. In manipulating gene expression through loss-of-function approaches, we can identify important regulatory mechanisms that dictate spermatogonial fate decisions. One such approach is RNA interference (RNAi), which uses natural cellular responses to small interfering RNAs to decrease levels of a targeted transcript. RNAi is performed in primary cultures of undifferentiated spermatogonia, and can be paired with techniques such as spermatogonial transplantation to assess the functional consequences of downregulated expression of the target gene on stem cell maintenance. This approach provides an alternative or complementary strategy to the generation of knockout mouse lines / cell lines. Here, we describe the methodology of RNAi in undifferentiated spermatogonia, and outline its inherent advantages and disadvantages over other technologies in the study of gene regulation in these cells.

Regeneration of spermatogenesis by mouse germ cell transplantation into allogeneic and xenogeneic testis primordia or organoids.

SummaryGametogenesis requires close interactions between germ cells and somatic cells. Derivation of sperm from spermatogonial stem cells (SSCs) is hampered by the inefficiency of spermatogonial transplantation technique in many animal species because it requires a large number of SSCs and depletion of endogenous spermatogenesis. Here we used mouse testis primordia and organoids to induce spermatogenesis from SSCs. We microinjected mouse SSCs into embryonic gonads or reaggregated neonatal testis organoids, which were transplanted under the tunica albuginea of mature testes. As few as 1 × 104 donor cells colonized both types of transplants and produced sperm. Moreover, rat embryonic gonads supported xenogeneic spermatogenesis from mouse SSCs when transplanted in testes of immunodeficient mice. Offspring with normal genomic imprinting patterns were born after microinsemination. These results demonstrate remarkable flexibility of the germ cell-somatic cell interaction and raise new strategies of SSC manipulation for animal transgenesis and analysis of male infertility.

Autophagy modulation alleviates cryoinjury in murine spermatogonial stem cell cryopreservation.

Cryopreservation can expand the usefulness of spermatogonial stem cells (SSCs) in various fields. However, previous investigations that have attempted to modulate cryoinjury-induced mechanisms to increase cryoprotective efficiency have mainly focused on apoptosis and necrosis. This study aimed to establish an effective molecular-based cryoprotectant for SSC cryopreservation via autophagy modulation. To determine the efficacy of autophagy modulation, we assessed the recovery rate and relative proliferation rate and performed western blotting for the determination of autophagy flux, immunocytochemistry and real-time quantitative polymerase chain reaction (RT-qPCR) for SSC characterization, and spermatogonial transplantation for in vivo SSC functional activity. The results showed that a basal level of autophagy caused a higher relative proliferation rate (pifithrin-μ 0.01 μM, 184.2 ± 11.2%; 3-methyladenine 0.01 μM, 175.3 ± 10.3%; pifithrin-μ 0.01 μM + 3-methyladenine 0.01 μM, P3, 224.6 ± 22.3%) than the DMSO control (100 ± 6.2%). All treatment groups exhibited normal characteristics, suggesting that these modulators could be used as effective cryoprotectants without changing the properties of the undifferentiated germ cells. According to the results of the in vivo spermatogonial transplantation assay, the colonies per total number of cultured SSCs was significantly higher in the pifithrin-μ 0.01 μM (1596.7 ± 172.5 colonies), 3-methyladenine 0.01 μM (1522.1 ± 179.2 colonies), and P3 (1727.5 ± 196.5 colonies) treatment groups than in the DMSO control (842.8 ± 110.08 colonies), which was comparable to that of the fresh control (1882.1 ± 132.1 colonies). A basal level of autophagy is more essential for resilience in frozen SSCs after thawing, rather than the excessive activation or inhibition of autophagy. A basal level of autophagy plays a critical role in the pro-survival response of frozen SSCs after thawing; herein, a new approach by which SSC cryoprotective efficiency can be improved was identified.

Cdc42 is required for male germline niche development in mice.

Spermatogonial stem cells (SSCs) are maintained in a special microenvironment called a niche. However, much is unknown about components that constitute the niche. Here, we report that Cdc42 is essential for germline niche development. Sertoli cell-specific Cdc42-deficient mice showed normal premeiotic spermatogenesis. However, germ cells gradually disappeared during haploid cell formation and few germ cells remained in the mature testes. Spermatogonial transplantation experiments revealed a significant loss of SSCs in Cdc42-deficient testes. Moreover, Cdc42 deficiency in Sertoli cells downregulated GDNF, a critical factor for SSC maintenance. Cdc42-deficient Sertoli cells also exhibited lower nuclear MAPK1/3 staining. Inhibition of MAP2K1 or depletion of Pea15a scaffold protein downregulated GDNF expression. A screen of transcription factors revealed that Cdc42-deficient Sertoli cells downregulate DMRT1 and SOX9, both of which are critical for Sertoli cell development. These results indicate that Cdc42 is essential for niche function via MAPK1/3-dependent GDNF secretion.

A regulatory role for CHD4 in maintenance of the spermatogonial stem cell pool.

SummaryMaintenance and self-renewal of the spermatogonial stem cell (SSC) population is the cornerstone of male fertility. Here, we have identified a key role for the nucleosome remodeling protein CHD4 in regulating SSC function. Gene expression analyses revealed that CHD4 expression is highly enriched in the SSC population in the mouse testis. Using spermatogonial transplantation techniques it was established that loss of Chd4 expression significantly impairs SSC regenerative capacity, causing a ∼50% reduction in colonization of recipient testes. An scRNA-seq comparison revealed reduced expression of “self-renewal” genes following Chd4 knockdown, along with increased expression of signature progenitor genes. Co-immunoprecipitation analyses demonstrated that CHD4 regulates gene expression in spermatogonia not only through its traditional association with the remodeling complex NuRD, but also via interaction with the GDNF-responsive transcription factor SALL4. Cumulatively, the results of this study depict a previously unappreciated role for CHD4 in controlling fate decisions in the spermatogonial pool.

Transient suppression of transplanted spermatogonial stem cell differentiation restores fertility in mice.

SummaryA remarkable feature of tissue stem cells is their ability to regenerate the structure and function of host tissue following transplantation. However, the dynamics of donor stem cells during regeneration remains largely unknown. Here we conducted quantitative clonal fate studies of transplanted mouse spermatogonial stem cells in host seminiferous tubules. We found that, after a large population of donor spermatogonia settle in host testes, through stochastic fate choice, only a small fraction persist and regenerate over the long term, and the rest are lost through differentiation and cell death. Further, based on these insights, we showed how repopulation efficiency can be increased to a level where the fertility of infertile hosts is restored by transiently suppressing differentiation using a chemical inhibitor of retinoic acid synthesis. These findings unlock a range of potential applications of spermatogonial transplantation, from fertility restoration in individuals with cancer to conservation of biological diversity.

Eif2s3y Promotes the Proliferation of Spermatogonial Stem Cells by Activating ERK Signaling.

The future fertility of males with cancer may be irreversibly compromised by chemotherapy and/or radiotherapy. Spermatogonial stem cell transplantation is believed to be a way to restore fertility in men. However, the survival efficiency of transplanted cells is still low. Eukaryotic translation initiation factor 2 subunit 3 and structural gene Y-linked (Eif2s3y) located on the Y chromosome of male animals is a coding gene of eIF2γ which mainly functions in translation initiation. Recently, the emerging role of Eif2s3y in spermatogenesis has been emphasized in several studies. However, the underlying mechanism is still unclear. In addition, how Eif2s3y functions in large animals remains largely unknown. In this study, we obtained the CDS sequence of the Eif2s3y gene from the testis of dairy goats and found that this gene was highly expressed in the testis and was evolutionarily conserved among different species. Interestingly, overexpression of Eif2s3y promoted the proliferation of spermatogonial stem cells of dairy goats by activating the ERK signaling pathway. In animal experiments, overexpressing Eif2s3y promoted transplanted goat spermatogonial stem cells and produced more colonies after microinjection into the seminiferous tubules of infertile mice. In conclusion, our study highlights an undiscovered role of Eif2s3y in dairy goat reproduction. This finding may provide an important basis for future works regarding male spermatogenic cell restoration and represent a major advance toward surrogate sires becoming a tool for disseminating and regenerating germplasm in all mammals.

ITGA6+ Human Testicular Cell Populations Acquire a Mesenchymal Rather than Germ Cell Transcriptional Signature during Long-Term Culture.

Autologous spermatogonial stem cell transplantation is an experimental technique aimed at restoring fertility in infertile men. Although effective in animal models, in vitro propagation of human spermatogonia prior to transplantation has proven to be difficult. A major limiting factor is endogenous somatic testicular cell overgrowth during long-term culture. This makes the culture both inefficient and necessitates highly specific cell sorting strategies in order to enrich cultured germ cell fractions prior to transplantation. Here, we employed RNA-Seq to determine cell type composition in sorted integrin alpha-6 (ITGA6+) primary human testicular cells (n = 4 donors) cultured for up to two months, using differential gene expression and cell deconvolution analyses. Our data and analyses reveal that long-term cultured ITGA6+ testicular cells are composed mainly of cells expressing markers of peritubular myoid cells, (progenitor) Leydig cells, fibroblasts and mesenchymal stromal cells and only a limited percentage of spermatogonial cells as compared to their uncultured counterparts. These findings provide valuable insights into the cell type composition of cultured human ITGA6+ testicular cells during in vitro propagation and may serve as a basis for optimizing future cell sorting strategies as well as optimizing the current human testicular cell culture system for clinical use.

Effect of serum replacement on murine spermatogonial stem cell cryopreservation

Cryopreservation of spermatogonial stem cells (SSCs) is a necessity to preserve the genetic information of valuable livestock herds and to produce transgenic animals. However, serum, a key component that allows efficient cryopreservation, has many limitations attributed to its undefined composition, inter-batch variations, and contamination potential. Therefore, we aimed to establish a method for serum-free cryopreservation of SSCs. To evaluate the cryopreservation efficiency of serum replacements, we assessed the recovery rate, relative proliferation potential, proliferation capacity, and apoptosis capacity. SSCs were characterized, and their functional activity was determined through immunofluorescence, RT-qPCR, and spermatogonial transplantation. The efficiency of each serum replacement was compared to that of the negative control (10% DMSO in DPBS) and positive control (10% DMSO and 40% FBS in DPBS). Our results indicated that cryopreservation with 5% human serum albumin (rHSA) exhibited a higher relative proliferation potential (274.0 ± 13.4%) than with DMSO control (100 ± 8.6%), with no significant difference from the 40% FBS (190.0 ± 20.1%). Moreover, early apoptosis also significantly decreased to a greater extent with 5% rHSA (5.1 ± 0.7%) than with DMSO control (12.9 ± 0.8%) and was at a level comparable to the 40% FBS (4.9 ± 0.8%). In addition, the SSCs cryopreserved with 5% rHSA exhibited normal self-renewal and differentiation abilities. In conclusion, 5% rHSA is a potential serum replacement for SSC cryopreservation, with properties comparable to that of serum. These results would contribute to the application of SSCs in improving livestock and in future clinical trials for human infertility treatment.

Production of donor-derived eggs after ovarian germ cell transplantation into the gonads of adult, germ cell-less, triploid hybrid fish†.

In animals, spermatogonial transplantation in sterile adult males is widely developed; however, despite its utility, ovarian germ cell transplantation is not well developed. We previously showed that the interspecific hybrid offspring of sciaenid was a suitable model for germ cell transplantation studies as they have germ cell-less gonads. However, all these gonads have testis-like characteristics. Here, we tested whether triploidization in hybrid embryos could result in germ cell-less ovary development. Gonadal structure dimorphism and sex-specific gene expression patterns were examined in 6-month-old triploid hybrids (3nHybs). Thirty-one percent of 3nHybs had germ cell-less gonads with an ovarian cavity. cyp19a1a and foxl2, ovarian differentiation-related genes, were expressed in these gonads, whereas dmrt1 and vasa were not expressed, suggesting ovary-like germ cell-less gonad development. Some (26%) 3nHybs had testis-like germ cell-less gonads. Ovarian germ cells collected from homozygous green fluorescent protein (GFP) transgenic blue drum (BD) (Nibea mitsukurii) were transplanted into 6-month-old 3nHybs gonads via the urogenital papilla or oviduct. After 9months, the recipients were crossed with wild type BD. Among the six 3nHyb recipients that survived, one female and one male produced fertile eggs and motile sperm carrying gfp-specific DNA sequences. Progeny tests revealed that all F1 offspring possessed gfp-specific DNA sequences, suggesting that these recipients produced only donor-derived eggs or sperm. Histological observation confirmed donor-derived gametogenesis in the 3nHyb recipients' gonads. Overall, triploidization reduces male-biased sex differentiation in germ cell-less gonads. We report, for the first time, donor-derived egg production in an animal via direct ovarian germ cell transplantation into a germ cell-less ovary.

Assessment of Yangtze sturgeon as recipient for the production of American paddlefish gametes through spermatogonia transplantation

The Chinese paddlefish (Psephurus gladius), one of the world’s largest freshwater fish, was last seen alive in 2003; they are presumed now to be extinct. In fish, germ cell transplantation is currently known as one of the most powerful assisted reproductive technologies for the conservation of endangered species. In the event that a Chinese paddlefish is unexpectedly caught in the near future, we aimed to develop an experimental strategy to produce paddlefish gametes in the gonads of surrogate sturgeon. Spermatogonia were collected from the testes of 2.5-year-old immature male American paddlefish (Polyodon spathula), the species most closely related to the Chinese paddlefish, by Percoll gradient centrifugation, and transplanted into the peritoneal cavity of Yangtze sturgeon (Acipenser dabryanus) larvae at 7–8 days post-hatch. At two months post-transplantation, donor-derived spermatogonia had efficiently colonized in the recipient gonads and proliferated. A PCR analysis developed to detect xenogenic donor-derived mtDNA sequences in recipient gonads revealed that American paddlefish germ cells survived for at least seven months after transplantation in the gonads of Yangtze sturgeon recipients. These results show that the somatic microenvironment of Yangtze sturgeon gonads was able to support the colonization, proliferation, and survival of xenogeneic germ cells from a different taxonomic family. This study provides key information that could lead to future restoration of Chinese paddlefish using germ cell transplantation.

Aging- and temperature-related activity of spermatogonial stem cells for germ cell transplantation in medaka

Spermatogonial transplantation can contribute to developing a novel method of producing seedlings for both aquaculture and biotic conservation. This study’s purpose was to investigate aging- and temperature-related changes in the numbers and stem cell functions of type-A spermatogonia (ASG) in the model fish medaka (Oryzias latipes). The ASG numbers in medaka of different ages were quantified via histological observation and enzymatic dissociation of vasa-Gfp medaka testes. The ASG numbers were higher in eight-month-old medaka (maturation) than in four-month-old medaka (the onset of maturation). However, ASG numbers decreased in 18-month-old medaka (senescence). Low water temperature appeared to slow down both testis development and aging processes. To study the effects of aging on ASG stem cell activity, testicular cell suspensions containing GFP-expressed ASG were prepared from vasa-Gfp medaka donors at 4 and 18 months of age and transplanted into recipient hybrid larvae of medaka (O. latipes x O. curvinotus), which provided young stem-cell-niches. The findings revealed no significant differences in ASG colonization rates isolated from medaka of different ages. Each group displayed similar rates of germ-line transmission. Furthermore, water temperature had no significant effects on each ASG’s stem cell activity. Taken together, these results indicated that aging and temperature affect ASG numbers. However, ASG isolated from medaka with different ages were transplanted into gonads with a young niche microenvironment, and there was no evidence of donor aging on stem cell activity.

Suitability of hybrid mackerel (Scomber australasicus × S. japonicus) with germ cell-less sterile gonads as a recipient for transplantation of bluefin tuna germ cells

We aim to establish a small-bodied surrogate broodstock, such as mackerel, which produces functional bluefin tuna gametes by spermatogonial transplantation. When reproductively fertile fish are used as recipients, endogenous gametogenesis outcompetes donor-derived gametogenesis, and recipient fish predominantly produce their gametes. In this study, we assessed fertility of hybrid mackerel, Scomber australasicus × S. japonicus, and its suitability as a recipient for transplantation of bluefin tuna germ cells. Hybrid mackerel were produced by artificially inseminating S. australasicus eggs with S. japonicus spermatozoa. Cellular DNA content and PCR analyses revealed that F1 offspring were diploid carrying both paternal and maternal genomes. Surprisingly, histological observations found no germ cells in hybrid mackerel gonads at 120 days post-hatch (dph), although they were present in the gonad of 30- and 60-dph hybrid mackerel. The frequency of germ cell-less fish was 100% at 120-dph, 63.1% at 1-year-old, and 81.8% at 2-year-old. We also confirmed a lack of expression of germ cell marker (DEAD-box helicase 4, ddx4) in the germ cell-less gonads of hybrid mackerel. By contrast, expression of Sertoli cell marker (gonadal soma-derived growth factor, gsdf) and of Leydig cell marker (steroid 11-beta-hydroxlase, cyp11b1) were clearly detected in hybrid mackerel gonads. Together these results showed that most of the hybrid gonads were germ cell-less sterile, but still possessed supporting cells and steroidogenic cells, both of which are indispensable for nursing donor-derived germ cells. To determine whether hybrid gonads could attract and incorporate donor bluefin tuna germ cells, testicular cells labeled with PKH26 fluorescent dye were intraperitoneally transplanted. Fluorescence observation of hybrid recipients at 14 days post-transplantation revealed that donor cells had been incorporated into the recipient’s gonads. This suggests that hybrid mackerel show significant promise for use as a recipient to produce bluefin tuna gametes.

Production of Chinese rosy bitterling offspring derived from frozen and vitrified whole testis by spermatogonial transplantation.

Bitterling is a small cyprinid fish facing an increasing risk of extinction owing to habitat destruction and decreasing freshwater mussel population that are used as their spawning substrates. Owing to their large size and high yolk contents, methods for cryopreservation of their eggs or embryos, which is a promising method for long-term preservation of their genetic resources, are still not available. We conducted this study to evaluate the feasibility of gamete production by transplanting cryopreserved testicular cells into germ cell-less recipients that were produced by knockdown of dead end gene. Immature testes isolated from recessive albino Chinese rosy bitterlings were cryopreserved by slow freezing or vitrification. Approximately 3000 slow-frozen or vitrified cells were transplanted into the peritoneal cavity of 4-day-old germ cell-less wild-type Chinese rosy bitterlings. We observed no significant differences in the incorporation rates of the slow-frozen and vitrified cells into the genital ridges of recipients compared with those of freshly prepared cells. When the recipients matured, almost half of the male or female recipients that received freshly prepared, slow-frozen, or vitrified cells produced gametes derived from donor cells, with no significant differences in their fecundity among the 3 groups. Moreover, fertilization of the resulting eggs and sperm produced donor-derived offspring exhibiting the albino phenotype. Therefore, the abovementioned methods could be used as a powerful and practical method for long-term preservation of bitterling genetic resources for biotic conservation.

Autologous transplantation of spermatogonial stem cells restores fertility in congenitally infertile mice

The blood-testis barrier (BTB) is thought to be indispensable for spermatogenesis because it creates a special environment for meiosis and protects haploid cells from the immune system. The BTB divides the seminiferous tubules into the adluminal and basal compartments. Spermatogonial stem cells (SSCs) have a unique ability to transmigrate from the adluminal compartment to the basal compartment through the BTB upon transplantation into the seminiferous tubule. Here, we analyzed the role of Cldn11, a major component of the BTB, in spermatogenesis using spermatogonial transplantation. Cldn11-deficient mice are infertile due to the cessation of spermatogenesis at the spermatocyte stage. Cldn11-deficient SSCs failed to colonize wild-type testes efficiently, and Cldn11-deficient SSCs that underwent double depletion of Cldn3 and Cldn5 showed minimal colonization, suggesting that claudins on SSCs are necessary for transmigration. However, Cldn11-deficient Sertoli cells increased SSC homing efficiency by >3-fold, suggesting that CLDN11 in Sertoli cells inhibits transmigration of SSCs through the BTB. In contrast to endogenous SSCs in intact Cldn11-deficient testes, those from WT or Cldn11-deficient testes regenerated sperm in Cldn11-deficient testes. The success of this autologous transplantation appears to depend on removal of endogenous germ cells for recipient preparation, which reprogrammed claudin expression patterns in Sertoli cells. Consistent with this idea, in vivo depletion of Cldn3/5 regenerated endogenous spermatogenesis in Cldn11-deficient mice. Thus, coordinated claudin expression in both SSCs and Sertoli cells expression is necessary for SSC homing and regeneration of spermatogenesis, and autologous stem cell transplantation can rescue congenital defects of a self-renewing tissue.

Establishment of Etv5 gene knockout mice as a recipient model for spermatogonial stem cell transplantation.

ABSTRACTSpermatogonial stem cell (SSC) transplantation is an alternative reproductive method to achieve conservation and production of elite animals in livestock production. Creating a recipient animal without endogenous germ cells is important for effective SSC transplantation. However, natural mutants with depletion of SSCs are difficult to obtain, and drug ablation of endogenous germ cells is arduous to perform for practical use. In this study, we used mouse models to study the preparation of recipients with congenital germ cell ablation. We knocked out (KO) Ets-variant gene 5 (Etv5) in mice using the CRISPR/Cas9 system. The testicular weight of Etv5−/− mice was significantly lower than that of wild-type (WT) mice. The germ cell layer of the seminiferous tubules gradually receded with age in Etv5−/− mice. At 12 weeks of age, the tubules of Etv5−/− mice lacked almost all spermatogenic cells with a Sertoli cell-only phenotype, and sperm were completely absent in the epididymis. We subsequently transplanted allogeneic SSCs with enhanced green fluorescent protein (EGFP) into 3- (immature) or 7-week-old (mature) Etv5−/− mice. Partially restoration of germ cell layers in the seminiferous tubules and spermatogenesis was observed in all immature testes but not in mature adult testes at 2 months post-transplantation. The presence of heterologous genes Etv5 and EGFP in recipient testicular tissue and epididymal sperm by PCR indicated that sperm originated from the transplanted donor cells. Our study demonstrates that, although Etv5−/− mice could accommodate and support foreign germ cell transplantation, this process occurs in a quite low efficiency to support a full spermatogenesis of transplanted SSCs. However, using Etv5−/− mice as a recipient model for SSC transplantation is feasible, and still needs further investigation to establish an optimized transplantation process.

CD2 is a surface marker for mouse and rat spermatogonial stem cells.

The spermatogonial stem cell (SSC) population in testis is small, and the lack of SSC markers has severely handicapped research on these cells. During our attempt to identify genes involved in SSC aging, we found that CD2 is expressed in cultured SSCs. Flow cytometric analysis and spermatogonial transplantation experiments showed that CD2 is expressed in SSCs from mature adult mouse testes. Cultured SSCs transfected with short hairpin RNAs (shRNAs) against CD2 proliferated poorly and showed an increased frequency of apoptosis. Moreover, functional analysis of transfected cells revealed impairment of SSC activity. Fluorescence activated cell sorting and spermatogonial transplantation experiments showed that CD2 is expressed not only in mouse but also in rat SSCs. The results indicate that CD2 is a novel SSC surface marker conserved between mouse and rat SSCs.

134 Generation of NANOS2 knockout goats using CRISPR/Cas9 and somatic cell nuclear transfer techniques

The NANOS2 gene, encoding an RNA binding protein, is known to play a critical role in the development of germline for all organisms studied to date. The male mice with biallelic NANOS2 knockouts (KOs) are sterile due to apoptosis of prospermatogonia shortly after birth but with morphologically intact seminiferous tubules. Thus, the choice of NANOS2 for targeting could be a viable strategy to develop germline ablated males that would serve as recipients for exogenous spermatogonial stem cell transplantation. The goat is a potential model of human physiology and an agriculturally important species. Here, we report successful generation of NANOS2 KO goats using CRISPR/Cas9 and somatic cell nuclear transfer (SCNT) techniques. We first designed 4 single-guide RNAs (sgRNAs) specific for the single exon of goat NANOS2 (GenBank: NC_030825.1). The targeting vectors were constructed by using the pX330 plasmid (Addgene: 42230) and transfected into sheep fetal fibroblasts. Mutation efficiency analysis showed that 3 of them (out of 4, 75.0%) were efficient in directing Cas9 to generate targeted cleavages, with mutation efficiencies of 10-30%. We established single cell-derived fetal fibroblast colonies by limiting dilution of the cells transfected with one of targeting vectors (sgRNA: GCTGGAGACCCAAGGGACTG). Colony screening with PCR/restriction fragment length polymorphism (RFLP) assays confirmed that we achieved biallelic mutations in the targeting site in 6 of 89 (6.7%) male and 6 of 172 (3.5%) female colonies. Sanger sequencing analysis of genomic DNA isolated from cell colonies with biallelic mutations showed that typical nucleotide deletions and insertions (indels), caused by repairing double-strand DNA breaks during the error-prone non-homologous end joining (NHEJ) process, were generated at the targeting site of NANOS2. Three male and two female colonies with NANOS2 null mutations were identified and used as cell donors for SCNT. In total, 202 cloned 1-cell stage embryos (130 male or 72 female) were generated and surgically transferred into 12 synchronized recipients. Six of them (6 of 12, 50.0%) were confirmed pregnant by ultrasonography on Day 40-45 of gestation. Four pregnancies developed to term, resulting in six offspring (five males and one female). Sequence analysis and PCR/RFLP assays showed that both male and female offspring carried the mutations in NANOS2, which were identical to the donor colonies from which they originated. Our results indicated that CRISPR/Cas9 combined with SCNT is an efficient system for generating NANOS2 KO goats. The phenotypic analysis to assess the effects of NANOS2 KO on the development of germline in male cloned goats is in progress.