Top Shelf Research Articles

MODERN STEEL-CONCRETE SPAN STRUCTURES OF SMALL AND MEDIUM-SPAN BRIDGES

The paper reviews the most common reinforced concrete girder structures of modern bridges used in Ukraine and other countries. The scope, advantages and disadvantages of reinforced concrete structures are considered. The peculiarities of the use of reinforced concrete structures in European countries are reviewed. The most common typical structural solutions of reinforced concrete girder structures used worldwide are given. Options for facilitation of reinforced concrete structures without significant loss of load-bearing capacity are also highlighted. Options for facilitation of structures are presented in the article by lightening the metal load-bearing elements and reducing the weight of the reinforced concrete slab of the carriageway. Reducing the weight of metal elements can be obtained through the use of perforated elements, which can be performed by waste-free technology. To reduce the cost of materials and reduce the weight of the reinforced concrete slab, it is designed lightweight – hollow or ribbed. When removing concrete from the stretched zone, only the ribs of the width required to accommodate the welded frames and ensure the strength of the panels on an inclined cross section are retained. In this case, the plate in the span between the ribs work on the bend as beams of T-section. The top shelf of the plate also works on the local bend between the ribs. During the inspection, the article presents a new design of reinforced concrete girder structure, using perforated box metal elements, made by waste-free technology, and lightweight reinforced concrete slab of the carriageway with hollow formers. Metal blocks are connected to each other by bolts. Metal blocks are made of perforated sheet elements made of waste-free technology. Each block consists of two main beams, transverse diaphragms and a lower plate. The upper belt of the main beams is implemented with the device of horizontal shelves along the entire length of the beams, performing the function of a supporting element for the reinforced concrete slab. Combining all structural elements into a single finished unit is carried out in the factory by automatic welding, which, in turn, allows us to achieve the high factory readiness. The diaphragms of the block are made with a comb along the upper border, on which a profiled steel sheet is placed, which is a fixed formwork for a reinforced concrete slab. The plate is made of non-removable formwork. To ensure the joint operation of the metal part and the reinforced concrete slab, a system of discrete-continuous connections in the form of rigid stops connected in the longitudinal and transverse directions by reinforcing rods is proposed.

Calculating quantities of ice gel for cooling of fresh-cut melon in temporary storage box during distribution

Temperature reduction can be done by adding a cooling media, one of which is ice gel. The use of ice gel as a cooling medium should take notice of the load heat during distribution because the load of heat that is removed by ice gel is limited. The calculation of the required heat load that needed to be removed to determine the amount of ice gel required during distribution. The calculations include the heat load of the storage box, the heat load of the fruit, and the heat load of the fruit respiration. The temporary storage box is made of thermotec heat shield material and has 3 shelves. This study uses fresh-cut melon as a sample of stored fruit. The result of calculating the ice gel needed in the distribution and storage for the top shelf and middle shelf respectively as many as 3 ice gel and the bottom shelf is 2 of ice gel 0.496 grams to storage 22 fresh-cut melon-sized 60 grams.

First report of Tobacco ringspot virus in highbush blueberry in Washington State.

Since 2015, several blueberry plants (Vaccinium corymbosum) of cvs. Draper and Top Shelf in an organic farm in eastern Washington State showed reduced growth with deformed leaves displaying chlorotic spots, rings, and red blotches and producing small and poorly ripened berries. The symptomatic plants showed gradual decline within 2 to 3 years post-planting. In ELISA using antibodies (Agdia, Inc., USA) to Blueberry leaf mottle virus, Cherry leaf roll virus, Peach rosette mosaic virus, Strawberry latent ringspot virus, Tomato black ring virus, Tomato ringspot virus, and Tobacco ringspot virus [TRSV]), leaf samples from six symptomatic plants tested positive only to TRSV (Secoviridae: Nepovirus). Subsequently, total RNA was isolated from leaves of a symptomatic plant using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, USA). High quality RNA was subjected to high-throughput sequencing (HTS) on the Illumina© NovaSeq™ platform (Huntsman Cancer Institute, UT, USA). An average of ~28 million 150-base pair (bp) paired-end reads obtained were subjected to quality filtering followed by de novo assembly using CLC Genomics Workbench (v12.0) and BLASTn analysis (http://www.ncbi.nlm.nih.gov/blast). Two contigs of 2,778 bp (average coverage: 11,031.7) and 3,589 bp (average coverage: 11,882) showed, respectively, a maximum of 97.3 and 97.6% nucleotide (nt) identity with TRSV RNA1 of a South Korean isolate (KJ556849). Another contig of 3,615 bp (average coverage: 7072.1) showed a maximum of 92.8% nt identity with TRSV RNA2 of an isolate from Iowa (MT563079). The HTS data revealed no other viral sequences reported from blueberry plants (Martin and Tzanetakis 2018). To further confirm the presence of TRSV, extracts of leaf samples from seven symptomatic and ten asymptomatic plants collected randomly from cvs. Draper and Top Shelf were tested by RT-PCR using primers specific to a region of the helicase gene of TRSV RNA1 (Forward: GACTACTGAGCAACATTGCAACTTCC, Reverse: GTCCCCTAACAGCATTGACTACC) and the coat protein gene of TRSV RNA2 (Forward: GCTGATTGGCAGTGTATTGTTAC, Reverse: GTGTTCGCATCTGGTTTCAAATTGG). An approximately 360 bp fragment specific to RNA1 and ~640 bp fragment specific to RNA2 were amplified only from symptomatic samples. Sanger sequence analysis of amplicons specific to RNA1 and RNA2 showed 98.1% and 96.8% nt identity with corresponding sequences of TRSV isolates from South Korea (KJ556849) and Iowa (MT563079), respectively. These results confirmed the presence of TRSV in symptomatic blueberry plants. The complete sequence of RNA1 (7,512 nt, MW495243) and RNA2 (3,925 nt, MW495244) genome segments of the blueberry isolate determined in this study showed 95.9 and 93.2% nt sequence identity, respectively, with corresponding TRSV sequences from South Korea (KJ556849) and Iowa (MT563079). Based on previous reports (Converse and Ramsdell 1982, Martin et al. 2012, Martin and Tzanetakis, 2018), this study represents the first report of TRSV infecting highbush blueberry in Washington State. Since the State has emerged as the national leader in blueberry production, the results will strengthen plant health certification standards to provide virus-tested propagative materials for domestic growers and export to the European Union.

Junkwraith by Ellinor Richey

Reviewed by: Junkwraith by Ellinor Richey April Spisak Richey, Ellinor Junkwraith; written and illus. by Ellinor Richey. Top Shelf, 2021 [288p] Paper ed. ISBN 9781603095006 $24.99 Reviewed from digital galleys R Gr. 4-6 In a fit of pique and exhaustion, Florence throws away her ice skates. One would expect she could just come back for them once she calms down, but in this futuristic world, the act of throwing away something she used to love has dire consequences, and a ghost is now attacking her memories as punishment for the abandonment. The junkwraith is formidable, and Florence begins her quest into the Wastelands with almost no assistance or confidence, hardly a worthy opponent for a vengeful spirit. This Swedish graphic novel uses color in brilliant ways, with washed out, muted city scenes echoing the more vibrantly shaded panels when Florence begins to find herself on her quest. The dynamic, unexpected linework reenforces the setting, a futuristic world that is only hinted at in the illustrations and occasional comments. The concept that all the waste we make will haunt us is a compelling one, as is the premise that once-precious, discarded things have the most potential to torture us: this is Toy Story gone horribly wrong. Give this genre-fluid tale to [End Page 102] horror, science fiction, and fantasy buffs, or even realistic fiction readers who don’t mind their family explorations or coming of age stories souped up with some supernatural elements. Copyright © 2021 The Board of Trustees of the University of Illinois

Onion Skin by Edgar Camacho

Reviewed by: Onion Skin by Edgar Camacho Elizabeth Bush Camacho, Edgar Onion Skin; written, tr. from the Spanish, and illus. by Edgar Camacho. Top Shelf, 2021 [160 p] Paper ed. ISBN 9781603094894 $14.99 Reviewed from digital galleys R Gr. 9-12 Buoyed temporarily by severance pay from a dissatisfying job in a small ad agency, Rolando meets his soulmate, Nera, at the perfect time. Nera has also dropped off the work grid and camps out in a friend's abandoned food truck; with hard work and some modest investment, they rehab the truck the truck and hit the road, armed with optimism and two planters of a spice that Nera's grandmother had passed to her as the unique enhancement for family recipes. Their growing success is imperiled, though, when they unwittingly encroach on the territory of rival food truckers, the Hellpigs, who vandalize the truck and steal the spices. They refuse to withdraw meekly, and with the assistance of a feisty motel manager who had once suffered the Hellpigs' wrath, they stage an epic act of revenge that puts them on the lam but also puts the Hellpigs out of business for good. The plot is straightforward, but the structure of Camacho's graphic novel is anything but, unreeling into a mirrored funhouse of fractured episodes for readers to piece together. Those initially boggled by the dearth of segues will latch on to a clear timeline clue: Rolando's arm in a sling, signaling the story's "opening" event, the result of the on-purpose accident that leads our hero to Nera and his adventure. Fluid, sharp-edged rendering awash in dusky Southwestern hues nimbly blends setting and mood in this Mexican import; teens sensing uncertain adulthood looming uncomfortably close will find the darkness, tempered with a hopefully-ever-after ending, a resonant read. [End Page 419] Copyright © 2021 The Board of Trustees of the University of Illinois

Adrift

Adrift Erin Miller Reid (bio) When Georgeanna first arrived in Mainz, the German students assessed her shoes. She wore a pair of Reebok sneakers she'd taken great pains to keep snow white, at times even scrubbing the soles with Comet cleaning powder. "You can always know an American by their shoes," a classmate said in accented English. "They wear sneakers everywhere, not just to do sport." His English was far better than [End Page 17] Georgeanna's German, even though she was the one spending two semesters abroad. The next day she wore her brown loafers instead, complete with a shiny copper penny wedged in the slit just over the tongue. "Those shoes look like something my Oma would wear," a female classmate said with brusque German-bred honesty that Georgeanna would eventually learn to not take personally. After class, Georgeanna took a bus downtown, its wide body weaving with hisses and sighs between timber-lined buildings that hovered along narrow streets originally intended for pushcarts and wagons, never vehicles the size of single-wide mobile homes. Georgeanna stared at the bus's floor appraising the shoes of other passengers. Indeed, the elderly ladies, their wheeled produce baskets in tow, wore loafers. Georgeanna reasoned that her own penny loafers were sleeker and daintier than the heavy-soled sort West German senior citizens wore. However, she noticed that the girls closer to her age sported heels of all types—strappy and close-toed, rounded and squared, mostly sleek black and dark brown—but all with height. At the department store, Georgeanna chose a chocolate-brown pair of lace-up, platform Oxfords. She caught her heels on cracked sidewalks at first, and her ankles ached at the end of the day, but no one commented on how American she looked anymore, or how she resembled a grandmother. That was months ago. Now Georgeanna managed the sidewalks of West Germany in heels with confidence. She expertly navigated the cobblestone streets of downtown without stumbling. She raced up the stairwell when she was late for class, and climbed the library stepladder to reach books on the top shelf. Her honed skills of heel-wearing were put to the test in one of the wooded thickets tucked in and around the [End Page 18] campus. Georgeanna admired the German penchant for nature, and these woods, as small as they were, reminded her of the tree-covered hills back home in Kentucky, where the forests were dense with pines, poplars, and an underbrush of rhododendron, creeper vine, and fallen trunks that she and her siblings, Elena and P.J. spent entire days exploring as kids. Georgeanna sat down on a cement bench in the otherwise empty grove to eat an apple and write a letter to her boyfriend Trent. She took a bite of the apple, so juicy that it dripped onto her chin, and scribbled away to Trent, assuring him that despite the good time she was having and all she was learning, she still loved him and missed him. She sunk her front teeth into another mouthful of apple. The crack of the apple's crisp flesh pierced the quiet that had settled in the crop of birch trees and alders. A pigeon scuttled from under the bench and pecked at her feet. Just as Georgeanna bit a tiny morsel of apple to toss to the bird, a completely naked man emerged from the bushes. He blinked as if his eyes were adjusting to the first sun of the day. He was bald from head to toe, no hair on his head, his chest, his arms, or legs. His penis hung unadorned by even the smallest tuft. His skin was pale, like the buttermilk Georgeanna used to dunk leftover cornbread into for an afterschool snack. The Naktbader. She'd only heard about the campus nudist from other students. She'd never seen him herself. According to student lore, he was a graduate school drop-out who camped out in the nooks and crannies of the campus, ate from the cafeteria dumpster, and bathed in the central fountain at odd hours of the night. Students debated his hairless physique, whether it was self-induced...

Transformations: Creating Character in Contemporary Photography

TransformationsCreating Character in Contemporary Photography Kristine Somerville Click for larger view View full resolution Yinka Shonibare, Medusa West, 2015, digital chromogenic print and bespoke wooden frame, © Yinka Shonibare CBE. All rights reserved, DACS/ARS, NY, 2021. Image courtesy James Cohan Gallery, New York and Shanghai, photo: Adam Reich. [End Page 153] Vain trifles as they seem, clothes have, they say, more important offices than merely to keep us warm. They change our view of the world and the world's view of us. … There is much to support the view that it is clothes that wear us and not we them; we may make them take the mould of arm or breast, but they mould our hearts, our brains, our tongues to their liking. —Virginia Woolf, Orlando As a child during the '60s, I fell in love with the adventurous styles of the era, with their bright colors and patterns, variety of materials and textures, and extreme shapes, from form-fitting to free-flowing and voluminous. I had several pieces of clothing that I adored: a silk shirt patterned with wide-eyed, lush-whiskered cats, light blue patent leather saddle shoes, and a richly embroidered peasant top. I was an awkward, shy child who hid behind her mother when strangers spoke to her, but I was extroverted in my sense of style. The flashier the clothes, the better I liked them and the braver I felt when venturing out into the world. Playing dress-up was a favorite pastime. One of the advantages of being a child of divorce was that once my parents remarried, I had four closets to raid rather than two. In my father's, there were pieces from different phases of his life. From his college years, he kept his letterman sweater and fraternity sweatshirts, and from his mandatory military service in the army in Frankfurt, Germany, he still had his green fatigues, flight jacket, and combat helmet. In his early thirties, he was too old for the swinging '60s, but he had the outfits, a beloved Sonny Bono–inspired suede vest lined with llama fur and wide-checked bell-bottom pants. But his uniform of real life—dress shirts and sharply tailored three-piece business suits, the occasional cashmere sweater—crowded out the flashy phases of youth. Hidden in the recesses of my stepmother's closet was a cornucopia of psychedelic silk minidresses, cotton granny dresses, platform shoes, and floppy hats, but I loved even more the slinky evening gowns that she wore when they went out for a night on the town in Chicago. Her closet resembled a small boutique, with a three-way mirror; sequined handbags and strappy heels lined the top shelves, stored in their original boxes. [End Page 154] Click for larger view View full resolution Silin Liu, Frida Kahlo & Céline Liu, 2017, color photograph, courtesy of the artist My mother and stepfather were more practical and less sentimental about clothes. While they didn't keep much from the past, in my stepfather's closet, among his sensible leisure suits, were a few surprises: a paisley smoking jacket with a tasseled belt and a couple of Western shirts with pearl snap buttons. My mother didn't particularly like clothes and tended toward comfortable permanent-press trousers and matching turtlenecks. But she did have a fondness for wigs. A row of felt-covered Styrofoam heads sat atop her dresser, displaying a frosted shag, a blond pageboy, and a mess of brown, tousled curls. The trials of work and the tribulations of a blended family kept my mother and stepfather exhausted. Their dressier clothes languished in dry cleaners' plastic, and the wigs gathered dust, except when I shook one off, popped [End Page 155] Click for larger view View full resolution Silin Liu, Andy Warhol & Céline Liu, 2015, color photograph, courtesy of the artist it on my head, and paraded around the house while draped in strings of fake pearls that I had pillaged from her jewelry box. Child psychologists often encourage the play of dressing up because it allows children to explore the adult world. This was true for me. I didn't yet have a sense of my...

Intakes of top shelf foods and contribution to energy and nutrients in a representative sample of school-aged children (5–12y) in Ireland

Intakes of top shelf foods and contribution to energy and nutrients in a representative sample of school-aged children (5–12y) in Ireland

Peculiarities of the classification of economically valuable indicators of highbush blueberry varieties of Vaccinium corymbosum L.

Purpose. To substantiate the features of the classification of morphobiological and economically valuable indicators of highbush blueberry varieties of Vaccinium corymbosum L.Methods. The studies were carried out during 2012–2019. Research methods: field (visual examination of the manifestation of morphological signs of vegetative and generative organs of blueberry plants), laboratory (determination of the content of vitamin C, total sugar, pectin, carotenes, anthocyanins, flavonoids, total acidity in berries), analytical, comparative, statistical (cluster analysis).Results. Over the years of research, varieties of highbush blueberries were characterized by a stable manifestation of homogeneous morphological traits and economically valuable performance indicators. In particular, the studied varieties are classified according to ripeness groups: very early: ‘Fiolent’; early: ‘Draper’, ‘Huron’, ‘Clockwork’, ‘Cargo’, ‘Laska’; medium: ‘Blue Ribbon’, ‘Top shelf’, ‘ZF08-070’, ‘Mavka’; late: ‘Liberti’, ‘Last Call’ and very late: ‘Aurora’, ‘Overtime’. It was determined that the quantitative morphological traits of highbush blueberry varieties that influenced the formation of plant productivity include such traits as growth vigor, leaf length, leaf width, inflorescences lengthwise, bunch density, fruit size. Economically valuable indicators of suitability of highbush blueberry varieties remained stable within the ripeness group. The highest yield (19.5 t/ha) was provided by the mid-season variety ‘Mavka’ of domestic selection. The yield of berries from the bush of this variety was also high and amounted to 7 kg. The studied performance indicators were low in the variety ‘Blue Ribbon’ – 10.2 t/ha and 2.4 kg, respectively. The minimum and maximum values of the manifestation of characteristics will serve to establish the limiting boundaries of its variation in the next modeling of economically valuable indicators of highbush blueberry varieties.Conclusions. Such morphobiological characteristics of highbush blueberry varieties, as plant growth vigor, leaf length, leaf width, inflorescences lengthwise, bunch density, fruit size are closely related to plant productivity, berry yield per bush, berry weight and yield. Therefore, they can be involved in the development and improvement of the model of suitability indicators of highbush blueberries for distribution in Ukraine.

First report of Lasiodiplodia theobromae causing decline of blueberry (Vaccinium corymbosum L.) in the Czech Republic.

Popularity of blueberries (Vaccinium corymbosum L.) has been rising worldwide, due to their nutritional bioactive compounds such as flavonoids, anthocyanins and polyphenols (Sinelli et al. 2008). These factors led to an increase of the demand for fresh blueberries in the Czech market, which resulted in increased blueberry planted in the Czech Republic. In spring 2018, about 200,000 1-year-old blueberry plants originally from the Netherlands were planted on 47 ha in the South Moravian region. In September 2019, wilting of leaves and shoots, bark necrosis and dieback of the plant were observed. The occurrence of blueberry decline symptoms in the field was near 2% of 5,000 observed plants which resulted in significant yield losses at the beginning of the production. Twenty shoots of symptomatic plants were collected (one shoot from each plant, twenty plants in total) and surface-disinfected using 75% ethanol. Necrotic tissues of xylem were aseptically placed on potato dextrose agar (PDA) (Himedia, India) amended with streptomycin and incubated at 25°C in the dark for one week. Nine isolates of Botryosphaeriaceae-like fungi were obtained from twenty plants and were transferred on PDA. Aerial mycelium grew rapidly, initially white, and then became grey to black. To enhance the conidia production, the isolates were transferred on water agar (Himedia, India) with autoclaved poplar twigs, placed near day light and incubated at room temperature. Three weeks later, black pycnidia were observed on the poplar twigs. Mature pycnidia exuded white/grey coloured masses of conidiospores. Conidia were granular, subcylindrical to elliptical. Immature conidia were single-celled and hyaline measuring 9.73 ± 1.39 × 16.86 ± 1.81 µm (n=60). Mature conidia were thick-walled with a septum from 11.30 ± 1.17 × 16 ± 1.58 µm (n=60). Based on conidiogenous cells, paraphyses and longitudinal striations on mature conidia characteristics, the isolates were morphologically assigned to the Lasiodiplodia genus (Phillips et al. 2013). Isolates were single-spored and total DNA was extracted with NucleoSpin Tissue (Macherey-Nagel, Germany) following manufacturer's protocol. ITS region, including the 5.8S, and part of the translation elongation factor 1 alpha (TEF-1α) were amplified with ITS1/ITS4 and EF1-728F/EF1-986R primers, respectively (Carbone and Kohn 1999; White et al. 1990). Consensus sequences were blasted using NCBI nucleotide BLASTn search. The sequences of ITS region were in 468/469 nts (MEND-F-00167) and 486/490 nts (MEND-F-00168) similar to Lasiodiplodia theobromae isolate CBS 287.47 and 286/289 nts (MEND-F-00167), 287/290 nts (MEND-F-00168) in case of TEF-1α. Sequences of two representative isolates (MEND-F-00167 and MEND-F-00168) were deposited in GenBank under accession numbers MN983133 and MN983134 for ITS and MN989914 and MN989915 for TEF-1α. For pathogenicity tests, 6 mm agar plugs with mycelium obtained from ten day old mycelia of both fungal isolates were inoculated on ten 1-year-old blueberry shoots cv. Top Shelf collected from one plant, using a cork borer. Five shoots and pure agar plugs were used as a control. Plugs were covered with wet cotton wool to keep moisture and fixed with Parafilm. After three weeks, characteristic discoloration and lesions appeared on the inoculated shoots. Control shoots remained symptomless. Necrotic tissue was aseptically cut and L. theobromae was re-isolated on PDA. Identity of fungus was confirmed by morphological characterization and sequencing, fulfilling Koch´s postulates. Blueberry decline caused by Botryosphaeriaceae spp. has already been described around the world (Hilário et al. 2020; Tennakoon et al. 2018; Wiseman et al. 2017; Xu et al. 2015). To our knowledge, this is the first report of L. theobromae on blueberry in the Czech Republic.

Drying Model for “Rambak” Crackers Production Using Hybrid Greenhouse Effect Dryer with Stove Biomass and Clay Heat Exchanger

A hybrid greenhouse effect dryer was examined for small-medium cracker industries. The system consists of a main drying chamber, biomass stove, heat exchanger, and shelf. This work aims to construct heat and mass transfer model which can describe well the drying process, as well as can be used to predict the greenhouse air temperature, product temperature, and moisture evaporation during drying. Drying is conducted in the room dryer for 9 samples of crackers where each sample is ± 150 grams and is divided into 3 samples placed on the bottom shelf, 3 samples on middle shelf, and 3 samples on the top shelf. Drying is carried out from the initial moisture content of crackers ± 63‒64% to 12‒14% for the standard fries. Mathematics model was simulated in MATLAB software and was validated by comparing the analytical and experimental result. The heat transfer model could describe well the heat transfer process during drying. It was shown that the analytical and experimental results are in good agreement, with mean error range values 5.38‒20.4%.

White wine light-strike fault: A comparison between flint and green glass bottles under the typical supermarket conditions

Abstract White wines from two vintages were bottled in green and flint glass bottles and stored under typical supermarket shelf conditions. Light-strike fault, colour changes, light and temperature exposure were monitored up to 50 days. In general, green glass bottles secured wine quality for the tested period. Only a few flint glass bottled wines developed a fault due to light-strike after 1–2 days of supermarket shelf life, but all developed the fault after 20–40 days; so we considered the possibility of two mechanisms causing the problem. Flint-glass bottled wines stored on the bottom shelf developed the defect only slightly later compared with the wines on the top shelf. Moreover, storing the wines in dark and cold after a period of exposure to light did not eliminate the fault, indicating that the defect is probably additive. Monitoring the amount of light to which wines are exposed could prevent the fault.

Kodi by Jared Cullum

Reviewed by: Kodi by Jared Cullum Kiri Palm Cullum, Jared Kodi; written and illus. by Jared Cullum. Top Shelf, 2020 [176p] (Kodi) Paper ed. ISBN 9781603094672 $14.99 Reviewed from digital galleys R* Gr. 5-8 Loner Katya doesn't have any friends in her summer home of Alaska (not that she has any back in Seattle, either). When her grandmother insists she put away her comic books and go play outside, Katya stumbles upon a massive Kodiak bear, trapped under a fallen log. After Katya and her grandmother save the gentle creature and dub him Kodi, the bond between girl and bear becomes so strong that Kodi stows away on a boat to follow Katya to the mainland. There he befriends Joshua, an injured fisherman, and while Kodi helps Joshua catch fish to pay the rent, Joshua helps Kodi find his way back to Katya. Readers may be plenty familiar with tales of protagonists befriending wild animals, but this graphic novel shines with watercolor backgrounds and sparse text. Cullum can go pages at a time with only landscapes and character expressions, evoking both the expansive wilderness of Alaska and [End Page 468] the loneliness of the city. Kodi never speaks, but his gestures and expressions leave the reader with no question as to his kind soul and love for his human friends. Grownup characters, all with rounded, exaggerated features, tower over tiny Katya in her oversized clothes, emphasizing her feelings of isolation and fear. While Kodi is also of sizeable proportions, his bulk is more akin to that of a favorite blanket, and later images of him in a striped sailor shirt are adorable enough for an audible awwww. This story of friendship and belonging will please fans of graphic novels, nature lovers, and high/low readers. Copyright © 2020 The Board of Trustees of the University of Illinois

Trompe l’oeil: The Art of Deception

Trompe l’oeilThe Art of Deception Kristine Somerville Click for larger view View full resolution Gregory West, Book Bag, oil on panel, 2012 [End Page 141] Click for larger view View full resolution Debra Teare (above, left to right), The Message, 1969; Domino Effect, 1969; Good Medicine, 2006 Like most children growing up during the late ’60s, I had a View- Master, a boxy red plastic stereoscope viewer. It came with a matching case to be filled with reels, thin cardboard disks each containing seven 3D color photographs. If I held the viewer up to a tabletop lamp, the cities of Europe sprang to life, the images crisp and colors sharp, as I found myself on the canals of Copenhagen, lined on both sides with colorful row houses. A click of the lever, and I looked up at Big Ben with its spire and lancet windows gleaming in the afternoon sunlight. Another click, and I was among tourists gathering below the latticed girders and pillars of the Eiffel Tower. These 3D images had such a tactile realism—a simultaneous sense of space and intimacy—that I felt I could reach out and touch each landmark. Despite it all being a trick of the eye, an illusion that disappeared when I flipped off the lamp, I enjoyed the pleasure of being deceived. A similar art of deception is at the heart of trompe l’oeil (“deceive the eye”), a French phrase for paintings that attempt to trick the viewer into thinking their subjects are real rather than mere imitations of reality. The goal of the artist is to reproduce an object or scene, often a commonplace one, with enough exactitude—an almost aggressive reality—that it seems to exist in three-dimensional space. The painting’s heightened verisimilitude should prompt viewers to want to reach out and touch the composition. Trompe l’oeil shares with still-life painting an interest in the artful arrangement and careful study of objects, but its technique [End Page 142] Click for larger view View full resolution Debra Teare, Textures in Tin, 2007; Persistence-of-Vision, 2008 [End Page 143] Click for larger view View full resolution Gregory West, Top Shelf, oil on panel, 2012; Fig Newton, oil on panel, 2017 [End Page 144] Click for larger view View full resolution Gregory West, Book Ends, oil on panel, 2018 avoids interpretation beyond what is represented in the real world. Its one primary goal is the triumph of visual illusion. Trompe l’oeil’s quest for visual fidelity results in a set of well-defined rules that guide everything from style and technique to subject matter. The composition must be a life-size representation that fits perfectly in the setting for which it is intended. The painting should convey a sense of depth and dimension, with its objects standing out sharply and [End Page 145] appearing to occupy the spectator’s space. The artist creates this three- dimensional perspective by projecting objects out of the frame through hard lines, dark, intensified shadows, brilliant highlights, invisible brushstrokes, and expertly blended colors, usually a harmony of muted tones. Live figures are avoided because their appearance seldom deceives the viewer and their dress and accessories tend to date the painting. Click for larger view View full resolution Sharon Moody, Famous Beauties, oil on panel, 2005 [End Page 146] Click for larger view View full resolution Sharon Moody, Rock, Paper, Scissors, oil on canvas, 2008; Yesterday’s Heroes, oil on panel, 2015; It’s Wonder Woman, oil on panel, 2017 [End Page 147] Click for larger view View full resolution Janet Monafo, White Eggs, White Eggplants, pastel on paper, 2007 The charm of trompe l’oeil lies in its vocabulary of familiar and disorderly arranged objects. Classical statuary, shells, butterflies, snakes, and apothecary bottles are scattered among quill pens, dog-eared books, musical instruments, and other exotic curios. These treasures of various kinds are displayed projecting outward from curio cabinets, wall cupboards, and half-opened glass paneled doors or tucked away in niches [End Page 148] Click for larger view View full resolution Janet Monafo, Red Globes and Apricots, pastel on paper, 2002; Fruit and Flowers, pastel on paper, 2018...

Into the Gloss

‘The Top Shelf’ and ‘#ITGToPSHELFIE’ are both webpages of the beauty/ fashion blog ‘Into the Gloss’ (ITG), founded by Emily Weiss in 2010. I have chosen to consider two pages from the same site as the ways in which they are similar and different present another instance of how digital fashion media participates in the fashioning of life. Although men have appeared on both pages, I have focused upon the blogs’ female participants.

Power Outputs During Performance of a Simple Transfer Task

PURPOSE: The Gallon Jug Shelf Test (GJST) is a validated assessment of an older persons’ capacity to transfer moderately heavy objects from a knee-high to a shoulder high shelf. Since power is a major determinant of performance during activities of daily living, we calculated power during the performance of the GJST. METHODS: Subjects performed the GJST in a three-dimensional motion capture laboratory while standing with both feet on force plates. The task was performed in an open unit with immovable shelves to allow visualization of movement. The work done during when lifting a stationary gallon jug from low shelf to high shelf was calculated as shown in equation (1). ΔWork = m (a+g) x Δh (1)Where:m: the mass of the gallon jar (kg)a: the jar’s average acceleration (m/s^2)g: gravitational acceleration (9.81 m/s^2)Δh: difference in height between the bottom and top shelves (m)The power was calculated as the change in the work over the change in time (equation 2).∆Power = ∆ Work / ∆t (2)Where: ∆t: the time spent lifting the jar between the two shelves (s) RESULTS: A mixed ANOVA was used to examine differences in work and power among trials and across repetitions (reps). For work, a Huynh-Feldt analysis revealed a significant difference across repetitions (p=.050, ŋ^2=.068), while pairwise comparisons revealed significantly less work by the fourth (rep 2: Mdiff=.016±.005; rep 3: Mdiff=.012±.005) and fifth repetition (rep 2: Mdiff=.01±.007; rep 3: Mdiff=.014±.007) (p<.05). Similarly, a trend toward significance for differences in power across sets was detected (p=.067, ŋ^2=.064). Pairwise comparisons showed significant declines in power between repetition 2 and repetitions 4 (Mdiff=.002±.001; p=.004) and 5 (Mdiff=.002±.001; p=.015), and between repetitions 3 and 4 (Mdiff=.001±.001; p=.004; p=.029). CONCLUSIONS: The GJST is a viable test of object transfer power and work that can also be used to evaluate fatigue in older persons.

Postcards from the Trenches: A German Soldier's Testimony of the Great War by Irene Guenther

Reviewed by: Postcards from the Trenches: A German Soldier's Testimony of the Great War by Irene Guenther Joe Perry Postcards from the Trenches: A German Soldier's Testimony of the Great War. By Irene Guenther. New York: Bloomsbury, 2018. Pp. 232. Cloth $40.00. ISBN 978-1350015753. Cleaning house after the death of her parents, historian Irene Guenther made a surprising discovery: a dusty envelope, forgotten on a top shelf, that held eighty World War I standard-issue "field postcards," each hand painted with a scene from the German side of the western front. Guenther, whose publications include Nazi "Chic"? Fashioning Women in the Third Reich (2004), discovered that the postcards were illustrated by Otto Schubert, an artist who apparently knew her grandfather in Dresden in the 1920s. Intrigued, Guenther searched for further information about Schubert, uncovering a forgotten artistic career that spanned the final years of the Kaiserreich to the decades [End Page 605] after World War II. The postcards and a selection of Schubert's other war-related lithographs—contextualized with narrative coverage of World War I, contemporary German artists and art movements, and Schubert's biography—are at the core of this book, which argues that Schubert's work "implores a reassessment of [his] place in the canon of World War One art" (46). Indeed, Schubert deserves wider recognition. Born in 1892 in Dresden, Schubert's life was typisch deutsch. The man was tragically buffeted by the crosscurrents of the personal, the professional, and the political that drove German history in the first two thirds of the twentieth century. When the war broke out, Schubert was a student at the Dresden Kunstakademie. Drafted in October 1914, he served on the western front—and sent his future wife Irma ninety hand-painted postcards—until he was wounded in April 1916 at Verdun and subsequently released from military service. Back at the Kunstakademie, Schubert in 1917 published two sets of lithographs with images from the front: 24 Lithographs of the War in the West and The Suffering of Horses in War. He joined the Dresden Secession Group 1919, whose membership included luminaries such as Conrad Felixmüller, Otto Dix, and (as an honorary member) Oskar Kokoschka. In the 1920s, Schubert became a successful illustrator, providing lithographs and woodcuts for a variety of publications ranging from children's books to works by Goethe and the brothers Grimm. Schubert joined the Nazi Party in September 1932, and Guenther explains that the motivations for this move remain obscure. Did the artist sense economic opportunity? Did he approve of the Nazi economic or political programs? Did he share the party's racist ideologies? Whatever the answer, because of the antiwar tenor of his early art and his membership in Group 1919, he was labeled a "degenerate artist" and forbidden from exhibiting his work. Schubert lost his son on the eastern front in 1943, his wife in an early allied bombing attack on Dresden in October 1944, and his studio in the firebombing of February 1945. Although his two daughters moved to West Germany after the war, Schubert stayed in Dresden, remarried in 1950, and resumed his work as a book illustrator; he enjoyed "an extensive retrospective of his work" (73) in an East Berlin state museum in 1957. Before he died of Parkinson's disease in 1970, Schubert painted works critical of the Holocaust, including "Auschwitz Triptych" (1965), reproduced in the book. Schubert's postcards offer remarkable insights into everyday life in the German army in occupied France. His quick watercolors generally avoid depictions of explicit violence, no doubt because they were intended for his girlfriend. Yet the scenes of soldiers working or relaxing behind the lines; the portraits of French civilians, landscapes, and (sometimes ruined) villages; and the occasional view from the front lines comprise an intense personal archive that records the contradictions of occupation (a potential line of interpretation that Guenther ignores). Schubert's 1917 war-themed lithographs were more graphic, with disturbing scenes of death and destruction; the [End Page 606] twelve images included in The Suffering of Horses in War are a unique and moving tribute to the vast numbers of pack animals that served and perished at...

The Cup of Coffee Club: 11 Players and their Brush with Baseball History by Jacob Kornhauser

Reviewed by: The Cup of Coffee Club: 11 Players and their Brush with Baseball History by Jacob Kornhauser Mitchell Nathanson Jacob Kornhauser.The Cup of Coffee Club: 11 Players and their Brush with Baseball History. Lanham, MD: Rowman & Littlefield, 2020. 191 pp. Cloth, $29.95. Reading Jacob Kornhauser’s new book, I couldn’t shake the opening line of Tolstoy’s Anna Karenina: “Happy families are all alike; every unhappy family is unhappy in its own way.” For while the stories of baseball’s heroes are remarkably similar, the ones contained within The Cup of Coffee Club are each singularly tragic. At least nobody throws themselves under a train. Kornhauser has collected eleven such tales and if they’re in fact representative of what it’s like to reach the summit, for one day only I’m glad I never got beyond high school ball. But I suspect they’re not; Tolstoy never saw a baseball game, but he probably nailed it when it comes to the stories of the men who played a solitary game in the big leagues before returning to Earth forever. The book is a fascinating concept: letting readers in on the experience of living out your dream only to have it snatched away after only the slightest nibble. What’s that like? Is it worth it? Or is it better to have never gotten there at all under the theory that only once one experiences Eden can he truly comprehend what he’s missing? Kornhauser interviewed his subjects to get their takes, and while they all seem to be trying very hard to put the most positive spin on things, it’s not difficult to see that what they’re struggling to define as success nevertheless feels very much, at least to them, like a profound failure. These are revealing, albeit tough reads. Take, for instance, the stories of Larry Yount and Stephen Larkin—brothers of top shelf Hall of Famers. Larry was the older brother (of Robin) and Stephen the younger (of Barry), but no matter, the comparisons with their more famous siblings hurt—even to read them, albeit in different ways. And then there’s the tale of Jeff Bannister, who overcame childhood bone cancer, osteomyelitis, temporary paralysis (caused by a home plate collision during a college fall league game), and the untimely death of his father to reach the big leagues with the Pirates on July 23, 1991. In sketch form this story feels like a success, overcoming seemingly insurmountable odds and all. But Kornhauser digs deeper and reveals it to be bittersweet at best. Bannister got a hit in his only big league at-bat, ending his career with a perfect 1.000 batting average. Great, right? But it was a rainy night, the game was a blowout, Bannister played what would be termed “garbage time” had this been the NBA, and he was sent down as soon as the Pirates’ starting catcher, Don Slaught, returned from injury. From then on, Bannister admitted to Kornhauser, he “play[ed] angry” (76). “When you achieve your dream or [End Page 214] you climb Mount Everest and all of a sudden, you have to come back down,” he continued, “it’s just a memory. What’s next? You always need that next step. I didn’t have that next step.” (77). None of them did. Which, perhaps, is the only through line connecting these eleven tough sketches. At least some members of the cup of coffee club have a Jeff Bannister-like memory: Roe Skidmore’s one game likewise produced a hit, and he has the yellowed ball on his mantel to prove it. Yount, by contrast, holds the distinction of being the only pitcher in Major League history to be credited with an appearance without having faced a single batter in his entire big-league career. Kornhauser’s book is sprinkled with fascinating revelations like that one, but there’s a macabre aspect to each of them. They’re fascinating because they’re tragic in one way or another. Which, once again, makes me grateful that none of these tales end in Anna Karenina-like fashion. Because each story is so different than...

The F Street Mess: How Southern Senators Rewrote the Kansas–Nebraska Act by Alice Elizabeth Malavasic

Reviewed by: The F Street Mess: How Southern Senators Rewrote the Kansas–Nebraska Act by Alice Elizabeth Malavasic Andrew F. Hammann (bio) The F Street Mess: How Southern Senators Rewrote the Kansas–Nebraska Act. By Alice Elizabeth Malavasic. (Chapel Hill: University of North Carolina Press, 2017. Pp. 280. Cloth, $29.95.) Alice Elizabeth Malavasic tells the story, and indeed the backstory, of the Kansas–Nebraska Act, a piece of legislation passed in 1854 and commonly cited by historians as the catalyst of the rise of the Republican Party and the sectional discord that became civil war. Malavasic's narrative, which spans the years 1837 to 1861, recounts how a tight-knit group of Congressmen who lived together on F Street in Washington, DC—David Atchison of Missouri, Andrew Butler of South Carolina, and [End Page 605] Robert Hunter and James Mason of Virginia—came to play a decisive role in proposing and defending the most controversial element of the Kansas–Nebraska Act: the repeal of the Missouri Compromise's 36' 30" line, which banned slavery north of this latitude in the Louisiana Territory. Malavasic is not the first historian to point out that the F Street Mess wielded considerable power in shaping and passing a piece of legislation associated, most commonly, with Senator Stephen Douglas of Illinois. She acknowledges this by pointing to past works by Michael Holt, Allan Nevins, David Potter, and, most recently, Rachel Shelden in Washington Brotherhood: Politics, Social Life, and the Coming of the Civil War (Chapel Hill, NC, 2013). What The F Street Mess adds to existing scholarship, Malavasic contends, is a deeper understanding of the role that the "group dynamic" among the four messmates played in constituting their outsized collective influence (14). Malavasic meticulously guides readers through the Kansas–Nebraska debates' complex politics and historical context. She explicates, often with notable clarity, a range of legal arguments made in favor of, or against repeal of, the 36' 30" line and connects these positions to the partisan agendas and personal interests (mostly land speculation and reelection) of the men who formulated them. To keep things lively, Malavasic inflects her delivery with moments of literary flair meant to conjure a sense of historical atmosphere. A good example appears in the lead paragraphs of Chapter 4 where she describes the commencement of the 1853–1854 Congressional session. Malavasic begins by panning around the vast, ornate Senate chamber and establishing each F Street Mess member's location within it. She then shifts the reader's gaze to the "small unadorned" and "spindly" current-bill box on whose bottom shelf a new Kansas–Nebraska bill would most likely soon be placed (81). With a sense of foreshadowing, she finally adds, "whether it would be one of the few [bills] to make it to the narrow top shelf" before the session's end was "uncertain"; "what it would look like if it did" was quite uncertain as well (82). The most intriguing aspect of the book lies in its overall conceptualization. Like Rachel Shelden, Malavasic points out that political histories can give insufficient attention to the ways that personal relationships shaped the political process. More commonly emphasized factors such as "ideology, party, and region" mattered, she readily acknowledges, but in certain instances "friendships" forged and sustained outside of [End Page 606] legislative halls overshadowed these factors in determining the laws produced within them (17). Malavasic contends that the Kansas–Nebraska Act, specifically the Missouri Compromise repeal article, was just such an instance. As valid and intriguing as Malavasic's framework is, it connects to an unsteady aspect of the book. While The F Street Mess provides thoughtful biographies of the individual messmates, it does not deliver a full enough sense of the Mess's group dynamic—the book's purported argumentative hinge—or the interpersonal elements that comprised it. In the first and second chapters, for instance, Malavasic makes much of John Calhoun being key to understanding the F Street Mess's cohesion and influence—"they were the heirs of Calhoun," she asserts (59). Yet these chapters, and subsequent ones, leave readers wanting deeper and more specific explanations of how each member personally understood this "inheritance" and how these understandings...

East of Aztlán

East of Aztlán Cam Rentsch (bio) Every morning, I use my grandmother's coffeepot. Wait, no, that doesn't sound quite right. Let's start this again. I still own my grandmother's coffeepot pot, a stainless-steel 12-cup electric percolator with no buttons and a cord the diameter of my thumb. I'd say that it shows no signs of slowing down, but I don't want to jinx it. It was bought for my grandparents as a wedding gift in 1964, and now, in 2017, I use it daily. These grandparents, my mother's parents, the ones I find myself writing about often, were white. My other grandparents, my father's biological father and mother, I never met. They were Mexicans, probably of mixed Spanish and Indian descent. My father was put up for adoption at the age of three, left as a ward of the state in Southern California. I own a lot of other things that were my mother's parents once upon a time. These things were all handed down off that top shelf of wisdom that my grandfather was always reaching up to for me through my boyhood. A cast-iron skillet and pocket knives and flannel shirts and even guns, a proper essay topic for a young male American writer if there ever was one. Inherited guns. I inherited a coffeepot too, from my grandmother, from 1964, that I use daily. ________ My morning routine usually looks sort of like this: I wake up and roll out of bed, emphasis here on roll, and walk to the kitchen in my underwear, feet stinging on cold tile. I grind coffee beans by hand, in a cheap burr grinder, before filling the pot with water. On some days I'll muster up the motivation to go run, but on most I'll return to my bed with a full cup just before my absence leaves it cold. I started drinking coffee in college, drinking it black after realizing how [End Page 167] much you had to pay for creamer at a campus market. Anything to save a couple bucks. At the time, my grandparents still owned their coffeepot and I had a little four-cup one from Walmart, and my grandparents were both still alive, and my grandmother would send me care packages of cookies in Pringles cans to keep the post office from breaking them. Those and black coffee were all I lived on for a little while. All I could afford to live on, with no time then outside of class for a job. ________ It's easy to talk about inheritance in the form of things. I inherited my grandmother's coffeepot, my grandfather's flannel shirts, and his 12-gauge shotgun. From my father I inherited the jersey number that we both wore for the same football team of a rural high school where the son of the man who coached him coached me. You can't make up that shit, rural and American to the core. Football and fathers and inherited jersey numbers. We talked a lot about inheritance growing up in Appalachia. We inherit shotguns, and we kill the animals that fill our freezers with them. We inherit disdain for big government and the ebt cards in our wallets. If you're lucky, you can inherit a muscle car with faded paint left in the barn, weeds growing around rotted tires. If you're lucky like me, you can inherit otherness. ________ Let's start with Mexican. Who do I have to thank for my being Mexican? Well, my father mainly, along with everyone who's ever called me that, among other names and quite a few slurs. That list goes on far too long to write, and all those names come back up like acid in my mouth. I was certainly called Mexican more than I ever felt it. The only thing that's really all that Mexican about me is that I think the word pinche translates to fucking and not dishboy. For being Mexican, I could also blame the Spanish, or mestizaje, or European gold lust, or Cortez. Smallpox, American one-drop rules, the...