Transcriptional Repressor Research Articles

Upregulation of p52-ZER6 (ZNF398) increases reactive oxygen species by suppressing metallothionein-3 in neuronal cells.

ZNF398/ZER6 belongs to the Krüppel-associated box (KRAB) domain-containing zinc finger proteins (K-ZNFs), the largest family of transcriptional repressors in higher organisms. ZER6 exists in two isoforms, p52 and p71, generated through alternative splicing. Our investigation revealed that p71-ZER6 is abundantly expressed in the stomach, kidney, liver, heart, and brown adipose tissue, while p52-ZER6 is predominantly found in the stomach and brain. The role of p52-ZER6 in neurons has remained unclear. Leveraging open-source RNA-seq data, we identified metallothionein 3 (MT3) as a target gene of p52-ZER6 in mouse hippocampal neuronal HT-22cells. Through chromatin immunoprecipitation assays, we identified the putative DNA-binding motif (CTAGGGGGGTTGTTATCTCTTTGG) of p52-ZER6 in the promoter region of MT3. Furthermore, we demonstrated an interaction between p52-ZER6 and estrogen receptor alpha (ERα) in the nucleus of SH-SY5Y cells, which led to the inhibition of p52-ZER6's DNA occupancy on the promoter of the MT3 gene. MT3 is a cysteine-rich, low molecular-weight protein known for reducing oxidative stress, reactive oxygen species (ROS), and metal toxicity. Our study revealed that overexpression of p52-ZER6 reduced the levels of MT3, increasing ROS levels, which was mitigated by co-overexpression of ERα. Notably, we also observed upregulation of p52-ZER6 and reduction of MT3 in the cortex of 5xFAD, an Alzheimer's disease (AD) mouse model. These findings suggest a potential pathological mechanism involving p52-ZER6-mediated ROS production in AD pathogenesis.

The RNA chaperone Hfq is a novel regulator of catalase expression and hydrogen peroxide-induced oxidative stress response in Listeria monocytogenes EGD-e

The RNA chaperone Hfq plays a pivotal role in many bacteria, acting as a regulator of gene expression and promoting interaction between mRNA-sRNA pairs in Gram-negative bacteria. However, in Gram-positive bacteria this protein is expendable for riboregulation, and the main function of Hfq remains elusive. This work unveils a novel function for Hfq in the oxidative stress response of the human pathogen Listeria monocytogenes, a Gram-positive bacterium responsible for the infectious disease listeriosis. Disruption of hfq gene (Δhfq) results in a hypersensitive phenotype towards hydrogen peroxide (H2O2), in which sub-inhibitory concentrations of this reactive oxygen species (ROS) severely impair growth and viability of L. monocytogenes EGD-e. A Δhfq complemented strain do not show this phenotype. This Hfq-dependent regulation of oxidative stress seems specific for H2O2, as exposure to superoxides caused no differences. We demonstrate that Hfq has a dual regulatory role in the expression of catalase (kat), the key enzyme involved in H2O2 detoxification. Hfq influences kat transcription under non-stress conditions by modulating the levels of the transcriptional repressor PerR, and also acts post-transcriptionally by stabilizing kat mRNA under H2O2-induced stress. Indeed, enzymatic assays revealed reduced catalase activity in Δhfq cell extracts, a result unrelated to differences in cellular iron content. Bacterial infection triggers immune cells to produce massive amounts of ROS, like H2O2. We show that inactivation of Hfq increases susceptibility to macrophage killing, connecting Hfq with the stress resistance and virulence of L. monocytogenes EGD-e. Overall, these findings advance the understanding of Hfq function within Gram-positive bacteria, revealing for the first time that Hfq is a novel regulator of catalase expression. This paves the way for the study of yet unknown oxidative stress response pathways regulated by Hfq in other pathogens.

Nuclear morphology, chromatin compaction, and epigenetic changes in lymphocytes of dogs infected with Ehrlichia canis.

Canine monocytic ehrlichiosis (CME), induced by Ehrlichia canis, is an important infectious disease in dogs, characterized by various clinical signs and consequent immune dysfunction. This study aimed to characterize nuclear morphology, chromatin compaction, histone H3 acetylation, and DNA methylation in lymphocytes from dogs naturally infected with E. canis, compared with healthy controls. A total of 30 dogs were included in this study, comprising 15 healthy dogs and 15 dogs with confirmed E. canis infection, verified through polymerase chain reaction. Blood samples were collected from these dogs to isolate peripheral blood mononuclear cells. The isolated cells were prepared into smears and stained using the Feulgen reaction for subsequent analysis. These stained smears underwent video imaging analysis to assess nuclear morphology and chromatin parameters. Additionally, lymphocytes isolated from the PBMCs were analyzed to quantify global levels of histone H3 acetylation and DNA methylation. The results indicated significant increases in nuclear size and alterations in chromatin architecture in the lymphocytes of dogs with E. canis infection. A significant reduction in histone H3 acetylation was observed in this group, suggesting a potential mechanism of transcriptional repression. In contrast, no significant differences in DNA methylation were detected between the infected dogs and the healthy controls. In conclusion, our findings reveal distinct morphological and epigenetic alterations in lymphocytes associated with E. canis infection, thereby enhancing the understanding of the immune dysfunction observed in dogs with CME.

Synthetic approaches and clinical applications of representative HDAC inhibitors for cancer therapy: A review.

Histone deacetylase (HDAC) inhibitors are a promising class of epigenetic modulators in cancer therapy. This review provides a comprehensive analysis of recent synthetic strategies and clinical applications of key HDAC inhibitors for oncology. HDACs play a critical role in modulating chromatin structure and gene expression by removing acetyl groups from histone proteins, leading to transcriptional repression of tumor suppressor genes. By inhibiting HDAC activity, HDAC inhibitors restore normal acetylation patterns, reactivating silenced tumor suppressor genes and inducing cell cycle arrest, apoptosis, and autophagy in cancer cells. The review explores synthetic approaches to developing representative HDAC inhibitors that have been approved or in various clinical trials. Through an integrated perspective on the synthesis, mechanism of action, and clinical advancements of HDAC inhibitors, this review aims to guide future research toward next-generation HDAC inhibitors that could enhance cancer treatment efficacy while minimizing toxicity, offering insights for chemists and clinicians in the field of oncology.

Targeting UBE2T suppresses breast cancer stemness through CBX6-mediated transcriptional repression of SOX2 and NANOG.

Breast cancer stem cells (BCSCs) are the main cause of breast cancer recurrence and metastasis. While the ubiquitin-proteasome system contributes to the regulation of BCSC stemness, the underlying mechanisms remain unclear. Here, we identified ubiquitin-conjugating enzyme E2T (UBE2T) as a pivotal ubiquitin enzyme regulating BCSC stemness through systemic screening assays, including single-cell RNA sequencing (scRNA-seq) and stemness-index analysis. We found that patients with high UBE2T expression exhibited worse prognosis than those with low expression (10-year PFS: 55.95% vs. 85.08%), which are consistent across various subtypes of breast cancers. Genetic ablation of UBE2T suppresses BCSC stemness and tumor progression in organoids and spontaneous MMTV-PyMT mice, dependent on the transcriptional inactivation of pluripotency genes SOX2 and NANOG. Mechanically, UBE2T collaborates with the E3 ligase TRIM25 to perform K48-linked polyubiquitination and degradation of CBX6 at K214, which deficiency helps to promote the transcription of SOX2 and NANOG and enhances BCSC stemness. The pharmacological inhibitor of UBE2T significantly reduced the expression of NANOG and SOX2, suppressed tumor progression, and demonstrated synergistic effects when combined with chemotherapeutics, but not with other treatments. Collectively, our study revealed that the UBE2T-TRIM25-CBX6 axis can regulate BCSC stemness and offers a potentially therapeutic strategy to combat breast cancer in a clinical translation setting.

DcWRKY15 positively regulates anthocyanin biosynthesis during petal coloration in Dianthus caryophyllus

Petal pigmentation in carnations is closely associated with the biosynthesis of anthocyanins. This biosynthetic process is tightly regulated by transcription factors, which activate or repress key genes involved in anthocyanin production. Here, we aim to explore the mechanisms involved in the transcriptional regulation of anthocyanin biosynthesis in carnation petals. We identified DcWRKY15 as a critical regulator influencing anthocyanin production in these petals. DcWRKY15 expression showed a strong correlation with the expression levels of genes associated with anthocyanin biosynthesis, peaking during early petal development stages. The findings from the dual-LUC, VIGS, Y1H and EMSA assays demonstrated that DcWRKY15 played a positive regulatory role in anthocyanin biosynthesis. DcWRKY15 achieved this by binding directly to the promoters of DcCHS and DcF3H, thereby enhancing their expression. Additionally, DcWRKY15 interacts with the repressor DcMYB2, which reduces its capacity to enhance anthocyanin biosynthesis, particularly during the later stages of petal development. These findings offer new insights into the molecular mechanisms responsible for petal coloration in carnations, highlighting the complex interplay between activator and repressor transcription factors.

EZH2 serves as a viable therapeutic target for myeloma-induced osteolytic bone destruction

Myelomatous bone disease is a complication characterized by lytic bone lesions, reduced bone formation, bone pain, and increased fracture risk. Understanding these underlying mechanisms is crucial for developing effective therapeutic approaches. Here we show the role of enhancer of zeste homolog 2 (EZH2) in bone lesions induced by myeloma cells. Our research reveals that cytokines produced by myeloma-associated adipocytes activate the expression of EZH2 in myeloma cells. Furthermore, we find that EZH2 forms a transcriptional repression complex with transcription factor AP2α. This complex promotes trimethylation at lysine 27 of histone H3 (H3K27me3) in the promoter region of the tumor suppressor gene EMP1, resulting in transcriptional silencing. EMP1 silencing leads to increased myeloma cell proliferation and the concomitant secretion of osteolytic cytokines that contribute to bone destruction. Importantly, EZH2 inhibitors effectively treat myeloma-induced osteolytic lesions. Thus, targeting EZH2 represents a potential therapeutic strategy for preventing and managing myeloma bone disease.

96. Candida albicans bloodstream infections are comprised of diverse populations of strains, including antifungal tolerant strains that emerge during treatment failure

Abstract Background The longstanding model is that most bloodstream infections (BSIs) are caused by a single strain that passes through a bottleneck. C. albicans exhibits genomic and phenotypic plasticity, but it is unknown whether within-patient (pt) strain diversity is common during BSIs.Figure 1.C. albicans SNP phylogenyStrains within each patient's blood cultures differed by SNPs and indels Methods We determined short-read whole genome sequences (Illumina NextSeq) of 10 C. albicans strains from blood cultures (BCs) in each of 4 pts at baseline (n=4) and during persistent BSIs (3 of 4). In depth phenotypic assays were performed on strains from 1 pt.Figure 2.C. albicans large scale genomic variantsStrains within 3/4 pts (MN, QR, G) were distinct by large scale variants, including aneuploidies, copy number variations and LOH. Results Strains clustered by pt by single nucleotide polymorphism (SNP) phylogeny. BCs from each pt contained mixed populations of strains that differed by SNPs and indels (n=4 pts; 0-42 SNPs, 0-9 indels/pt), gene copy numbers (n=2), chromosome 5 or 7 aneuploidy (n=2), and loss of heterozygosity (n=1) [Fig 1, 2]. Chromosome 7 trisomy (Tri7) and euploid strains from 1 pt (MN) exhibited identical antifungal minimum inhibitory concentrations. However, euploid strains significantly outcompeted Tri7 strains in presence of micafungin in vitro, consistent with echinocandin tolerance [Fig 3]. In absence of micafungin, Tri7 strains significantly outcompeted euploid strains within human blood ex vivo and during mouse gastrointestinal colonization, colon invasion and BSIs, despite attenuated hyphal formation in vitro and in vivo [Fig 4]. Over-expression of chromosome 7 gene NRG1 (transcriptional repressor) in euploid strains recapitulated Tri7 phenotypes, including repressed hyphal and biofilm formation. Tri7 strains represented 76% of the baseline BC population in pt MN. After 2 days of micafungin treatment, euploid strains were ≥ 95% of the population. In control experiments, changes in ploidy were not evident following incubation of index strain M1 in BC bottles in vitro.Figure 3.Phenotypic differences between Tri7 and euploid strains from pt MNA) M2 (euploid) outcompetes M1 (Tri7) in presence of micafungin in vitro in absence of differences in MIC. B) Tri7 strains are attenuated in hyphal formation. C) NRG1 overexpression in euploid M2 background represses biofilm and hyphal formation. Conclusion Positive BCs are comprised of diverse C. albicans populations rather than single, genetically identical strains. Within-pt strains may demonstrate differences in responsiveness to antifungal agents and virulence that are not recognized by the clinical micro lab. In some cases, antifungal treatment failures are due to selection of pre-existing resistant or tolerant strains. Results challenge standard clinical and microbiology practices that focus on single Candida strains.Figure 4.Tri7 strain M1 outcompetes euploid strain M2 during GI colonization and disseminated candidiasis.A) GI colonization mouse model. B) Competitive indices within kidneys during disseminated candidiasis Disclosures Cornelius J. Clancy, MD, Cidara: Grant/Research Support|Gilead: Honoraria|Merck: Grant/Research Support|Scynexis: Advisor/Consultant|Shionogi: Advisor/Consultant|Venatorx: Advisor/Consultant

UBE2J1 is identified as a novel plasma cell-related gene involved in the prognosis of high-grade serous ovarian cancer

BackgroundImmune cells within tumor tissues play important roles in remodeling the tumor microenvironment, thus affecting tumor progression and the therapeutic response. The current study was designed to identify key markers of plasma cells and explore their role in high-grade serous ovarian cancer (HGSOC).MethodsWe utilized single-cell sequencing data from the Gene Expression Omnibus (GEO) database to identify key immune cell types within HGSOC tissues and to extract related markers via the Seurat package. The effects of immune cell markers on prognosis were analyzed via univariate Cox regression, least absolute shrinkage and selection operator (LASSO) and gene set variation analysis (GSVA) of bulk sequencing data from The Cancer Genome Atlas (TCGA)-HGSOC cohort. Finally, the effects of key markers on HGSOC cells were evaluated via Cell Counting Kit-8 (CCK-8), Transwell, colony formation, wound healing, immunofluorescence and in vivo tumor growth assays.ResultsAt the single-cell level, we detected a significant increase in the proportion of plasma cells in HGSOC samples compared to that in normal ovarian samples. Within HGSOC tissues, these plasma cells were found to interact with CD8 + T cells, fibroblasts and endothelial cells. In addition, patients in the high-plasma cell-related score group had better survival rates and higher epithelial‒mesenchymal transition (EMT), apoptosis and immune scores. Moreover, univariate Cox and LASSO regression analyses revealed that ubiquitin-conjugating enzyme E2 J1 (UBE2J1) is a prognostic marker in HGSOC. Further functional studies revealed that overexpression of UBE2J1 promoted cell proliferation, invasion, migration and colony formation, whereas UBE2J1 knockdown attenuated the abovementioned cellular behaviors. Additionally, UBE2J1 overexpression promoted EMT, as evidenced by alterations in the protein expression levels of N-cadherin, snail family transcriptional repressor 2 (Slug), Twist family BHLH transcription factor 1 (Twist 1) and E-cadherin. Moreover, we found that UBE2J1 silencing was able to inhibit the tumor growth in vivo.ConclusionsOverall, this study elucidated the role of plasma cells and revealed UBE2J1 as a novel oncogene in HGSOC, uncovering new mechanisms related to HGSOC tumorigenesis and promising therapeutic targets for HGSOC patients.

Repression of CADM1 transcription by HPV type 18 is mediated by three-dimensional rearrangement of promoter-enhancer interactions.

Upon infection, human papillomavirus (HPV) manipulates host cell gene expression to create an environment that is supportive of a productive and persistent infection. The virus-induced changes to the host cell's transcriptome are thought to contribute to carcinogenesis. Here, we show by RNA-sequencing that oncogenic HPV18 episome replication in primary human foreskin keratinocytes (HFKs) drives host transcriptional changes that are consistent between multiple HFK donors. We have previously shown that HPV18 recruits the host protein CTCF to viral episomes to control the differentiation-dependent viral transcriptional programme. Since CTCF is an important regulator of host cell transcription via coordination of epigenetic boundaries and long-range chromosomal interactions, we hypothesised that HPV18 may also manipulate CTCF to contribute to host transcription reprogramming. Analysis of CTCF binding in the host cell genome by ChIP-Seq revealed that while the total number of CTCF binding sites is not altered by the virus, there are a sub-set of CTCF binding sites that are either enriched or depleted of CTCF. Many of these altered sites are clustered within regulatory elements of differentially expressed genes, including the tumour suppressor gene cell adhesion molecule 1 (CADM1), which supresses epithelial cell growth and invasion. We show that HPV18 establishment results in reduced CTCF binding at the CADM1 promoter and upstream enhancer. Loss of CTCF binding is coincident with epigenetic repression of CADM1, in the absence of CpG hypermethylation, while adjacent genes including the transcriptional regulator ZBTB16 are activated. These data indicate that the CADM1 locus is subject to topological rearrangement following HPV18 establishment. We tested this hypothesis using 4C-Seq (circular chromosome confirmation capture-sequencing) and show that HPV18 establishment causes a loss of long-range chromosomal interactions between the CADM1 transcriptional start site and the upstream transcriptional enhancer. These data show that HPV18 manipulates host cell promoter-enhancer interactions to drive transcriptional reprogramming that may contribute to HPV-induced disease progression.

A DOF transcriptional repressor-gibberellin feedback loop plays a crucial role in modulating light-independent seed germination.

Plants evolved several strategies to cope with the ever-changing environment. One example of this is given by seed germination, which must occur when environmental conditions are suitable for plant life. In the model system Arabidopsis thaliana seed germination is induced by light; however in nature, seeds of several plant species can germinate regardless of this stimulus. Whereas the molecular mechanisms triggered by light for seed germination are well understood, the ones permitting plants to germinate in the dark are still vague mostly due to the lack of suitable model systems. Here we employ Cardamine hirsuta, a close Arabidopsis relative, as a powerful model system to uncover the molecular mechanisms underlying light-independent germination. Comparing Cardamine and Arabidopsis we show that the maintenance of the pro-germination hormone Gibberellin (GA) levels prompt Cardamine seeds to germinate in dark and light conditions. Via genetic and molecular biology experiments, we show that the Cardamine DOF transcriptional repressor DOF AFFECTING GERMINATION 1 (ChDAG1), homologous to the Arabidopsis DAG1 transcription factor, is involved in this process functioning to mitigate GA levels via negative regulation of ChGA3OX1 and ChGA3OX2 gibberellin biosynthetic genes, independently of light conditions. We also demonstrate that this mechanism is likely to be conserved in other Brassica species capable of germinating in dark conditions, such as Lepidium sativum and Camelina sativa. Our data support the proposal that Cardamine is a new model system suitable for light-independent germination studies. Exploiting this system we also resolved a long-time question about the mechanisms controlling the light-independent germination in plants, opening new frontiers for future studies.

ETV5-Mediated Transcriptional Repression of DDIT4 Blocks Macrophage Pro-Inflammatory Activation in Diabetic Atherosclerosis.

Atherosclerosis risk is elevated in diabetic patients, but the underlying mechanism such as the involvement of macrophages remains unclear. Here, we investigated the underlying mechanism related to the pro-inflammatory activation of macrophages in the development of diabetic atherosclerosis. Bioinformatics tools were used to analyze the macrophage-related transcriptome differences in patients with atherosclerosis and diabetic mice. LDLR-/- mice with DDIT4 depletion were generated and fed a Western diet to induce atherosclerosis. DDIT4 expression was elevated in diabetic mice and patients with atherosclerosis. Macrophage proinflammatory factors F4/80, Il-6, and TNFα were reduced in DDIT4-/-LDLR-/- mice and necrotic areas were decreased in the aortic root. Atherosclerotic plaque stability was increased in DDIT4-/-LDLR-/- mice, as evidenced by increased collagen and smooth muscle cell content. DDIT4, regulated by ETV5, acted on macrophages, affecting lipid accumulation, migration capacity, and pro-inflammatory responses. Knockdown of ETV5 increased expression of DDIT4 and pro-inflammatory factors in macrophages, increased necrotic core area in the aortic root, and decreased stability of atherosclerotic plaques in mice, which was abated by DDIT4 knockdown. The findings provide new insight into how diabetes promotes atherosclerosis and support a model wherein loss of ETV5 sustains transcription of DDIT4 and the pro-inflammatory activation of macrophages.

Targeting the IKZF1/BCL-2 axis as a novel therapeutic strategy for treating acute T-cell lymphoblastic leukemia

ABSTRACT Objectives Acute T-cell lymphoblastic leukemia (T-ALL) is a severe hematologic malignancy with limited treatment options and poor long-term survival. This study explores the role of IKZF1 in regulating BCL-2 expression in T-ALL. Methods CUT&Tag and CUT&Run assays were employed to assess IKZF1 binding to the BCL-2 promoter. IKZF1 overexpression and knockdown experiments were performed in T-ALL cell lines. The effects of CX-4945 and venetoclax, alone and in combination, were evaluated in vitro and in vivo T-ALL models. Results CUT&Tag sequencing identified IKZF1 binding to the BCL-2 promoter, establishing it as a transcriptional repressor. Functional assays demonstrated that IKZF1 overexpression reduced BCL-2 mRNA levels and increased repressive histone marks at the BCL-2 promoter, while IKZF1 knockdown led to elevated BCL-2 expression. CX-4945, a CK2 inhibitor, could reduced BCL-2 levels in T-ALL cells. Notably, knockdown of IKZF1 partially rescued the CX-4945-induced repression of BCL-2. These results underscore the CK2-IKZF1 signaling axis as a key regulator of BCL-2 expression. In vitro, CX-4945 enhanced the cytotoxicity of venetoclax, with the combination showing significant synergistic effects and increased apoptosis in T-ALL cell lines. In vivo studies with cell line-derived xenograft (CDX) and patient-derived xenograft (PDX) models demonstrated that CX-4945 and venetoclax combined therapy provided superior therapeutic efficacy, reducing tumor burden and prolonging survival compared to single-agent treatments. Conclusions IKZF1 represses BCL-2 in T-ALL, and targeting the CK2-IKZF1 axis with CX-4945 and venetoclax offers a promising therapeutic strategy, showing enhanced efficacy and potential as a novel treatment approach for T-ALL.

EZH1-DNMT1 axis inhibits the expression of TFPI2 to promote osteogenic differentiation of periosteum-derived stem cells and accelerate fracture repair.

The periosteum lies in a dynamic environment with a niche of periosteum-derived stem cells (PDSCs) for their reparative needs. Here, we report that epigenetic repression of tissue factor pathway inhibitor 2 (TFPI2) mediates the osteogenic potential of PDSCs and the ensuing fracture repair. Significantly overexpressed TFPI2 after fracture was screened using the GSE152677 dataset, and the expression of TFPI2 in bone tissues of post-fracture mice was verified by RT-qPCR and immunohistochemistry. Loss- and gain-of-function assays were conducted using adenoviruses. Primary mouse PDSCs were extracted, and their osteogenic potential was assessed using ALP staining, alizarin red staining, and western blot analysis. The epigenetic modifiers of TFPI2 were verified using ChIP-qPCR, Co-IP, and qMSP. TFPI2 expression was elevated after fracture, whereas enhancer of zeste homolog 1 (EZH1) expression was significantly downregulated. Inhibition of TFPI2 expression promoted fracture repair in mice, which was correlated with enhanced osteogenic differentiation of PDSCs. EZH1 repressed TFPI2 expression by modifying trimethylation of histone H3 at lysine 27 (H3K27me3). EZH1 promoted TFPI2 promoter DNA methylation by recruiting DNA-methyltransferase 1 (DNMT1), leading to transcriptional repression of TFPI2. Overexpression of DNMT1 and EZH1 significantly promoted recovery in fractured mice, which was reversed by inhibition of TFPI2. These results suggest that artificial overexpression EZH1 mediates TFPI2 inhibition by recruiting DNMT1, promoting osteogenic differentiation of PDSCs to accelerate fracture repair.

Telomerase in cancer- ongoing quest and future discoveries.

Telomerase, constituted by the dynamic duo of telomerase reverse transcriptase (TERT), the catalytic entity, and an integral RNA component (TERC), is predominantly suppressed in differentiated human cells due to postnatal transcriptional repression of the TERT gene. Dysregulation of telomerase significantly contributes to cancer development via telomere-dependent and independent mechanisms. Telomerase activity is often elevated in advanced cancers, with TERT reactivation and upregulation of TERC observed in early tumorigenesis. Beyond their primary function of telomere maintenance, TERT and TERC exhibit multifaceted roles in regulating gene expression, signal transduction pathways, and cellular metabolism. The presence of the enzymatic component TERT in both the nucleus and mitochondria underscores its non-canonical roles. Cell death is prevented in TERT-upregulated cells regardless of the DNA damage events and safeguards mitochondrial DNA from oxidative damage. This highlights its protective role in cancer cells where it intersects with glucose metabolism and epigenetic regulation, shaping tumor phenotypes. Oncogenic viruses exploit various strategies to manipulate telomerase activity, aiding cancer progression. The perpetual cell proliferation facilitated by telomerase is a hallmark of cancer, making it an attractive therapeutic target. Inhibitors targeting the catalytic subunit of telomerase, nutraceutical-based compounds, and telomerase-based vaccines represent promising avenues for cancer therapy. Considering the pivotal roles played by the complete enzyme telomerase and TERT component in cancer initiation, substantial endeavors have been dedicated to unravel the mechanisms driving telomerase activation and TERT induction. This review also explores how computational modeling can be leveraged to uncover new insights in telomere research, and efficient targeted therapies.

Transcription near arrested DNA replication forks triggers ribosomal DNA copy number changes.

DNA copy number changes via chromosomal rearrangements or the production of extrachromosomal circular DNA. Here, we demonstrate that the histone deacetylase Sir2 maintains the copy number of budding yeast ribosomal RNA gene [ribosomal DNA (rDNA)] by suppressing end resection of DNA double-strand breaks (DSBs) formed upon DNA replication fork arrest in the rDNA and their subsequent homologous recombination (HR)-mediated rDNA copy number changes during DSB repair. Sir2 represses transcription from the regulatory promoter E-pro located near the fork arresting site. When Sir2 is absent, this transcription is stimulated but terminated by arrested replication forks. This transcription-replication collision induces DSB formation, DSB end resection and the Mre11-Rad50-Xrs2 complex-dependent DSB repair that is prone to chromosomal rDNA copy number changes and the production of extrachromosomal rDNA circles. Therefore, repression of transcription near arrested replication forks is critical for the maintenance of rDNA stability by directing DSB repair into the HR-independent, rearrangement-free pathway.

TFII-I/GTF2I regulates globin gene expression and stress response in erythroid cells.

Transcription factor TFII-I/GTF2I is ubiquitously expressed and has been shown to play a role in the differentiation of hematopoietic cells and in the response to various cellular stressors. We previously demonstrated that TFII-I acts as a repressor of adult β-globin gene transcription and positively regulates expression of stress response proteins, including ATF3. Here we analyzed the function of TFII-I in TF-1 cells during erythroid differentiation and in response to cellular stress, including unfolded protein response, hypoxia, and oxidative stress. Ablation of TFII-I leads to mild changes in cell cycle and proliferation of TF-1 cells. Importantly, TFII-I deficiency increased expression of the adult β-globin gene with concomitant reduction in the expression of the fetal γ-globin genes during erythropoietin mediated erythroid differentiation of TF-1 cells. Furthermore, TFII-I regulates genes involved in stress response, including CHOP, Elongin A, ATF3, ATF4, and Grp78, and participates in the apoptotic response to stressors. In summary, the data provide further support for a role of TFII-I in stress response and in the regulation of globin genes.

E. coli Biomolecules Increase Glycolysis and Invasive Potential in Lung Adenocarcinoma

Introduction: Recent studies have discovered that lung cancer subtypes possess distinct microbiome profiles within their tumor microenvironment. Additionally, the tumor-associated microbiome exhibits altered bacterial pathways, suggesting that certain bacterial families are more capable of facilitating tumor progression than others. We hypothesize that there exists a crosstalk between lung adenocarcinoma (LUAD) cells and bacterial cells. Methods and Materials: RNA sequencing (RNA-seq) was performed on LUAD cell lines to explore the paracrine signaling effects of bacterial biomolecules. Based on our RNA-seq data, we investigated glycolysis by measuring glucose uptake and lactate production, invasive potential through invasion assays, and epithelial-to-mesenchymal transition (EMT) markers. Since lipopolysaccharides (LPS), abundant on the cell walls of Gram-negative bacteria, can activate toll-like receptor 4 (TLR4), we inhibited TLR4 with C34 to assess its relationship with the observed phenotypic changes. To identify the bacterial biomolecules responsible for these changes, we treated the media with RNAse enzyme, charcoal or dialyzed away molecules larger than 3 kDa. Results and Discussion: RNA-seq revealed 948 genes upregulated in the presence of E. coli biomolecules. Among these, we observed increased expression of Hexokinase II (HKII), JUN proto-oncogene, and Snail Family Transcriptional Repressor 1. We verified the elevation of glycolytic enzymes through Western blot and saw elevation of 2-deoxyglucose uptake and lactate production in LUAD cell lines incubated in E. coli biomolecules. In addition to E. coli elevating glycolysis in LUAD cell lines, E. coli exposure enhanced invasive potential as demonstrated by Boyden chamber assays. Notably, inhibition of TLR4 did not reduce the impact of E. coli biomolecules on glycolysis or the invasive potential of LUAD. Modulating the E. coli-supplemented media with RNAse enzyme or dextran-coated charcoal or using a spin column to remove biomolecules smaller than 3 kDa resulted in changes in HKII and Claudin protein expression. These findings suggest a direct relationship between E. coli and LUAD, wherein several cancer hallmarks are upregulated. Future studies should further investigate these bacterial biomolecules and their role in the tumor microenvironment to fully understand the impact of microbial shifts on cancer progression.

Development of compounds for targeted degradation of mammalian cryptochrome proteins.

The mammalian cryptochrome proteins (CRY1 and CRY2) are transcriptional repressors most notable for their role in circadian transcriptional feedback. Not all circadian rhythms depend on CRY proteins, however, and the CRY proteins are promiscuous interactors that also regulate many other processes. In cells with chronic CRY deficiency, protein homeostasis is highly perturbed, with a basal increase in cellular stress and activation of key inflammatory signalling pathways. Here, we developed tools to delineate the specific effects of CRY reduction, rather than chronic deficiency, to better understand the direct functions of CRY proteins. Performing a bioluminescence screen and immunoblot validation, we identified compounds that resulted in CRY reduction. Using these compounds, we found that circadian PERIOD2 (PER2) protein rhythms persisted under CRY-depleted conditions. By quantitative mass spectrometry, we found that CRY-depleted cells partially phenocopied the proteomic dysregulation of CRY-deficient cells, but showed minimal circadian phenotypes. We did, however, also observe substantial off-target effects of these compounds on luciferase activity and could not ascertain a specific mechanism of action. This work therefore highlights both the utility and the challenges of targeted protein degradation and bioluminescence reporter approaches in disentangling the contribution of CRY proteins to circadian rhythmicity, homeostasis and innate immune regulation.This article is part of the Theo Murphy meeting issue 'Circadian rhythms in infection and immunity'.

Impacts of perR on oxygen sensitivity, gene expression, and murine infection in Clostridioides difficile 630∆erm.

Clostridioides difficile infection (CDI), characterized by colitis and diarrhea, afflicts approximately half a million people in the USA every year, burdening both individuals and the healthcare system. C. difficile 630Δerm is an erythromycin-sensitive variant of the clinical isolate C. difficile 630 and is commonly used in the C. difficile research community due to its genetic tractability. 630Δerm possesses a point mutation in perR, an autoregulated transcriptional repressor that regulates oxidative stress resistance genes. This point mutation results in a constitutively de-repressed PerR operon in 630Δerm. To address the impacts of perR on phenotypes relevant for oxygen tolerance and relevant to a murine model of CDI, we corrected the point mutant to restore PerR function in 630∆erm (herein, 630∆erm perRWT). We demonstrate that there is no difference in growth between 630Δerm and 630Δerm perRWT under anaerobic conditions or when exposed to concentrations of O2 that mimic those found near the surface of the colonic epithelium. However, 630∆erm perRWT is more sensitive to ambient oxygen than 630∆erm, which coincides with alterations in expression of a variety of perR-dependent and perR-independent genes. Finally, we show that 630∆erm and 630∆erm perRWT do not differ in their ability to infect and cause disease in a well-established murine model of CDI. Together, these data support the hypothesis that the perR mutation in 630∆erm arose as a result of exposure to ambient oxygen and that the perR mutation in 630∆erm is unlikely to impact CDI-relevant phenotypes in laboratory studies.IMPORTANCEClostridioides difficile is a diarrheal pathogen and a major public health concern. To improve humans' understanding of C. difficile, a variety of C. difficile isolates are used in research, including C. difficile 630Δerm. 630Δerm is a derivative of the clinical isolate 630 and is commonly studied because it is genetically manipulable. Previous work showed that a mutation in perR in 630Δerm results in a dysregulated oxidative stress response, but no work has been done to characterize perR-dependent effects on the transcriptome or to determine impacts of perR during infection. Here, we identify transcriptomic differences between 630∆erm and 630∆erm perRWT exposed to ambient oxygen and demonstrate that there is no strain-based difference in burdens in murine C. difficile infection.