Synthetic Biology Tools Research Articles

CpPosNeg: A positive-negative selection strategy allowing multiple cycles of marker-free engineering of the Chlamydomonas plastome.

The chloroplast represents an attractive compartment for light-driven biosynthesis of recombinant products, and advanced synthetic biology tools are available for engineering the chloroplast genome ( =plastome) of several algal and plant species. However, producing commercial lines will likely require several plastome manipulations. This presents issues with respect to selectable markers, since there are a limited number available, they can be used only once in a serial engineering strategy, and it is undesirable to retain marker genes for antibiotic resistance in the final transplastome. To address these problems, we have designed a rapid iterative selection system, known as CpPosNeg, for the green microalga Chlamydomonas reinhardtii that allows creation of marker-free transformants starting from wild-type strains. The system employs a dual markerencoding a fusion protein of E. coli aminoglycoside adenyltransferase (AadA: conferring spectinomycin resistance) and a variant of E. coli cytosine deaminase (CodA: conferring sensitivity to 5-fluorocytosine). Initial selection on spectinomycin allows stable transformants to be established and driven to homoplasmy. Subsequent selection on 5-fluorocytosine results in rapid loss of the dual marker through intramolecular recombination between the 3'UTR of the marker and the 3'UTR of the introduced transgene. We demonstrate the versatility of the CpPosNeg system by serial introduction of reporter genes into the plastome.

Synthetic biology and bioelectrochemical tools for electrogenetic system engineering

Synthetic biology research and its industrial applications rely on deterministic spatiotemporal control of gene expression. Recently, electrochemical control of gene expression has been demonstrated in electrogenetic systems (redox-responsive promoters used alongside redox inducers and electrodes), allowing for the direct integration of electronics with biological processes. However, the use of electrogenetic systems is limited by poor activity, tunability, and standardization. In this work, we developed a strong, unidirectional, redox-responsive promoter before deriving a mutant promoter library with a spectrum of strengths. We constructed genetic circuits with these parts and demonstrated their activation by multiple classes of redox molecules. Last, we demonstrated electrochemical activation of gene expression under aerobic conditions using a novel, modular bioelectrochemical device. These genetic and electrochemical tools facilitate the design and improve the performance of electrogenetic systems. Furthermore, the genetic design strategies used can be applied to other redox-responsive promoters to further expand the available tools for electrogenetics.

Synthetic Biology Tools for Engineering Microbial Cells to Fight Superbugs.

With the increase in clinical cases of bacterial infections with multiple antibiotic resistance, the world has entered a health crisis. Overuse, inappropriate prescribing, and lack of innovation of antibiotics have contributed to the surge of microorganisms that can overcome traditional antimicrobial treatments. In 2017, the World Health Organization published a list of pathogenic bacteria, including Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Escherichia coli (ESKAPE). These bacteria can adapt to multiple antibiotics and transfer their resistance to other organisms; therefore, studies to find new therapeutic strategies are needed. One of these strategies is synthetic biology geared toward developing new antimicrobial therapies. Synthetic biology is founded on a solid and well-established theoretical framework that provides tools for conceptualizing, designing, and constructing synthetic biological systems. Recent developments in synthetic biology provide tools for engineering synthetic control systems in microbial cells. Applying protein engineering, DNA synthesis, and in silico design allows building metabolic pathways and biological circuits to control cellular behavior. Thus, synthetic biology advances have permitted the construction of communication systems between microorganisms where exogenous molecules can control specific population behaviors, induce intracellular signaling, and establish co-dependent networks of microorganisms.

Analysis of Xylose Operon from Paenibacillus polymyxa ATCC842 and Development of Tools for Gene Expression.

With numerous industrial applications, Paenibacillus polymyxa has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression elements in P. polymyxa have not been systematically investigated, genetic modification on account of a specific metabolism pathway for the strain is limited. In this study, a xylose-inducible operon in the xylan-utilizing bacterium ATCC842 was identified, and the relative operon transcription was increased to 186-fold in the presence of xylose, while the relative enhanced green fluorescent protein (eGFP) fluorescence intensity was promoted by over four-fold. By contrast, glucose downregulated the operon to 0.5-fold that of the control. The binding site of the operon was “ACTTAGTTTAAGCAATAGACAAAGT”, and this can be degenerated to “ACTTWGTTTAWSSNATAVACAAAGT” in Paenibacillus spp., which differs from that in the Bacillus spp. xylose operon. The xylose operon binding site was transplanted to the constitutive promoter Pshuttle-09. The eGFP fluorescence intensity assay indicated that both the modified and original Pshuttle-09 had similar expression levels after induction, and the expression level of the modified promoter was decreased to 19.8% without induction. This research indicates that the operon has great potential as an ideal synthetic biology tool in Paenibacillus spp. that can dynamically regulate its gene circuit strength through xylose.

Cyanobacterial secondary metabolites towards improved commercial significance through multiomics approaches.

Cyanobacteria are ubiquitous photosynthetic prokaryotes responsible for the oxygenation of the earth's reducing atmosphere. Apart from oxygen they are producers of a myriad of bioactive metabolites with diverse complex chemical structures and robust biological activities. These secondary metabolites are known to have a variety of medicinal and therapeutic applications ranging from anti-microbial, anti-viral, anti-inflammatory, anti-cancer, and immunomodulating properties. The present review discusses various aspects of secondary metabolites viz. biosynthesis, types and applications, which highlights the repertoire of bioactive constituents they harbor. Majority of these products have been produced from only a handful of genera. Moreover, with the onset of various OMICS approaches, cyanobacteria have become an attractive chassis for improved secondary metabolites production. Also the intervention of synthetic biology tools such as gene editing technologies and a variety of metabolomics and fluxomics approaches, used for engineering cyanobacteria, have significantly enhanced the production of secondary metabolites.

Natural variation meets synthetic biology: Promiscuous trichome-expressed acyltransferases from Nicotiana.

Acylsugars are defensive, trichome-synthesized sugar esters produced in plants across the Solanaceae (nightshade) family. Although assembled from simple metabolites and synthesized by a relatively short core biosynthetic pathway, tremendous within- and across-species acylsugar structural variation is documented across the family. To advance our understanding of the diversity and the synthesis of acylsugars within the Nicotiana genus, trichome extracts were profiled across the genus coupled with transcriptomics-guided enzyme discovery and in vivo and in vitro analysis. Differences in the types of sugar cores, numbers of acylations, and acyl chain structures contributed to over 300 unique annotated acylsugars throughout Nicotiana. Placement of acyl chain length into a phylogenetic context revealed that an unsaturated acyl chain type was detected in a few closely related species. A comparative transcriptomics approach identified trichome-enriched Nicotiana acuminata acylsugar biosynthetic candidate enzymes. More than 25 acylsugar variants could be produced in a single enzyme assay with four N. acuminata acylsugar acyltransferases (NacASAT1-4) together with structurally diverse acyl-CoAs and sucrose. Liquid chromatography coupled with mass spectrometry screening of in vitro products revealed the ability of these enzymes to make acylsugars not present in Nicotiana plant extracts. In vitro acylsugar production also provided insights into acyltransferase acyl donor promiscuity and acyl acceptor specificity as well as regiospecificity of some ASATs. This study suggests that promiscuous Nicotiana acyltransferases can be used as synthetic biology tools to produce novel and potentially useful metabolites.

Metabolic Engineering Strategies for Improved Lipid Production and Cellular Physiological Responses in Yeast Saccharomyces cerevisiae

Microbial lipids have been a hot topic in the field of metabolic engineering and synthetic biology due to their increased market and important applications in biofuels, oleochemicals, cosmetics, etc. This review first compares the popular hosts for lipid production and explains the four modules for lipid synthesis in yeast, including the fatty acid biosynthesis module, lipid accumulation module, lipid sequestration module, and fatty acid modification module. This is followed by a summary of metabolic engineering strategies that could be used for enhancing each module for lipid production. In addition, the efforts being invested in improving the production of value-added fatty acids in engineered yeast, such as cyclopropane fatty acid, ricinoleic acid, gamma linoleic acid, EPA, and DHA, are included. A discussion is further made on the potential relationships between lipid pathway engineering and consequential changes in cellular physiological properties, such as cell membrane integrity, intracellular reactive oxygen species level, and mitochondrial membrane potential. Finally, with the rapid development of synthetic biology tools, such as CRISPR genome editing tools and machine learning models, this review proposes some future trends that could be employed to engineer yeast with enhanced intracellular lipid production while not compromising much of its cellular health.

Polyhydroxybutyrate (PHB) production from crude glycerol by genetic engineering of Rhodotorula glutinis

Polyhydroxybutyrate (PHB) is a member of the Polyhydroxyalkanoates (PHAs) family, which is generally produced through microbial biosynthesis. The synthetic biology tools are applied to transform PHB genes (PhaA, PhaB and PhaC) into an oleaginous yeast (Rhodotorula glutinis) genome. Western blot analysis confirms the expression of PhaA, PhaB and PhaC in the candidate transformants. The strain of R. glutinis #100–29 was selected to be the best PHB production candidate according to the shaker results. As compared to glucose, crude glycerol was known to be a suitable carbon source for R. glutinis cultivation. The PHB concentration, yield and content obtained in a 5-L fermenter using 30 g/L of crude glycerol were 2.87 g/L, 95.53 mg/g and 62% respectively. To the best of our knowledge, these should be the highest numbers obtained in yeast for PHB production, which indicates that strain #100–29 could be a potential PHB producer from crude glycerol.

Development and characterization of a glycine biosensor system for fine-tuned metabolic regulation in Escherichia coli

BackgroundIn vivo biosensors have a wide range of applications, ranging from the detection of metabolites to the regulation of metabolic networks, providing versatile tools for synthetic biology and metabolic engineering. However, in view of the vast array of metabolite molecules, the existing number and performance of biosensors is far from sufficient, limiting their potential applications in metabolic engineering. Therefore, we developed the synthetic glycine-ON and -OFF riboswitches for metabolic regulation and directed evolution of enzyme in Escherichia coli.ResultsThe results showed that a synthetic glycine-OFF riboswitch (glyOFF6) and an increased-detection-range synthetic glycine-ON riboswitch (glyON14) were successfully screened from a library based on the Bacillus subtilis glycine riboswitch using fluorescence-activated cell sorting (FACS) and tetA-based dual genetic selection. The two synthetic glycine riboswitches were successfully used in tunable regulation of lactate synthesis, dynamic regulation of serine synthesis and directed evolution of alanine-glyoxylate aminotransferase in Escherichia coli, respectively. Mutants AGXT22 and AGXT26 of alanine-glyoxylate aminotransferase with an increase of 58% and 73% enzyme activity were obtained by using a high-throughput screening platform based on the synthetic glycine-OFF riboswitch, and successfully used to increase the 5-aminolevulinic acid yield of engineered Escherichia coli.ConclusionsA synthetic glycine-OFF riboswitch and an increased-detection-range synthetic glycine-ON riboswitch were successfully designed and screened. The developed riboswitches showed broad application in tunable regulation, dynamic regulation and directed evolution of enzyme in E. coli.

Emerging Biosensing Technologies for the Diagnostics of Viral Infectious Diseases.

Several viral infectious diseases appear limitless since the beginning of the 21st century, expanding into pandemic lengths. Thus, there are extensive efforts to provide more efficient means of diagnosis, a better understanding of acquired immunity, and improved monitoring of inflammatory biomarkers, as these are all crucial for controlling the spread of infection while aiding in vaccine development and improving patient outcomes. In this regard, various biosensors have been developed recently to streamline pathogen and immune response detection by addressing the limitations of traditional methods, including isothermal amplification-based systems and lateral flow assays. This review explores state-of-the-art biosensors for detecting viral pathogens, serological assays, and inflammatory biomarkers from the material perspective, by discussing their advantages, limitations, and further potential regarding their analytical performance, clinical utility, and point-of-care adaptability. Additionally, next-generation biosensing technologies that offer better sensitivity and selectivity, and easy handling for end-users are highlighted. An emerging example of these next-generation biosensors are those powered by novel synthetic biology tools, such as clustered regularly interspaced short palindromic repeats (CRISPR) with CRISPR-associated proteins (Cas), in combination with integrated point-of-care devices. Lastly, the current challenges are discussed and a roadmap for furthering these advanced biosensing technologies to manage future pandemics is provided.

Parameterized Computational Framework for the Description and Design of Genetic Circuits of Morphogenesis Based on Contact-Dependent Signaling and Changes in Cell-Cell Adhesion.

Synthetic development is a nascent field of research that uses the tools of synthetic biology to design genetic programs directing cellular patterning and morphogenesis in higher eukaryotic cells, such as mammalian cells. One specific example of such synthetic genetic programs was based on cell-cell contact-dependent signaling using synthetic Notch pathways and was shown to drive the formation of multilayered spheroids by modulating cell-cell adhesion via differential expression of cadherin family proteins in a mouse fibroblast cell line (L929). The design method for these genetic programs relied on trial and error, which limited the number of possible circuits and parameter ranges that could be explored. Here, we build a parameterized computational framework that, given a cell-cell communication network driving changes in cell adhesion and initial conditions as inputs, predicts developmental trajectories. We first built a general computational framework where contact-dependent cell-cell signaling networks and changes in cell-cell adhesion could be designed in a modular fashion. We then used a set of available in vitro results (that we call the "training set" in analogy to similar pipelines in the machine learning field) to parameterize the computational model with values for adhesion and signaling. We then show that this parameterized model can qualitatively predict experimental results from a "testing set" of available in vitro data that varied the genetic network in terms of adhesion combinations, initial number of cells, and even changes to the network architecture. Finally, this parameterized model is used to recommend novel network implementation for the formation of a four-layered structure that has not been reported previously. The framework that we develop here could function as a testing ground to identify the reachable space of morphologies that can be obtained by controlling contact-dependent cell-cell communications and adhesion with these molecular tools and in this cellular system. Additionally, we discuss how the model could be expanded to include other forms of communication or effectors for the computational design of the next generation of synthetic developmental trajectories.

Modern mannan: a hemicellulose's journey.

Hemicellulosic polysaccharides built of β-1,4-linked mannose units have been found throughout the plant kingdom and have numerous industrial applications. Here, I review recent advances in the biosynthesis and modification of plant β-mannans. These matrix polymers can associate with cellulose bundles to impact the mechanical properties of plant fibers or biocomposites. In certain algae, mannan microfibrils even replace cellulose as the dominant structural component of the cell wall. Conversely, patterned galactoglucomannan found in Arabidopsis thaliana seed mucilage significantly modulates cell wall architecture and abiotic stress tolerance despite its relatively low content. I also discuss the subcellular requirements for β-mannan biosynthesis, the increasing number of carbohydrate-active enzymes involved in this process, and the players that continue to be puzzling. I discuss how cellulose synthase-like enzymes elongate (gluco)mannans in orthogonal hosts and highlight the discoveries of plant enzymes that add specific galactosyl or acetyl decorations. Hydrolytic enzymes such as endo-β-1,4-mannanases have recently been involved in a wide range of biological contexts including seed germination, wood formation, heavy metal tolerance, and defense responses. Synthetic biology tools now provide faster tracks to modulate the increasingly-relevant mannan structures for improved plant traits and bioproducts.

Binary detection of protein and nucleic acid enabled cancer diagnosis through branched hybridization chain reaction

Developing isothermal bio-analyzers for amplified detection of multi-factor diseases like cancer biomarkers (nucleic acid and protein) has facilitated the early diagnosis and clinical theranostics. In light of that, a sensitive detection system was developed assisted by the recognition capability of a functional aptamer followed by cyclic self-assembly of three auxiliary hairpins via branched hybridization chain reaction (b-HCR) performance. In the downstream process, in the presence of hemin, split sequences of a DNAzyme brought in close proximity to facilitate the color alteration of the solution to a green appearance. By ingenious exerting multi-level amplification, the assay empowered sensitive detection of miR-21 and PDGF-BB related cancer biomarkers with LOD values of 10 pM and 40 nM, respectively. Taken together, simplicity, enzyme-free nature, excellent generality, affordable cost without any washing steps and immobilization makes the presented system a promising analytical tool in synthetic biology, designing nanomachines and point-of-care detection in resource-constrained settings.

De novo design and directed folding of disulfide-bridged peptide heterodimers

Peptide heterodimers are prevalent in nature, which are not only functional macromolecules but molecular tools for chemical and synthetic biology. Computational methods have also been developed to design heterodimers of advanced functions. However, these peptide heterodimers are usually formed through noncovalent interactions, which are prone to dissociate and subject to concentration-dependent nonspecific aggregation. Heterodimers crosslinked with interchain disulfide bonds are more stable, but it represents a formidable challenge for both the computational design of heterodimers and the manipulation of disulfide pairing for heterodimer synthesis and applications. Here, we report the design, synthesis and application of interchain disulfide-bridged peptide heterodimers with mutual orthogonality by combining computational de novo designs with a directed disulfide pairing strategy. These heterodimers can be used as not only scaffolds for generating functional molecules but chemical tools or building blocks for protein labeling and construction of crosslinking hybrids. This study thus opens the door for using this unexplored dimeric structure space for many biological applications.

Design and optimization of E. coli artificial genetic circuits for detection of explosive composition 2,4-dinitrotoluene

The detection of mine-based explosives poses a serious threat to the lives of deminers, and carcinogenic residues may cause severe environmental pollution. Whole-cell biosensors that can detect on-site in dangerous or inaccessible environments have great potential to replace conventional methods. Synthetic biology based on engineering modularity serves as a new tool that could be used to engineer microbes to acquire desired functions through artificial design and precise regulation. In this study, we designed artificial genetic circuits in Escherichia coli MG1655 by reconstructing the transcription factor YhaJ-based system to detect explosive composition 2,4-dinitrotoluene (2,4-DNT). These genetic circuits were optimized at the transcriptional, translational, and post-translational levels. The binding affinity of the transcription factor YhaJ with inducer 2,4-DNT metabolites was enhanced via directed evolution, and several activator binding sites were inserted in sensing yqjF promoter (PyqjF) to further improve the output level. The optimized biosensor PyqjF×2-TEV-(mYhaJ + GFP)-Ssr had a maximum induction ratio of 189 with green fluorescent signal output, and it could perceive at least 1 μg/mL 2,4-DNT. Its effective and robust performance was verified in different water samples. Our results demonstrate the use of synthetic biology tools to systematically optimize the performance of sensors for 2,4-DNT detection, that lay the foundation for practical applications.

Synthetic Biology Tool Development Advances Predictable Gene Expression in the Metabolically Versatile Soil Bacterium Rhodopseudomonas palustris.

Harnessing the unique biochemical capabilities of non-model microorganisms would expand the array of biomanufacturing substrates, process conditions, and products. There are non-model microorganisms that fix nitrogen and carbon dioxide, derive energy from light, catabolize methane and lignin-derived aromatics, are tolerant to physiochemical stresses and harsh environmental conditions, store lipids in large quantities, and produce hydrogen. Model microorganisms often only break down simple sugars and require low stress conditions, but they have been engineered for the sustainable manufacture of numerous products, such as fragrances, pharmaceuticals, cosmetics, surfactants, and specialty chemicals, often by using tools from synthetic biology. Transferring complex pathways has proven to be exceedingly difficult, as the cofactors, cellular conditions, and energy sources necessary for this pathway to function may not be present in the host organism. Utilization of unique biochemical capabilities could also be achieved by engineering the host; although, synthetic biology tools developed for model microbes often do not perform as designed in other microorganisms. The metabolically versatile Rhodopseudomonas palustris CGA009, a purple non-sulfur bacterium, catabolizes aromatic compounds derived from lignin in both aerobic and anaerobic conditions and can use light, inorganic, and organic compounds for its source of energy. R. palustris utilizes three nitrogenase isozymes to fulfill its nitrogen requirements while also generating hydrogen. Furthermore, the bacterium produces two forms of RuBisCo in response to carbon dioxide/bicarbonate availability. While this potential chassis harbors many beneficial traits, stable heterologous gene expression has been problematic due to its intrinsic resistance to many antibiotics and the lack of synthetic biology parts investigated in this microbe. To address these problems, we have characterized gene expression and plasmid maintenance for different selection markers, started a synthetic biology toolbox specifically for the photosynthetic R. palustris, including origins of replication, fluorescent reporters, terminators, and 5′ untranslated regions, and employed the microbe’s endogenous plasmid for exogenous protein production. This work provides essential synthetic biology tools for engineering R. palustris’ many unique biochemical processes and has helped define the principles for expressing heterologous genes in this promising microbe through a methodology that could be applied to other non-model microorganisms.

Nitrogen Metabolism in Pseudomonas putida: Functional Analysis Using Random Barcode Transposon Sequencing.

Pseudomonas putida KT2440 has long been studied for its diverse and robust metabolisms, yet many genes and proteins imparting these growth capacities remain uncharacterized. Using pooled mutant fitness assays, we identified genes and proteins involved in the assimilation of 52 different nitrogen containing compounds. To assay amino acid biosynthesis, 19 amino acid drop-out conditions were also tested. From these 71 conditions, significant fitness phenotypes were elicited in 672 different genes including 100 transcriptional regulators and 112 transport-related proteins. We divide these conditions into 6 classes, and propose assimilatory pathways for the compounds based on this wealth of genetic data. To complement these data, we characterize the substrate range of three promiscuous aminotransferases relevant to metabolic engineering efforts in vitro. Furthermore, we examine the specificity of five transcriptional regulators, explaining some fitness data results and exploring their potential to be developed into useful synthetic biology tools. In addition, we use manifold learning to create an interactive visualization tool for interpreting our BarSeq data, which will improve the accessibility and utility of this work to other researchers. IMPORTANCE Understanding the genetic basis of P. putida's diverse metabolism is imperative for us to reach its full potential as a host for metabolic engineering. Many target molecules of the bioeconomy and their precursors contain nitrogen. This study provides functional evidence linking hundreds of genes to their roles in the metabolism of nitrogenous compounds, and provides an interactive tool for visualizing these data. We further characterize several aminotransferases, lactamases, and regulators, which are of particular interest for metabolic engineering.

Internal Transcription Terminators Control Stoichiometry of ABC Transporters in Cellulolytic Clostridia.

ABSTRACTThe extracellular substrate-binding proteins (SBPs) of ATP-binding cassette (ABC) importers tend to be expressed in excess relative to their cognate translocators, but how the stoichiometry of ABC transporters is controlled remains unclear. Here, we elucidated a mechanism contributing to differential gene expression in operons encoding ABC importers by employing cellulolytic Clostridia species, specifically Ruminiclostridium cellulolyticum. We found that there were usually stem-loop structures downstream of SBP genes, which could prematurely terminate the transcription of ABC importers and were putative internal intrinsic terminators, resulting in high transcript levels of upstream SBP genes and low transcript levels of downstream cognate translocator genes. This was determined by their termination efficiencies. Internal terminators had a lower U content in their 3′ U-rich tracts and longer GC-rich stems, which distinguishes them from canonical terminators and potentially endows them with special termination efficiencies. The pairing of U-rich tracts and the formation of unpaired regions in these internal terminators contributed to their folding energies, affecting the stability of their upstream SBP transcripts. Our findings revealed a strategy of internal transcriptional terminators controlling in vivo stoichiometry of their flanking transcripts.IMPORTANCE Operons encoding protein complexes or metabolic pathways usually require fine-tuned gene expression ratios to create and maintain the appropriate stoichiometry for biological functions. In this study, a strategy for controlling differential expression of genes in an operon was proposed by utilizing ABC importers from Ruminiclostridium cellulolyticum. We found that a stem-loop structure is introduced into the intergenic regions of operons encoding ABC importers as the putative internal terminator, which results in the premature termination of transcription. Consequently, the stoichiometric ratio of genes flanking terminators is precisely determined by their termination efficiencies and folding energies at the transcriptional level. Thus, it can be utilized as a promising synthetic biology tool to control the differential expression of genes in an operon.

Synthetic Biology Approaches for Improving Chemical Production in Cyanobacteria

Biological chemical production has gained traction in recent years as a promising renewable alternative to traditional petrochemical based synthesis. Of particular interest in the field of metabolic engineering are photosynthetic microorganisms capable of sequestering atmospheric carbon dioxide. CO2 levels have continued to rise at alarming rates leading to an increasingly uncertain climate. CO2 can be sequestered by engineered photosynthetic microorganisms and used for chemical production, representing a renewable production method for valuable chemical commodities such as biofuels, plastics, and food additives. The main challenges in using photosynthetic microorganisms for chemical production stem from the seemingly inherent limitations of carbon fixation and photosynthesis resulting in slower growth and lower average product titers compared to heterotrophic organisms. Recently, there has been an increase in research around improving photosynthetic microorganisms as renewable chemical production hosts. This review will discuss the various efforts to overcome the intrinsic inefficiencies of carbon fixation and photosynthesis, including rewiring carbon fixation and photosynthesis, investigating alternative carbon fixation pathways, installing sugar catabolism to supplement carbon fixation, investigating newly discovered fast growing photosynthetic species, and using new synthetic biology tools such as CRISPR to radically alter metabolism.

Field validation of the performance of paper-based tests for the detection of the Zika and chikungunya viruses in serum samples

In low-resource settings, resilience to infectious disease outbreaks can be hindered by limited access to diagnostic tests. Here we report the results of double-blinded studies of the performance of paper-based diagnostic tests for the Zika and chikungunya viruses in a field setting in Latin America. The tests involved a cell-free expression system relying on isothermal amplification and toehold-switch reactions, a purpose-built portable reader and onboard software for computer vision-enabled image analysis. In patients suspected of infection, the accuracies and sensitivities of the tests for the Zika and chikungunya viruses were, respectively, 98.5% (95% confidence interval, 96.2–99.6%, 268 serum samples) and 98.5% (95% confidence interval, 91.7–100%, 65 serum samples) and approximately 2 aM and 5 fM (both concentrations are within clinically relevant ranges). The analytical specificities and sensitivities of the tests for cultured samples of the viruses were equivalent to those of the real-time quantitative PCR. Cell-free synthetic biology tools and companion hardware can provide de-centralized, high-capacity and low-cost diagnostics for use in low-resource settings.